The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	0	19926	5043703	plate,tail	Burkholderia_virus(42.11%)	24	NA	NA
AWO23341.1|530_989_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AWO23342.1|1203_2319_+	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AWO23343.1|2333_3287_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AWO23344.1|3296_3635_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AWO23345.1|3636_4083_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AWO23346.1|4082_4547_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AWO23347.1|4543_4798_+	hypothetical protein	NA	NA	NA	NA	NA
AWO23348.1|4787_6215_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AWO23349.1|6214_6736_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AWO23350.1|6738_7020_+	hypothetical protein	NA	NA	NA	NA	NA
AWO23351.1|7117_7453_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWO23352.1|7376_7535_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AWO23353.1|10823_11708_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AWO23354.1|11704_11920_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AWO23355.1|11907_13080_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
AWO23356.1|13076_13673_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
AWO23357.1|13727_14075_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
AWO23358.1|14065_15169_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
AWO23359.1|15161_15740_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AWO23360.1|15742_17665_+	short-chain fatty acid transporter	NA	A0A0K2FIZ6	Escherichia_phage	44.8	6.9e-40
AWO23361.1|17675_18149_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AWO23362.1|18155_18770_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AWO23363.1|18769_19294_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
AWO23364.1|19353_19926_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
>prophage 2
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	26576	28529	5043703		Vibrio_phage(100.0%)	1	NA	NA
AWO27981.1|26576_28529_-	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 3
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	49753	51225	5043703	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AWO23410.1|49753_50701_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AWO23411.1|50715_51225_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 4
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	61565	62324	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO23419.1|61565_62324_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 5
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	71546	72431	5043703		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWO23427.1|71546_72431_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	9.2e-24
>prophage 6
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	77767	82279	5043703		Escherichia_phage(50.0%)	4	NA	NA
AWO23434.1|77767_78598_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
AWO23435.1|78938_79793_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AWO23436.1|79828_80719_+	sugar ABC transporter	NA	NA	NA	NA	NA
AWO23437.1|80779_82279_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
>prophage 7
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	91565	92609	5043703		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWO23447.1|91565_92609_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 8
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	110254	111622	5043703	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWO23463.1|110254_111622_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 9
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	115589	119600	5043703		Pseudomonas_phage(50.0%)	4	NA	NA
AWO23469.1|115589_116087_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
AWO23470.1|116194_116986_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AWO23471.1|117107_118001_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AWO23472.1|118109_119600_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 10
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	128303	143097	5043703		Staphylococcus_phage(25.0%)	17	NA	NA
AWO27984.1|128303_129233_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AWO23479.1|129328_131665_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AWO23480.1|131894_132548_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWO23481.1|132544_133273_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWO23482.1|133269_133902_-	protein YrbL	NA	NA	NA	NA	NA
AWO23483.1|134114_134387_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AWO23484.1|134383_135238_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AWO23485.1|135283_135775_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWO23486.1|135892_136180_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AWO23487.1|136202_137636_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWO23488.1|137683_138409_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AWO23489.1|138415_138973_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWO23490.1|138941_139517_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWO23491.1|139513_140080_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AWO23492.1|140100_141087_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AWO23493.1|141100_142078_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWO23494.1|142287_143097_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 11
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	147165	148648	5043703		Vibrio_phage(50.0%)	2	NA	NA
AWO23499.1|147165_147444_-	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
AWO23500.1|147676_148648_-	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 12
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	155277	158150	5043703	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AWO23509.1|155277_157212_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AWO23510.1|157301_158150_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.6	7.5e-23
>prophage 13
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	162230	168869	5043703		Dickeya_phage(50.0%)	4	NA	NA
AWO23514.1|162230_163574_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AWO27988.1|164204_164657_+	ribosome maturation factor	NA	NA	NA	NA	NA
AWO23515.1|164684_166172_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AWO23516.1|166196_168869_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
>prophage 14
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	174350	176240	5043703		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWO23523.1|174350_176240_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 15
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	181942	189738	5043703		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AWO23529.1|181942_182245_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.0e-14
AWO23530.1|182295_182739_+	hypothetical protein	NA	NA	NA	NA	NA
AWO23531.1|182718_183237_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	4.4e-10
AWO23532.1|183364_184000_+	hypothetical protein	NA	NA	NA	NA	NA
AWO23533.1|184072_185113_+	permease	NA	NA	NA	NA	NA
AWO23534.1|185225_185801_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWO23535.1|185810_186401_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AWO23536.1|186420_186816_-	YraN family protein	NA	NA	NA	NA	NA
AWO23537.1|186773_188810_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWO23538.1|188874_189738_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 16
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	207358	208504	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO23558.1|207358_208504_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 17
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	214658	216953	5043703		Tetraselmis_virus(100.0%)	1	NA	NA
AWO23563.1|214658_216953_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.0e-158
>prophage 18
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	236763	237729	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO23585.1|236763_237729_-	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 19
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	250384	266532	5043703	tRNA	Herpes_simplex_virus(16.67%)	16	NA	NA
AWO23597.1|250384_253477_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.4	2.6e-158
AWO23598.1|253660_254644_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AWO23599.1|254573_254756_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23600.1|254862_255195_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AWO27993.1|255236_256616_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	3.8e-32
AWO27994.1|256551_256758_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23601.1|257033_258554_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.5	4.0e-35
AWO23602.1|258660_259284_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWO23603.1|259571_260336_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWO23604.1|260589_261096_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AWO23605.1|261173_263015_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWO23606.1|263073_263196_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWO23607.1|263209_264955_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.9e-76
AWO23608.1|265065_265281_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWO23609.1|265279_265510_+	hypothetical protein	NA	NA	NA	NA	NA
AWO23610.1|265518_266532_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
>prophage 20
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	272832	274071	5043703		Sinorhizobium_phage(100.0%)	1	NA	NA
AWO23618.1|272832_274071_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.3	2.2e-92
>prophage 21
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	279208	280642	5043703		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWO23622.1|279208_280642_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 22
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	284555	285209	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO23628.1|284555_285209_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 23
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	296448	308894	5043703		Ralstonia_phage(16.67%)	12	NA	NA
AWO23639.1|296448_297609_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	42.9	7.7e-87
AWO23640.1|297614_298286_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AWO27997.1|298173_298437_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23641.1|298433_299915_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AWO23642.1|300119_300749_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AWO23643.1|300749_301172_+	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
AWO23644.1|301196_302024_+	phosphodiesterase	NA	NA	NA	NA	NA
AWO23645.1|302023_302605_+	esterase YqiA	NA	NA	NA	NA	NA
AWO23646.1|302633_304526_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	4.5e-92
AWO23647.1|304589_306731_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWO23648.1|307104_307914_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
AWO23649.1|307910_308894_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.3	5.5e-09
>prophage 24
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	316736	321776	5043703		Stx_converting_phage(50.0%)	4	NA	NA
AWO23658.1|316736_317129_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
AWO23659.1|317181_317664_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO23660.1|317772_319380_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO23661.1|319517_321776_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
>prophage 25
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	329234	336553	5043703		Ostreococcus_tauri_virus(33.33%)	6	NA	NA
AWO23669.1|329234_330707_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	7.6e-47
AWO23670.1|331029_331779_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AWO23671.1|332030_334250_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AWO23672.1|334291_334549_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23673.1|334599_335526_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWO23674.1|335725_336553_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	3.6e-62
>prophage 26
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	342629	343514	5043703		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWO23682.1|342629_343514_-	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 27
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	365726	366899	5043703		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AWO23705.1|365726_366899_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.4	1.2e-39
>prophage 28
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	413672	414692	5043703		Tetraselmis_virus(100.0%)	1	NA	NA
AWO23741.1|413672_414692_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	6.4e-37
>prophage 29
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	422369	425173	5043703		Pseudomonas_phage(50.0%)	5	NA	NA
AWO23749.1|422369_423014_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.0	5.2e-24
AWO23750.1|423032_423254_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWO23751.1|423322_423769_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWO23752.1|423814_424300_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
AWO23753.1|424354_425173_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
>prophage 30
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	440043	447490	5043703	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
AWO23770.1|440043_441582_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
AWO23771.1|442709_443060_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
AWO23772.1|443056_443482_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
AWO23773.1|443509_443713_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28003.1|443853_443991_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23774.1|444142_445060_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AWO23775.1|445093_445969_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AWO23776.1|445981_447490_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.3e-06
>prophage 31
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	452053	457013	5043703	transposase	Stx2-converting_phage(33.33%)	4	NA	NA
AWO23782.1|452053_453043_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
AWO23783.1|453194_454422_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
AWO23784.1|454580_454766_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23785.1|454922_457013_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 32
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	465801	472934	5043703	protease	Pseudomonas_phage(50.0%)	3	NA	NA
AWO23794.1|465801_467325_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWO23795.1|468406_468775_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23796.1|469046_472934_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.8	7.5e-227
>prophage 33
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	483290	484519	5043703	transposase	Shigella_phage(100.0%)	1	NA	NA
AWO23805.1|483290_484519_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
>prophage 34
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	489992	492176	5043703		Pseudomonas_phage(50.0%)	2	NA	NA
AWO23813.1|489992_491516_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWO28004.1|491960_492176_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
>prophage 35
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	498912	500178	5043703		Enterobacteria_phage(100.0%)	1	NA	NA
AWO23819.1|498912_500178_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.1	2.1e-77
>prophage 36
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	522871	524026	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO23846.1|522871_524026_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 37
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	532394	533303	5043703		Yersinia_phage(100.0%)	1	NA	NA
AWO23855.1|532394_533303_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 38
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	539006	539684	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO23863.1|539006_539684_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 39
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	553191	554424	5043703		Catovirus(100.0%)	1	NA	NA
AWO23879.1|553191_554424_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 40
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	562560	567039	5043703		Prochlorococcus_phage(50.0%)	2	NA	NA
AWO23889.1|562560_565434_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
AWO23890.1|565599_567039_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.2e-31
>prophage 41
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	570838	586230	5043703	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
AWO23897.1|570838_571735_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
AWO23898.1|571759_572470_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWO23899.1|572475_574209_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
AWO23900.1|574299_575397_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AWO23901.1|575407_576925_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWO23902.1|576967_577516_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWO23903.1|577638_577764_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23904.1|577765_579214_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	2.1e-25
AWO23905.1|579158_579347_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23906.1|579649_581569_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AWO23907.1|581568_582057_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AWO23908.1|582092_583460_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
AWO23909.1|583495_584815_-	guanine deaminase	NA	NA	NA	NA	NA
AWO23910.1|584829_586230_-	xanthine permease XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 42
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	610508	611264	5043703		Clostridium_phage(100.0%)	1	NA	NA
AWO23928.1|610508_611264_+	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 43
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	615550	618045	5043703		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AWO23932.1|615550_616312_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AWO28007.1|616626_618045_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 44
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	627676	634449	5043703		Moraxella_phage(33.33%)	6	NA	NA
AWO23941.1|627676_628390_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AWO23942.1|628458_629148_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AWO23943.1|629832_630363_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWO23944.1|630375_632622_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AWO23945.1|632772_633648_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWO23946.1|633654_634449_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 45
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	639926	651074	5043703		Klosneuvirus(25.0%)	5	NA	NA
AWO23952.1|639926_642815_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.5	1.2e-67
AWO23953.1|642807_646350_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	5.2e-09
AWO23954.1|646349_648176_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.3e-24
AWO23955.1|648257_649589_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AWO23956.1|649820_651074_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 46
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	654945	659280	5043703	transposase	Tetraselmis_virus(25.0%)	4	NA	NA
AWO23959.1|654945_655542_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
AWO23960.1|655613_656561_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	2.6e-16
AWO23961.1|656977_658519_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AWO23962.1|658533_659280_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 47
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	674435	676949	5043703		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWO23973.1|674435_676949_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
>prophage 48
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	680314	691358	5043703		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWO23977.1|680314_682693_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.7	2.5e-15
AWO23978.1|683156_684014_-	hypothetical protein	NA	NA	NA	NA	NA
AWO23979.1|684010_686374_-	hypothetical protein	NA	A7IYC3	Corynebacterium_phage	27.3	8.8e-05
AWO23980.1|686385_688710_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.7	2.4e-15
AWO23981.1|688721_691358_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
>prophage 49
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	700191	702697	5043703	tRNA	Pandoravirus(50.0%)	3	NA	NA
AWO23989.1|700191_700998_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
AWO23990.1|701048_701492_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWO23991.1|701491_702697_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	7.8e-74
>prophage 50
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	714274	715030	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO24002.1|714274_715030_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 51
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	719888	720737	5043703		Vibrio_phage(100.0%)	1	NA	NA
AWO24006.1|719888_720737_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 52
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	728269	732384	5043703		Hokovirus(50.0%)	2	NA	NA
AWO24014.1|728269_731026_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.4e-54
AWO24015.1|731082_732384_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.0e-38
>prophage 53
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	735780	744005	5043703		Only_Syngen_Nebraska_virus(25.0%)	6	NA	NA
AWO24018.1|735780_737418_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AWO24019.1|737505_738804_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AWO24020.1|738863_739736_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24021.1|740806_741478_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
AWO24022.1|741562_742570_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWO24023.1|742595_744005_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	22.9	1.9e-15
>prophage 54
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	751306	752092	5043703		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWO24029.1|751306_752092_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 55
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	766743	768776	5043703		Hokovirus(50.0%)	2	NA	NA
AWO24044.1|766743_768171_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
AWO24045.1|768170_768776_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.9e-28
>prophage 56
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	771886	775602	5043703		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWO24051.1|771886_772648_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AWO24052.1|772641_773268_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWO24053.1|773407_774547_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWO24054.1|774609_775602_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 57
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	779968	787108	5043703		Escherichia_phage(83.33%)	6	NA	NA
AWO24059.1|779968_780607_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
AWO24060.1|780603_781866_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AWO24061.1|781862_782771_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AWO24062.1|782966_783734_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AWO24063.1|783784_784441_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AWO24064.1|784546_787108_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 58
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	811122	812088	5043703		Tetraselmis_virus(100.0%)	1	NA	NA
AWO24087.1|811122_812088_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.6	2.7e-37
>prophage 59
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	817871	823258	5043703	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
AWO24096.1|817871_818369_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	9.8e-31
AWO24097.1|818448_819510_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AWO24098.1|819578_820079_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWO24099.1|820207_822838_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	9.3e-80
AWO24100.1|823072_823258_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 60
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	837999	843296	5043703		Bacillus_virus(20.0%)	6	NA	NA
AWO24115.1|837999_839202_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AWO24116.1|839191_839440_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24117.1|839557_840517_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	1.4e-134
AWO24118.1|840526_842671_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
AWO24119.1|842643_843054_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AWO24120.1|843050_843296_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 61
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	847230	851281	5043703		Clostridium_phage(50.0%)	4	NA	NA
AWO24128.1|847230_847680_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
AWO24129.1|847680_848343_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AWO24130.1|848363_849764_-	GABA permease	NA	NA	NA	NA	NA
AWO24131.1|850000_851281_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
>prophage 62
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	856291	856774	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO24135.1|856291_856774_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 63
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	870404	871475	5043703		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWO24151.1|870404_871475_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 64
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	877380	879954	5043703		Enterobacteria_phage(100.0%)	1	NA	NA
AWO24159.1|877380_879954_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 65
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	885738	887037	5043703		Burkholderia_virus(100.0%)	1	NA	NA
AWO24161.1|885738_887037_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
>prophage 66
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	892330	898413	5043703	tRNA	Achromobacter_phage(25.0%)	8	NA	NA
AWO24165.1|892330_892750_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWO24166.1|892763_892967_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24167.1|892956_893994_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWO24168.1|894041_894731_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AWO24169.1|895035_895419_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AWO24170.1|895474_896062_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWO28020.1|896164_897046_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWO24171.1|897078_898413_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 67
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	904184	907926	5043703		Tupanvirus(50.0%)	4	NA	NA
AWO24178.1|904184_905984_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AWO24179.1|905999_906974_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWO24180.1|907023_907302_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24181.1|907245_907926_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 68
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	911385	911646	5043703		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWO24188.1|911385_911646_-	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	6.5e-18
>prophage 69
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	915765	927074	5043703		Bacillus_phage(50.0%)	7	NA	NA
AWO24194.1|915765_919653_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.1e-129
AWO24195.1|920228_921656_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
AWO24196.1|921820_922534_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWO24197.1|922523_923858_+	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AWO24198.1|923918_924257_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AWO24199.1|924301_925492_-	flavohemoprotein	NA	NA	NA	NA	NA
AWO24200.1|925820_927074_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 70
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	932832	934362	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO24204.1|932832_934362_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	22.6	7.0e-11
>prophage 71
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	944347	950685	5043703		Faustovirus(20.0%)	8	NA	NA
AWO24214.1|944347_945562_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AWO24215.1|945589_945976_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AWO24216.1|945992_946316_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AWO24217.1|946411_946927_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AWO24218.1|946943_948794_+	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AWO24219.1|948795_949131_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWO24220.1|949142_949343_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWO24221.1|949401_950685_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 72
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	960570	961002	5043703		Powai_lake_megavirus(100.0%)	1	NA	NA
AWO24226.1|960570_961002_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 73
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	981495	987966	5043703		Escherichia_phage(66.67%)	8	NA	NA
AWO24238.1|981495_982863_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	2.3e-42
AWO24239.1|983024_984491_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AWO24240.1|984559_986137_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWO24241.1|986229_986769_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AWO24242.1|986784_987303_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AWO24243.1|987405_987543_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AWO24244.1|987604_987796_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AWO24245.1|987813_987966_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
>prophage 74
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	994213	998215	5043703		Prochlorococcus_phage(33.33%)	5	NA	NA
AWO24249.1|994213_994852_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AWO24250.1|994851_995889_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.8e-71
AWO24251.1|995907_996093_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24252.1|996213_996840_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWO24253.1|996925_998215_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
>prophage 75
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1005693	1006407	5043703		Synechococcus_phage(100.0%)	1	NA	NA
AWO24262.1|1005693_1006407_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 76
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1023648	1024599	5043703		Cyanophage(100.0%)	1	NA	NA
AWO24275.1|1023648_1024599_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 77
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1043253	1064981	5043703		Streptococcus_phage(25.0%)	22	NA	NA
AWO24293.1|1043253_1044123_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
AWO24294.1|1044336_1044762_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWO24295.1|1044748_1045198_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AWO24296.1|1045258_1045834_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWO24297.1|1045929_1046829_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AWO24298.1|1047006_1048431_-	PTS N-acetylmuramic acid transporter subunits IIBC	NA	NA	NA	NA	NA
AWO24299.1|1048434_1049331_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AWO24300.1|1049610_1050402_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
AWO24301.1|1050559_1051576_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO24302.1|1051575_1052409_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AWO24303.1|1052408_1053284_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AWO24304.1|1053273_1054371_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AWO24305.1|1054505_1055417_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
AWO24306.1|1055419_1055788_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24307.1|1055892_1056744_+	pyridoxine kinase	NA	NA	NA	NA	NA
AWO24308.1|1056786_1057296_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWO24309.1|1057336_1059064_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AWO24310.1|1059108_1059366_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWO24311.1|1059749_1060721_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AWO24312.1|1060905_1061667_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWO24313.1|1061896_1062895_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWO24314.1|1062965_1064981_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	5.0e-150
>prophage 78
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1090519	1091254	5043703		Clostridioides_phage(100.0%)	1	NA	NA
AWO24338.1|1090519_1091254_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 79
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1095073	1095994	5043703		Morganella_phage(100.0%)	1	NA	NA
AWO24341.1|1095073_1095994_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 80
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1099683	1107260	5043703		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AWO24346.1|1099683_1101378_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
AWO24347.1|1101447_1102392_+	transporter YfdV	NA	NA	NA	NA	NA
AWO24348.1|1102465_1103611_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AWO24349.1|1103666_1107260_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
>prophage 81
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1115623	1117794	5043703		Klebsiella_phage(33.33%)	4	NA	NA
AWO24356.1|1115623_1115845_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
AWO28027.1|1115907_1116354_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWO24357.1|1116398_1116884_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
AWO24358.1|1116975_1117794_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.7e-46
>prophage 82
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1128743	1129346	5043703	integrase	Clostridioides_phage(100.0%)	1	1122915:1122928	1130590:1130603
1122915:1122928	attL	TTTTGTAAGAACTC	NA	NA	NA	NA
AWO24364.1|1128743_1129346_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
AWO24364.1|1128743_1129346_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
1130590:1130603	attR	GAGTTCTTACAAAA	NA	NA	NA	NA
>prophage 83
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1133919	1138152	5043703	transposase	Stx2-converting_phage(60.0%)	5	NA	NA
AWO24367.1|1133919_1134942_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWO24368.1|1134938_1135616_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	93.6	1.5e-98
AWO24369.1|1135536_1137108_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.1	1.2e-167
AWO24370.1|1137127_1137475_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWO24371.1|1137474_1138152_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 84
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1152414	1153242	5043703		Powai_lake_megavirus(100.0%)	1	NA	NA
AWO24390.1|1152414_1153242_-	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	29.2	5.3e-05
>prophage 85
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1161156	1162181	5043703		Stx2-converting_phage(100.0%)	2	NA	NA
AWO24396.1|1161156_1161834_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
AWO24397.1|1161833_1162181_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 86
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1169742	1170886	5043703	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AWO24402.1|1169742_1170886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.3	2.0e-66
>prophage 87
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1189842	1192291	5043703		Enterobacteria_phage(100.0%)	2	NA	NA
AWO24413.1|1189842_1191033_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.3	7.6e-130
AWO24414.1|1191358_1192291_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
>prophage 88
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1209200	1210286	5043703		Pandoravirus(100.0%)	1	NA	NA
AWO24431.1|1209200_1210286_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 89
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1218822	1219959	5043703		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWO24440.1|1218822_1219959_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
>prophage 90
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1226617	1228135	5043703		Mollivirus(100.0%)	1	NA	NA
AWO24448.1|1226617_1228135_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	1.6e-87
>prophage 91
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1232346	1233120	5043703		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWO24454.1|1232346_1233120_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 92
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1243790	1247018	5043703		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AWO24466.1|1243790_1244441_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
AWO24467.1|1244527_1246360_+	SLC13 family permease	NA	NA	NA	NA	NA
AWO24468.1|1246418_1247018_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 93
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1281979	1286983	5043703		Tupanvirus(50.0%)	4	NA	NA
AWO24501.1|1281979_1283962_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
AWO24502.1|1283961_1284930_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
AWO24503.1|1284933_1286073_-	UDP-4-amino-4-deoxy-L-arabinose-oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.8	4.2e-29
AWO24504.1|1286380_1286983_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 94
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1290586	1295253	5043703	transposase	Oenococcus_phage(50.0%)	5	NA	NA
AWO28034.1|1290586_1291792_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
AWO24509.1|1291848_1293138_+	MFS transporter	NA	NA	NA	NA	NA
AWO24510.1|1293155_1293959_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AWO24511.1|1293999_1294245_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24512.1|1294257_1295253_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.1	1.8e-68
>prophage 95
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1301145	1314963	5043703		Pseudomonas_phage(33.33%)	8	NA	NA
AWO24517.1|1301145_1302222_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AWO24518.1|1302424_1303075_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24519.1|1303128_1303383_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AWO24520.1|1303382_1304513_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AWO24521.1|1304601_1306887_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AWO28035.1|1307568_1311327_+	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	26.6	1.3e-21
AWO24522.1|1311466_1312189_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AWO24523.1|1312335_1314963_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	1.1e-91
>prophage 96
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1329886	1334729	5043703		Bacillus_phage(50.0%)	2	NA	NA
AWO24534.1|1329886_1331713_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
AWO24535.1|1331879_1334729_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
>prophage 97
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1339006	1344802	5043703		Enterobacteria_phage(25.0%)	5	NA	NA
AWO24540.1|1339006_1340128_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	2.0e-116
AWO24541.1|1340239_1341295_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWO24542.1|1341368_1342433_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
AWO24543.1|1342432_1343083_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
AWO24544.1|1343158_1344802_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.6e-13
>prophage 98
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1353564	1354188	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO24555.1|1353564_1354188_+	heme ABC transporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 99
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1364246	1371896	5043703		Vibrio_phage(50.0%)	7	NA	NA
AWO24568.1|1364246_1365254_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
AWO24569.1|1365392_1365677_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWO24570.1|1365801_1367562_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	4.9e-101
AWO24571.1|1367711_1368407_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AWO24572.1|1368434_1369625_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
AWO24573.1|1369958_1370303_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24574.1|1370306_1371896_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	2.5e-19
>prophage 100
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1377650	1381951	5043703		Clostridioides_phage(50.0%)	4	NA	NA
AWO24579.1|1377650_1378217_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AWO24580.1|1378628_1379342_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24581.1|1379380_1380367_-	GTP-binding protein	NA	NA	NA	NA	NA
AWO24582.1|1380484_1381951_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.3e-43
>prophage 101
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1395339	1396197	5043703		Catovirus(100.0%)	1	NA	NA
AWO24595.1|1395339_1396197_-	endonuclease	NA	A0A1V0SBL9	Catovirus	35.0	3.1e-24
>prophage 102
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1400265	1404051	5043703	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AWO24600.1|1400265_1402257_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
AWO24601.1|1402288_1403125_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AWO24602.1|1403052_1403229_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24603.1|1403285_1403399_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWO24604.1|1403382_1404051_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 103
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1407745	1409266	5043703		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWO24609.1|1407745_1409266_+	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 104
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1429626	1437938	5043703		Enterobacteria_phage(83.33%)	9	NA	NA
AWO24628.1|1429626_1430553_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
AWO24629.1|1430557_1431289_+	ABC transporter permease	NA	NA	NA	NA	NA
AWO24630.1|1431269_1431377_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24631.1|1431436_1432168_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AWO24632.1|1432389_1434075_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWO24633.1|1434071_1434791_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWO24634.1|1434837_1435308_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWO24635.1|1435348_1435810_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AWO24636.1|1435934_1437938_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
>prophage 105
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1454876	1456910	5043703	tRNA	Indivirus(100.0%)	1	NA	NA
AWO24642.1|1454876_1456910_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 106
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1467559	1471116	5043703		Paenibacillus_phage(50.0%)	4	NA	NA
AWO24654.1|1467559_1468378_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
AWO24655.1|1468429_1469176_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWO24656.1|1469149_1470115_-	sugar kinase	NA	NA	NA	NA	NA
AWO24657.1|1470111_1471116_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 107
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1480255	1486529	5043703		Bacillus_phage(50.0%)	6	NA	NA
AWO24667.1|1480255_1481155_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
AWO24668.1|1481569_1481887_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24669.1|1482386_1483748_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
AWO24670.1|1483894_1484227_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWO24671.1|1484406_1485129_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AWO24672.1|1485125_1486529_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 108
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1500300	1501653	5043703		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWO24680.1|1500300_1501653_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 109
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1506379	1516947	5043703		Catovirus(40.0%)	8	NA	NA
AWO24683.1|1506379_1507021_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AWO24684.1|1507112_1507694_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AWO24685.1|1507715_1509569_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWO24686.1|1510020_1511604_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AWO24687.1|1512261_1513401_+	lipoprotein	NA	NA	NA	NA	NA
AWO24688.1|1513406_1513850_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWO24689.1|1513852_1516015_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
AWO24690.1|1516107_1516947_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
>prophage 110
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1521191	1527976	5043703		Synechococcus_phage(25.0%)	6	NA	NA
AWO24696.1|1521191_1522313_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AWO24697.1|1522315_1523281_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.4	2.9e-87
AWO24698.1|1523283_1523763_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWO24699.1|1523759_1524974_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AWO24700.1|1524976_1526413_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.3	8.5e-51
AWO24701.1|1526605_1527976_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	3.4e-33
>prophage 111
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1533976	1550227	5043703		Enterobacteria_phage(20.0%)	15	NA	NA
AWO24706.1|1533976_1535371_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
AWO24707.1|1535545_1536439_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWO28042.1|1536811_1537897_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
AWO24708.1|1537896_1538796_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
AWO24709.1|1538853_1539735_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AWO24710.1|1539734_1540292_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AWO24711.1|1540288_1541536_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
AWO24712.1|1541543_1542647_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
AWO24713.1|1542646_1543813_+	O16 family O-antigen polymerase	NA	NA	NA	NA	NA
AWO24714.1|1543815_1544808_+	beta-1,6-galactofuranosyltransferase WbbI	NA	NA	NA	NA	NA
AWO24715.1|1544788_1545379_+	acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	32.6	2.6e-06
AWO24716.1|1545363_1546482_+	glycosyltransferase	NA	NA	NA	NA	NA
AWO24717.1|1546483_1547278_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWO24718.1|1547405_1548812_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
AWO24719.1|1549060_1550227_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.0e-110
>prophage 112
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1557669	1558569	5043703		Cellulophaga_phage(100.0%)	1	NA	NA
AWO24727.1|1557669_1558569_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 113
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1564766	1565933	5043703		Stx2-converting_phage(100.0%)	1	NA	NA
AWO24734.1|1564766_1565933_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 114
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1568975	1575202	5043703	transposase	Acidithiobacillus_phage(20.0%)	10	NA	NA
AWO24738.1|1568975_1570517_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AWO24739.1|1570531_1571278_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AWO28048.1|1571640_1571754_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWO28049.1|1571766_1571958_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24740.1|1571957_1572332_-	toxin CbtA	NA	NA	NA	NA	NA
AWO24741.1|1572420_1572789_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWO24742.1|1572868_1573090_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AWO28047.1|1573152_1573599_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWO24743.1|1573644_1574118_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	8.7e-13
AWO24744.1|1574380_1575202_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.7	2.2e-43
>prophage 115
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1586334	1587102	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO24754.1|1586334_1587102_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	1.7e-13
>prophage 116
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1590613	1592416	5043703	transposase	Escherichia_phage(100.0%)	2	NA	NA
AWO24759.1|1590613_1591636_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	1.1e-198
AWO24760.1|1591771_1592416_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.5	1.4e-114
>prophage 117
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1596211	1598628	5043703	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
AWO24766.1|1596211_1597825_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWO24767.1|1597855_1598206_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWO24768.1|1598202_1598628_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
>prophage 118
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1612994	1614847	5043703		Mycobacterium_phage(50.0%)	2	NA	NA
AWO28052.1|1612994_1614218_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	1.5e-61
AWO24781.1|1614202_1614847_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	1.1e-53
>prophage 119
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1642551	1667207	5043703		Bacillus_phage(40.0%)	8	NA	NA
AWO24805.1|1642551_1652043_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
AWO24806.1|1652130_1658238_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AWO24807.1|1658428_1659388_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AWO24808.1|1659554_1661357_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.4	1.4e-31
AWO24809.1|1661343_1663146_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AWO24810.1|1663138_1664419_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AWO24811.1|1664446_1665751_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AWO24812.1|1665944_1667207_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	38.8	4.1e-73
>prophage 120
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1672397	1684766	5043703		Bacillus_phage(33.33%)	13	NA	NA
AWO28055.1|1672397_1673069_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	1.2e-31
AWO24818.1|1673068_1674427_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWO24819.1|1674534_1675386_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWO24820.1|1675980_1677039_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
AWO24821.1|1677604_1677970_+	permease	NA	NA	NA	NA	NA
AWO24822.1|1678009_1678705_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
AWO24823.1|1678771_1680190_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
AWO24824.1|1680170_1680641_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
AWO24825.1|1680629_1681550_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWO24826.1|1681722_1682640_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWO24827.1|1682718_1682901_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWO28056.1|1682962_1683151_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24828.1|1683071_1684766_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.5	1.9e-17
>prophage 121
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1700749	1701289	5043703	transposase	Helicobacter_phage(100.0%)	1	NA	NA
AWO24851.1|1700749_1701289_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.3	3.3e-32
>prophage 122
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1713805	1714558	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO24865.1|1713805_1714558_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 123
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1726539	1728054	5043703		Cedratvirus(100.0%)	1	NA	NA
AWO24881.1|1726539_1728054_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	2.1e-12
>prophage 124
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1738141	1742410	5043703		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AWO24892.1|1738141_1739803_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWO24893.1|1740093_1740954_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWO24894.1|1740956_1742006_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWO24895.1|1742020_1742410_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 125
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1746917	1748651	5043703	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWO24900.1|1746917_1748651_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 126
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1755138	1757189	5043703		Synechococcus_phage(50.0%)	3	NA	NA
AWO24905.1|1755138_1755882_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AWO24906.1|1755922_1756318_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24907.1|1756370_1757189_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
>prophage 127
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1761082	1769651	5043703	transposase	Bacillus_virus(40.0%)	10	NA	NA
AWO24912.1|1761082_1761604_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AWO24913.1|1761605_1762208_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28058.1|1762278_1762344_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24914.1|1762482_1763094_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWO24915.1|1763102_1764113_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AWO24916.1|1764222_1765570_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
AWO24917.1|1765764_1766550_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWO24918.1|1766546_1767302_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AWO28059.1|1767380_1768313_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWO24919.1|1768328_1769651_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 128
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1773649	1775125	5043703		Cyanophage(100.0%)	1	NA	NA
AWO24923.1|1773649_1775125_+	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 129
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1783181	1787650	5043703		Klebsiella_phage(33.33%)	7	NA	NA
AWO24931.1|1783181_1783844_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWO24932.1|1783867_1784524_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWO24933.1|1784625_1784856_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWO24934.1|1784994_1785369_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWO24935.1|1785372_1786245_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24936.1|1786257_1786599_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWO24937.1|1786993_1787650_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
>prophage 130
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1795145	1797194	5043703	tail,protease	Moraxella_phage(100.0%)	1	NA	NA
AWO24943.1|1795145_1797194_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 131
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1802526	1802736	5043703		Morganella_phage(100.0%)	1	NA	NA
AWO24951.1|1802526_1802736_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 132
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1808377	1809934	5043703		Moraxella_phage(100.0%)	1	NA	NA
AWO24959.1|1808377_1809934_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 133
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1813796	1822678	5043703	tRNA	Pandoravirus(33.33%)	8	NA	NA
AWO24963.1|1813796_1815158_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.2	2.9e-40
AWO24964.1|1815231_1815411_+	YoaH family protein	NA	NA	NA	NA	NA
AWO24965.1|1815530_1815890_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWO24966.1|1817027_1817372_-	hypothetical protein	NA	NA	NA	NA	NA
AWO24967.1|1817503_1819414_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	2.6e-92
AWO24968.1|1819471_1820167_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWO24969.1|1820206_1820788_+	hypothetical protein	NA	NA	NA	NA	NA
AWO24970.1|1820992_1822678_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 134
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1831645	1836222	5043703		Bacillus_phage(100.0%)	3	NA	NA
AWO24985.1|1831645_1833136_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
AWO24986.1|1833316_1834792_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWO24987.1|1834938_1836222_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 135
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1839540	1840395	5043703		Indivirus(100.0%)	1	NA	NA
AWO24990.1|1839540_1840395_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 136
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1849208	1853294	5043703		Staphylococcus_phage(50.0%)	4	NA	NA
AWO25000.1|1849208_1850189_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	8.7e-07
AWO25001.1|1850325_1851084_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWO25002.1|1851201_1852560_+	MFS transporter	NA	NA	NA	NA	NA
AWO25003.1|1852652_1853294_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
>prophage 137
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1859011	1860967	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO25011.1|1859011_1860967_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 138
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1865357	1866011	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO25017.1|1865357_1866011_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 139
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1872774	1873995	5043703		Klosneuvirus(100.0%)	1	NA	NA
AWO25025.1|1872774_1873995_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 140
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1881471	1882299	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO25033.1|1881471_1882299_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.5e-73
>prophage 141
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1888424	1890686	5043703		Tupanvirus(100.0%)	1	NA	NA
AWO25041.1|1888424_1890686_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	5.1e-143
>prophage 142
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1900057	1919598	5043703	tRNA	Tupanvirus(22.22%)	20	NA	NA
AWO25052.1|1900057_1901986_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
AWO25053.1|1901989_1902532_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWO25054.1|1902628_1902826_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWO25055.1|1902878_1903235_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWO28065.1|1903357_1903402_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWO25056.1|1903685_1904669_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AWO25057.1|1904683_1907071_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWO25058.1|1907075_1907375_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWO25059.1|1907475_1908456_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AWO25060.1|1908518_1909070_+	glutathione peroxidase	NA	NA	NA	NA	NA
AWO25061.1|1909069_1909819_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AWO25062.1|1909896_1910361_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AWO25063.1|1910608_1911322_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWO25064.1|1911384_1912821_+	YdiU family protein	NA	NA	NA	NA	NA
AWO25065.1|1912824_1913016_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AWO25066.1|1913147_1914194_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AWO25067.1|1914350_1915184_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AWO25068.1|1915295_1915463_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25069.1|1915516_1917895_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
AWO28066.1|1917951_1919598_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.7e-31
>prophage 143
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1938070	1943154	5043703		Lake_Baikal_phage(33.33%)	5	NA	NA
AWO25087.1|1938070_1938439_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	5.6e-15
AWO25088.1|1938447_1939935_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWO25089.1|1939944_1940691_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	8.7e-07
AWO25090.1|1940665_1941937_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AWO25091.1|1941933_1943154_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	7.6e-93
>prophage 144
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1951443	1953710	5043703		Escherichia_phage(50.0%)	3	NA	NA
AWO28067.1|1951443_1952112_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.7e-22
AWO25100.1|1952108_1952894_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AWO25101.1|1952897_1953710_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 145
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1959215	1968019	5043703		Orpheovirus(20.0%)	10	NA	NA
AWO25106.1|1959215_1959857_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AWO25107.1|1959896_1961045_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AWO25108.1|1961335_1962547_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWO25109.1|1962659_1963592_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWO25110.1|1963588_1964614_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
AWO25111.1|1964601_1964826_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25112.1|1964912_1965002_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AWO25113.1|1965167_1966337_+	MFS transporter	NA	NA	NA	NA	NA
AWO25114.1|1966482_1967064_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	44.8	3.1e-44
AWO25115.1|1967191_1968019_-	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 146
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1972434	1973933	5043703		Indivirus(50.0%)	2	NA	NA
AWO25122.1|1972434_1973331_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
AWO28069.1|1973411_1973933_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 147
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	1980844	1982119	5043703	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWO25130.1|1980844_1982119_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 148
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2002201	2004013	5043703		Vaccinia_virus(100.0%)	1	NA	NA
AWO25151.1|2002201_2004013_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.5	0.0e+00
>prophage 149
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2013908	2015210	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO25158.1|2013908_2015210_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	2.5e-17
>prophage 150
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2032973	2053105	5043703		Escherichia_phage(35.71%)	26	NA	NA
AWO25178.1|2032973_2033588_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWO25179.1|2033630_2034485_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWO25180.1|2034486_2035104_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWO25181.1|2035922_2036687_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.1	8.8e-47
AWO25182.1|2036744_2039171_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AWO25183.1|2039369_2039675_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWO25184.1|2039782_2040493_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWO25185.1|2040495_2041056_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWO25186.1|2041090_2041432_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWO25187.1|2041566_2041893_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWO25188.1|2041929_2042118_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25189.1|2042098_2043313_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	8.2e-47
AWO25190.1|2043324_2044344_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.3	3.7e-16
AWO25191.1|2044401_2044530_+	transporter	NA	NA	NA	NA	NA
AWO25192.1|2044531_2045827_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AWO25193.1|2045846_2046098_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWO25194.1|2046170_2048642_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AWO25195.1|2048735_2048927_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWO25196.1|2048923_2049112_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AWO25197.1|2049598_2050216_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25198.1|2050175_2050331_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWO25199.1|2050499_2050907_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AWO25200.1|2050987_2051215_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO25201.1|2051198_2051720_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25202.1|2051646_2052666_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AWO25203.1|2052706_2053105_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
>prophage 151
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2056304	2096841	5043703	head,lysis,capsid,tail,terminase,portal,transposase	Enterobacteria_phage(53.66%)	54	NA	NA
AWO25207.1|2056304_2057618_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWO25208.1|2057662_2057785_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AWO25209.1|2058054_2058387_-	protein FlxA	NA	NA	NA	NA	NA
AWO25210.1|2058589_2058895_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25211.1|2058919_2059159_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWO25212.1|2059158_2059446_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWO25213.1|2059517_2059673_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWO25214.1|2059889_2060141_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25215.1|2060207_2060486_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25216.1|2060487_2061537_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AWO25217.1|2061550_2062303_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AWO25218.1|2062724_2062937_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AWO25219.1|2063237_2063453_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AWO25220.1|2064206_2064422_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWO25221.1|2064426_2064738_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWO25222.1|2064734_2065268_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWO25223.1|2065264_2065762_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWO25224.1|2066124_2066337_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWO25225.1|2066347_2066536_+	cold-shock protein	NA	NA	NA	NA	NA
AWO25226.1|2066566_2066839_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25227.1|2067010_2067184_+	protein GnsB	NA	NA	NA	NA	NA
AWO25228.1|2067335_2067746_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AWO25229.1|2067803_2068037_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AWO25230.1|2068184_2068286_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25231.1|2068425_2068971_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWO25232.1|2068945_2070871_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWO25233.1|2070867_2071074_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWO25234.1|2071070_2072672_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AWO25235.1|2072652_2073972_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AWO25236.1|2073981_2074314_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWO25237.1|2074368_2075394_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AWO25238.1|2075435_2075834_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AWO25239.1|2075845_2076199_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AWO25240.1|2076210_2076789_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AWO25241.1|2076785_2077181_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AWO28074.1|2077188_2077929_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AWO25242.1|2077944_2078367_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AWO25243.1|2078348_2078783_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWO25244.1|2078775_2081337_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AWO25245.1|2081333_2081663_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWO25246.1|2081662_2082361_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AWO25247.1|2082366_2083110_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AWO25248.1|2083007_2083649_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AWO25249.1|2083709_2087189_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AWO25250.1|2087256_2087856_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AWO25251.1|2087920_2090320_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AWO25252.1|2090316_2090598_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AWO25253.1|2090607_2091312_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AWO25254.1|2091322_2091616_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25255.1|2091843_2092434_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWO25256.1|2092750_2092984_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
AWO25257.1|2093769_2095053_+	MFS transporter	NA	NA	NA	NA	NA
AWO25258.1|2095141_2096602_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	1.3e-43
AWO25259.1|2096637_2096841_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 152
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2101227	2102118	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO25264.1|2101227_2102118_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-20
>prophage 153
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2105120	2105504	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO25269.1|2105120_2105504_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 154
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2112718	2113666	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO28076.1|2112718_2113666_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
>prophage 155
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2139944	2142368	5043703		Klosneuvirus(100.0%)	1	NA	NA
AWO25300.1|2139944_2142368_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	3.6e-09
>prophage 156
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2145772	2147530	5043703		Tupanvirus(50.0%)	2	NA	NA
AWO25304.1|2145772_2146783_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
AWO25305.1|2147245_2147530_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 157
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2158775	2160320	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO25312.1|2158775_2160320_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 158
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2169283	2171386	5043703		Salmonella_phage(100.0%)	1	NA	NA
AWO25323.1|2169283_2171386_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 159
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2176883	2177897	5043703		Mycoplasma_phage(100.0%)	1	NA	NA
AWO25332.1|2176883_2177897_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.4	4.6e-27
>prophage 160
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2181526	2183488	5043703	protease	Phage_TP(100.0%)	1	NA	NA
AWO25336.1|2181526_2183488_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	3.5e-23
>prophage 161
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2195338	2196287	5043703		Moraxella_phage(50.0%)	2	NA	NA
AWO25351.1|2195338_2195512_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AWO25352.1|2195756_2196287_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 162
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2200240	2204143	5043703		Klosneuvirus(100.0%)	1	NA	NA
AWO25356.1|2200240_2204143_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 163
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2219118	2220108	5043703		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWO25363.1|2219118_2220108_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 164
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2225067	2234486	5043703	integrase,tRNA	Escherichia_phage(33.33%)	11	2222780:2222794	2233647:2233661
2222780:2222794	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AWO25367.1|2225067_2226201_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
AWO25368.1|2226341_2226776_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWO28080.1|2226927_2227233_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25369.1|2227198_2227465_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25370.1|2227853_2228033_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28081.1|2228798_2229050_+|integrase	integrase	integrase	A0A0U2JGI6	Escherichia_phage	100.0	1.9e-38
AWO25371.1|2229101_2230037_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
AWO25372.1|2230164_2231538_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
AWO25373.1|2231567_2231741_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25374.1|2232015_2232999_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWO25375.1|2233253_2234486_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2233647:2233661	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 165
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2239258	2239774	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO25380.1|2239258_2239774_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 166
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2256998	2258081	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO25397.1|2256998_2258081_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.8e-22
>prophage 167
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2277423	2279441	5043703		Bacillus_virus(50.0%)	2	NA	NA
AWO25418.1|2277423_2278230_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AWO25419.1|2278277_2279441_-	MFS transporter	NA	S4TR35	Salmonella_phage	27.2	5.6e-29
>prophage 168
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2288375	2290310	5043703		Lactococcus_phage(100.0%)	1	NA	NA
AWO25425.1|2288375_2290310_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 169
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2298122	2298713	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO25435.1|2298122_2298713_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 170
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2303622	2308914	5043703	protease	Tupanvirus(33.33%)	5	NA	NA
AWO25440.1|2303622_2306220_-	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
AWO25441.1|2306342_2306555_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25442.1|2306599_2306851_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25443.1|2306886_2307936_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWO25444.1|2308155_2308914_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 171
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2317412	2320370	5043703		Acinetobacter_phage(100.0%)	2	NA	NA
AWO25451.1|2317412_2319008_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.2e-52
AWO25452.1|2319011_2320370_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
>prophage 172
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2330332	2332347	5043703		Bacillus_virus(50.0%)	2	NA	NA
AWO25464.1|2330332_2331337_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AWO25465.1|2331333_2332347_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 173
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2341913	2348276	5043703		Citrobacter_phage(33.33%)	7	NA	NA
AWO25470.1|2341913_2342531_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
AWO25471.1|2343134_2343548_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AWO25472.1|2343692_2344601_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AWO25473.1|2344802_2345816_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWO25474.1|2345907_2346813_-	patatin family protein	NA	NA	NA	NA	NA
AWO25475.1|2346925_2347384_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25476.1|2347433_2348276_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
>prophage 174
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2357063	2358602	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO25486.1|2357063_2358602_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
>prophage 175
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2369724	2376002	5043703		Spodoptera_litura_granulovirus(33.33%)	8	NA	NA
AWO25495.1|2369724_2369964_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	39.0	2.6e-05
AWO25496.1|2370233_2371334_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AWO28089.1|2371738_2371846_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AWO25497.1|2371994_2372849_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AWO25498.1|2372884_2373694_-	protein sirB1	NA	NA	NA	NA	NA
AWO25499.1|2373697_2374090_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25500.1|2374086_2374920_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AWO25501.1|2374919_2376002_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 176
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2379138	2386929	5043703	transposase,tRNA	Tupanvirus(25.0%)	8	NA	NA
AWO25504.1|2379138_2380086_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AWO25505.1|2380210_2381890_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
AWO25506.1|2381944_2382223_-	DUF2583 domain-containing protein	NA	NA	NA	NA	NA
AWO25507.1|2382500_2383085_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWO25508.1|2383201_2384293_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AWO25509.1|2384507_2385683_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.4	1.7e-73
AWO25510.1|2385793_2386078_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AWO25511.1|2386074_2386929_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	1.6e-81
>prophage 177
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2397114	2401773	5043703	integrase	Vibrio_phage(33.33%)	8	2383293:2383306	2400815:2400828
2383293:2383306	attL	ACTTTCCATTCTGC	NA	NA	NA	NA
AWO25517.1|2397114_2397312_-	AlpA family transcriptional regulator	NA	A0A1V0E888	Vibrio_phage	43.9	2.5e-06
AWO25518.1|2397534_2398149_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25519.1|2398135_2399065_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
AWO25520.1|2399111_2399564_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWO25521.1|2399565_2400027_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28091.1|2400146_2400539_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AWO28092.1|2400893_2401250_-	hypothetical protein	NA	NA	NA	NA	NA
2400815:2400828	attR	ACTTTCCATTCTGC	NA	NA	NA	NA
AWO25522.1|2401503_2401773_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	58.7	3.4e-14
>prophage 178
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2420389	2421148	5043703		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWO25540.1|2420389_2421148_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 179
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2437065	2438753	5043703		Salmonella_phage(50.0%)	2	NA	NA
AWO25555.1|2437065_2438334_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.5	9.6e-208
AWO25556.1|2438333_2438753_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	61.3	6.9e-38
>prophage 180
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2446567	2447155	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO25571.1|2446567_2447155_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	29.6	2.4e-36
>prophage 181
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2452949	2509493	5043703	integrase,head,lysis,capsid,tRNA,tail,portal,terminase,transposase	Enterobacteria_phage(54.24%)	75	2452686:2452701	2514792:2514807
2452686:2452701	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
AWO25580.1|2452949_2453681_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
AWO25581.1|2453901_2454306_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AWO25582.1|2454567_2454720_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
AWO25583.1|2455647_2456562_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO25584.1|2456561_2457389_+	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	27.7	8.7e-08
AWO25585.1|2457385_2458243_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWO25586.1|2458239_2459097_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWO25587.1|2459188_2459482_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25588.1|2459494_2459773_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
AWO25589.1|2459940_2461554_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AWO25590.1|2461584_2461935_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWO25591.1|2461931_2462357_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWO25592.1|2462438_2464367_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	60.1	7.5e-111
AWO25593.1|2464425_2467824_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
AWO25594.1|2467884_2468556_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.8	6.4e-102
AWO25595.1|2468453_2469197_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	3.3e-147
AWO25596.1|2469202_2469901_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	5.2e-131
AWO25597.1|2469900_2470230_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	9.9e-56
AWO25598.1|2470226_2472788_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.8	0.0e+00
AWO25599.1|2472780_2473215_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
AWO25600.1|2473196_2473619_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	3.7e-71
AWO28094.1|2473634_2474375_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	2.8e-130
AWO25601.1|2474382_2474778_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AWO25602.1|2474774_2475353_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	1.1e-78
AWO25603.1|2475364_2475718_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
AWO25604.1|2475710_2476133_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25605.1|2476136_2477165_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	4.5e-115
AWO25606.1|2477222_2477570_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
AWO25607.1|2477606_2479112_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	7.9e-100
AWO25608.1|2479101_2480694_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
AWO25609.1|2480690_2480897_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AWO25610.1|2480880_2482809_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	1.1e-260
AWO25611.1|2482780_2483329_-|terminase	phage terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
AWO25612.1|2483410_2483602_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25613.1|2483639_2483822_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25614.1|2483920_2484295_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.5e-47
AWO25615.1|2484333_2484777_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	92.5	4.3e-70
AWO25616.1|2484773_2485271_-	lysozyme	NA	A5LH83	Enterobacteria_phage	99.4	1.7e-91
AWO25617.1|2485270_2485486_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWO25618.1|2486075_2487158_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	4.1e-167
AWO25619.1|2487346_2487730_-	antitermination protein	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
AWO25620.1|2487815_2487956_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
AWO25621.1|2487952_2488315_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
AWO25622.1|2488311_2488602_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
AWO25623.1|2488594_2488765_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AWO25624.1|2488764_2489220_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
AWO25625.1|2489216_2489318_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25626.1|2489667_2490711_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWO25627.1|2491060_2492587_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
AWO25628.1|2492842_2493175_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWO25629.1|2493242_2493545_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
AWO25630.1|2493541_2494243_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AWO25631.1|2494239_2495259_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.7e-112
AWO25632.1|2495255_2495795_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AWO25633.1|2495825_2496053_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AWO25634.1|2496163_2496856_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
AWO25635.1|2496936_2497998_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
AWO25636.1|2497975_2498353_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
AWO25637.1|2498828_2499035_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWO25638.1|2499110_2499407_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
AWO25639.1|2499412_2500198_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWO25640.1|2500194_2500875_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
AWO25641.1|2500871_2501054_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
AWO25642.1|2501026_2501218_+	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AWO25643.1|2501228_2501510_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
AWO25644.1|2501608_2501827_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AWO25645.1|2501874_2502114_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AWO25646.1|2502253_2502490_+	excisionase	NA	NA	NA	NA	NA
AWO25647.1|2502479_2503622_+|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AWO25648.1|2503735_2504986_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AWO25649.1|2505157_2505811_+	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AWO25650.1|2505820_2506282_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWO25651.1|2506335_2507442_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWO28095.1|2507477_2508119_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AWO25652.1|2508122_2509493_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
2514792:2514807	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 182
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2514514	2564776	5043703	integrase,head,lysis,holin,capsid,terminase,portal,tail	Escherichia_phage(36.54%)	68	2514527:2514541	2564878:2564892
AWO25657.1|2514514_2515651_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2514527:2514541	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AWO25658.1|2515634_2516498_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWO25659.1|2516729_2516996_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AWO28097.1|2517094_2517721_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWO25660.1|2517665_2517803_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWO25661.1|2517775_2518360_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AWO25662.1|2518359_2521386_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AWO25663.1|2521537_2522137_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AWO25664.1|2522204_2525897_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AWO25665.1|2526240_2526921_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AWO25666.1|2526818_2527562_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AWO25667.1|2527572_2528271_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AWO25668.1|2528270_2528600_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWO25669.1|2528596_2531158_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AWO25670.1|2531138_2531552_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWO25671.1|2531578_2532010_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AWO25672.1|2532023_2532776_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AWO25673.1|2532783_2533179_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWO25674.1|2533175_2533751_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AWO25675.1|2533766_2534120_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AWO25676.1|2534112_2534535_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25677.1|2534538_2535567_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
AWO25678.1|2535624_2535972_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AWO25679.1|2536008_2537514_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AWO25680.1|2537503_2539096_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AWO25681.1|2539092_2539299_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AWO25682.1|2539282_2541211_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AWO25683.1|2541182_2541692_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWO25684.1|2541813_2541993_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWO25685.1|2541966_2542287_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25686.1|2542174_2542528_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25687.1|2542650_2543031_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AWO28098.1|2543287_2543755_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AWO25688.1|2543903_2544119_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25689.1|2544242_2544776_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AWO25690.1|2544812_2545703_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AWO25691.1|2545707_2545923_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWO25692.1|2546072_2546234_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AWO25693.1|2546230_2546434_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AWO25694.1|2546679_2547015_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AWO25695.1|2547384_2547717_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
AWO25696.1|2547794_2548484_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AWO25697.1|2548476_2548845_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AWO25698.1|2548845_2549904_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AWO25699.1|2549905_2550184_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AWO25700.1|2550250_2550502_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25701.1|2550718_2550874_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWO25702.1|2551132_2551312_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25703.1|2551432_2552419_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AWO25704.1|2552415_2552781_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AWO25705.1|2552782_2553190_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
AWO25706.1|2553285_2553642_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AWO25707.1|2553619_2554081_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AWO25708.1|2554077_2554374_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AWO25709.1|2554370_2554778_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AWO25710.1|2554778_2555549_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AWO25711.1|2555582_2556248_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWO25712.1|2557048_2557600_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25713.1|2557583_2557811_-	transcriptional regulator	NA	NA	NA	NA	NA
AWO25714.1|2557887_2558295_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWO28099.1|2558501_2558654_+	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AWO28100.1|2558665_2559040_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25715.1|2559570_2560425_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AWO25716.1|2560435_2560624_+	cell division inhibitor	NA	NA	NA	NA	NA
AWO25717.1|2560620_2560824_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWO25718.1|2560901_2563358_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
AWO25719.1|2563419_2563689_+	excisionase	NA	NA	NA	NA	NA
AWO25720.1|2563657_2564776_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2564878:2564892	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 183
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2568221	2571944	5043703		Vibrio_phage(50.0%)	4	NA	NA
AWO25725.1|2568221_2569043_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AWO25726.1|2569058_2569970_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWO25727.1|2569998_2571243_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWO25728.1|2571242_2571944_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 184
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2579230	2579488	5043703		Erwinia_phage(100.0%)	1	NA	NA
AWO25732.1|2579230_2579488_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 185
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2591810	2593453	5043703		Streptococcus_virus(50.0%)	2	NA	NA
AWO25745.1|2591810_2592815_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
AWO25746.1|2592811_2593453_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 186
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2596725	2597907	5043703		Ralstonia_phage(50.0%)	2	NA	NA
AWO25750.1|2596725_2596962_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AWO25751.1|2597172_2597907_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 187
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2610263	2611205	5043703		Brevibacillus_phage(100.0%)	1	NA	NA
AWO25763.1|2610263_2611205_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 188
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2627086	2627332	5043703		Salmonella_phage(100.0%)	1	NA	NA
AWO25783.1|2627086_2627332_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 189
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2631993	2632914	5043703		Morganella_phage(100.0%)	1	NA	NA
AWO25790.1|2631993_2632914_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 190
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2642221	2642755	5043703		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AWO25798.1|2642221_2642755_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 191
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2646892	2647726	5043703		Pelagibacter_phage(100.0%)	1	NA	NA
AWO25807.1|2646892_2647726_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 192
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2651117	2652485	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO25811.1|2651117_2652485_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 193
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2659303	2660368	5043703		Cronobacter_phage(100.0%)	1	NA	NA
AWO25816.1|2659303_2660368_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 194
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2674689	2676789	5043703		Enterobacteria_phage(100.0%)	3	NA	NA
AWO25828.1|2674689_2675184_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
AWO25829.1|2675204_2676533_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	5.3e-233
AWO25830.1|2676615_2676789_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 195
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2679819	2692236	5043703		Klosneuvirus(20.0%)	13	NA	NA
AWO25835.1|2679819_2680740_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AWO25836.1|2680739_2681045_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AWO25837.1|2681299_2681899_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AWO25838.1|2681895_2684442_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.8	1.5e-71
AWO25839.1|2684441_2685614_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AWO25840.1|2685743_2686436_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AWO25841.1|2686408_2687437_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AWO25842.1|2687519_2690252_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	2.2e-39
AWO25843.1|2690334_2691408_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
AWO25844.1|2691456_2691630_-	protein GnsA	NA	NA	NA	NA	NA
AWO25845.1|2691619_2691850_-	cold-shock protein	NA	NA	NA	NA	NA
AWO28108.1|2691824_2692013_-	cold-shock protein	NA	NA	NA	NA	NA
AWO25846.1|2692023_2692236_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 196
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2703242	2703902	5043703		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWO25857.1|2703242_2703902_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 197
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2708136	2710191	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO25865.1|2708136_2710191_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 198
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2722801	2724709	5043703		Tupanvirus(100.0%)	1	NA	NA
AWO25877.1|2722801_2724709_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 199
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2732676	2744262	5043703	tRNA	Bacillus_virus(33.33%)	10	NA	NA
AWO25885.1|2732676_2733468_+	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
AWO25886.1|2733464_2734232_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
AWO25887.1|2734274_2736887_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
AWO25888.1|2737152_2738355_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWO25889.1|2738523_2739924_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
AWO25890.1|2740526_2741615_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
AWO25891.1|2741630_2741813_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25892.1|2741799_2742990_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AWO25893.1|2743039_2743687_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWO28113.1|2743713_2744262_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 200
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2753014	2842570	5043703	plate,integrase,holin,capsid,tRNA,protease,portal,terminase,tail	Enterobacteria_phage(63.64%)	94	2783351:2783370	2822039:2822058
AWO25898.1|2753014_2753800_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AWO25899.1|2753935_2754715_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AWO25900.1|2754691_2755585_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25901.1|2755738_2756485_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWO25902.1|2756481_2756664_-	protein YcaR	NA	NA	NA	NA	NA
AWO25903.1|2756715_2757948_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWO25904.1|2757984_2758971_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWO25905.1|2758967_2760716_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AWO25906.1|2760752_2763017_-	ComEC family protein	NA	NA	NA	NA	NA
AWO25907.1|2763222_2763507_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AWO25908.1|2763666_2765340_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AWO25909.1|2765450_2766134_-	cytidylate kinase	NA	NA	NA	NA	NA
AWO25910.1|2766306_2767071_-|protease	metalloprotease	protease	NA	NA	NA	NA
AWO25911.1|2767240_2768524_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWO25912.1|2768594_2769683_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AWO25913.1|2769881_2770574_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AWO25914.1|2770703_2772464_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AWO25915.1|2772869_2773727_+	formate transporter FocA	NA	NA	NA	NA	NA
AWO25916.1|2773781_2776064_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AWO25917.1|2776255_2776996_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AWO25918.1|2777092_2778241_-	MFS transporter	NA	NA	NA	NA	NA
AWO25919.1|2778554_2779181_+	hydrolase	NA	NA	NA	NA	NA
AWO25920.1|2779216_2780080_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWO25921.1|2780081_2780699_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWO25922.1|2780709_2783154_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
2783351:2783370	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AWO25923.1|2783453_2784446_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	3.5e-104
AWO28114.1|2784515_2784857_-	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AWO25924.1|2784961_2785483_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO25925.1|2785487_2785910_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25926.1|2785916_2786108_-	hypothetical protein	NA	NA	NA	NA	NA
AWO25927.1|2786245_2786596_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	1.1e-55
AWO25928.1|2786606_2786894_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AWO25929.1|2786905_2787148_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
AWO25930.1|2787348_2787666_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25931.1|2787655_2787859_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.9e-25
AWO25932.1|2787855_2788101_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	97.5	5.7e-40
AWO25933.1|2788097_2788394_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	78.8	1.9e-34
AWO25934.1|2788404_2788608_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	92.5	7.7e-27
AWO25935.1|2788604_2789435_+|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	99.3	3.3e-132
AWO25936.1|2789488_2790109_+	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	52.4	2.8e-11
AWO25937.1|2790105_2790471_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AWO28115.1|2790615_2793300_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
AWO25938.1|2793376_2794336_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
AWO25939.1|2794340_2794652_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	4.2e-48
AWO25940.1|2794715_2795048_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
AWO25941.1|2795044_2795359_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	95.2	2.9e-49
AWO25942.1|2795361_2795853_+	hypothetical protein	NA	G9L661	Escherichia_phage	91.4	2.4e-82
AWO25943.1|2795854_2796118_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWO25944.1|2796704_2797229_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25945.1|2797243_2798290_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AWO25946.1|2798289_2800041_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
AWO25947.1|2800195_2801032_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.9e-148
AWO25948.1|2801055_2802108_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
AWO25949.1|2802153_2802954_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	93.2	4.9e-133
AWO25950.1|2803055_2803550_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
AWO25951.1|2803549_2803750_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWO25952.1|2803752_2804076_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AWO25953.1|2804072_2804465_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AWO25954.1|2804461_2804869_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
AWO25955.1|2805007_2806888_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	80.5	2.7e-299
AWO25956.1|2806911_2807379_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AWO25957.1|2807371_2808007_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AWO25958.1|2808003_2808585_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
AWO25959.1|2808581_2808932_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
AWO25960.1|2808935_2809832_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.1e-154
AWO25961.1|2809824_2810433_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
AWO25962.1|2810429_2812025_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	51.4	9.9e-117
AWO25963.1|2812024_2812639_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AWO25964.1|2812645_2813119_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AWO28116.1|2813129_2813591_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	63.8	3.0e-50
AWO25965.1|2813662_2814262_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.0e-86
AWO25966.1|2814288_2814783_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	4.7e-86
AWO25967.1|2814789_2817597_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.6	0.0e+00
AWO25968.1|2817583_2817820_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWO25969.1|2817747_2818122_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	5.8e-36
AWO25970.1|2818177_2818690_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AWO25971.1|2818689_2819874_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	4.9e-222
AWO25972.1|2820031_2821141_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	5.3e-194
AWO25973.1|2821183_2821444_+	hypothetical protein	NA	NA	NA	NA	NA
AWO25974.1|2821634_2821775_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AWO25975.1|2822080_2823373_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
2822039:2822058	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
AWO25976.1|2823463_2824807_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWO25977.1|2824817_2825429_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWO25978.1|2825587_2829694_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWO25979.1|2829828_2830323_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWO25980.1|2830866_2831832_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AWO25981.1|2831954_2833721_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AWO25982.1|2833721_2835443_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AWO25983.1|2835484_2836189_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWO25984.1|2836473_2836692_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWO25985.1|2837376_2839653_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AWO25986.1|2839683_2840004_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.3	2.6e-13
AWO25987.1|2840326_2840551_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWO25988.1|2840623_2842570_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	8.5e-38
>prophage 201
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2851786	2853505	5043703		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AWO25997.1|2851786_2853505_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
>prophage 202
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2857092	2859830	5043703		Roseobacter_phage(50.0%)	4	NA	NA
AWO26000.1|2857092_2857923_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWO26001.1|2857919_2858243_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26002.1|2858368_2858884_+	lipoprotein	NA	NA	NA	NA	NA
AWO26003.1|2859101_2859830_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 203
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2862955	2872095	5043703		Streptococcus_phage(25.0%)	11	NA	NA
AWO26008.1|2862955_2864083_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AWO26009.1|2864123_2864612_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWO26010.1|2864671_2865517_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWO26011.1|2865513_2866458_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWO26012.1|2866467_2867601_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AWO26013.1|2867695_2868808_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWO26014.1|2869157_2869634_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWO26015.1|2869721_2870624_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWO26016.1|2870684_2871407_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWO26017.1|2871390_2871678_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWO26018.1|2871837_2872095_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 204
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2880662	2881865	5043703		Stx2-converting_phage(100.0%)	1	NA	NA
AWO28119.1|2880662_2881865_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 205
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2893199	2895071	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO26036.1|2893199_2895071_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 206
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2898286	2905170	5043703		Synechococcus_phage(33.33%)	5	NA	NA
AWO26040.1|2898286_2898949_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	5.7e-26
AWO26041.1|2899079_2899979_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWO26042.1|2899984_2902417_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AWO26043.1|2902562_2903378_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWO26044.1|2903577_2905170_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 207
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2910166	2915392	5043703		Escherichia_phage(33.33%)	7	NA	NA
AWO26051.1|2910166_2910682_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AWO26052.1|2911034_2911922_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWO26053.1|2912221_2912725_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AWO26054.1|2912789_2913083_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26055.1|2913128_2913875_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO26056.1|2914013_2914673_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AWO26057.1|2914669_2915392_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 208
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2921781	2933352	5043703		Synechococcus_phage(16.67%)	11	NA	NA
AWO26062.1|2921781_2922459_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	29.7	5.2e-19
AWO26063.1|2922532_2922799_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
AWO26064.1|2923063_2923324_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWO26065.1|2923461_2924547_-	dehydrogenase	NA	NA	NA	NA	NA
AWO26066.1|2924686_2925649_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWO26067.1|2925676_2927827_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.8e-41
AWO26068.1|2927825_2928131_+	DUF1768 domain-containing protein	NA	A0A0H3TLU0	Faustovirus	54.4	9.6e-13
AWO26069.1|2928363_2929725_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	32.6	1.5e-52
AWO28120.1|2929953_2930625_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO26070.1|2930624_2931623_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWO26071.1|2931615_2933352_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 209
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2943950	2944859	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO26085.1|2943950_2944859_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	4.9e-28
>prophage 210
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2951186	2952476	5043703		Klosneuvirus(100.0%)	1	NA	NA
AWO26091.1|2951186_2952476_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
>prophage 211
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2962738	2969314	5043703		Planktothrix_phage(33.33%)	9	NA	NA
AWO26100.1|2962738_2963797_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
AWO26101.1|2963799_2964489_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AWO26102.1|2964488_2965262_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO26103.1|2965283_2965493_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26104.1|2965428_2965578_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AWO26105.1|2965706_2966495_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWO26106.1|2966488_2966635_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26107.1|2966562_2968035_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.8	1.9e-13
AWO26108.1|2968297_2969314_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 212
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	2973677	2977197	5043703		Klebsiella_phage(33.33%)	4	NA	NA
AWO26113.1|2973677_2974730_-	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.1	7.5e-81
AWO26114.1|2975045_2975426_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26115.1|2975539_2976481_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.3e-23
AWO26116.1|2976477_2977197_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.9	2.4e-22
>prophage 213
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3013035	3013791	5043703		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWO26147.1|3013035_3013791_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.9e-10
>prophage 214
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3017714	3018506	5043703		Kaumoebavirus(100.0%)	1	NA	NA
AWO26152.1|3017714_3018506_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	5.8e-09
>prophage 215
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3021884	3033717	5043703		Hokovirus(40.0%)	10	NA	NA
AWO26157.1|3021884_3023366_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
AWO26158.1|3023407_3024826_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	2.8e-62
AWO26159.1|3024822_3025332_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWO26160.1|3025432_3025639_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AWO26161.1|3025951_3026041_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWO26162.1|3026040_3027714_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AWO26163.1|3027736_3029785_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
AWO26164.1|3029793_3030366_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
AWO26165.1|3030358_3033043_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	6.5e-12
AWO26166.1|3033039_3033717_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
>prophage 216
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3040372	3041137	5043703		Mycobacterium_phage(100.0%)	1	NA	NA
AWO26173.1|3040372_3041137_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 217
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3045282	3047928	5043703	tRNA	Escherichia_phage(100.0%)	2	NA	NA
AWO26179.1|3045282_3046947_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
AWO26180.1|3047166_3047928_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
>prophage 218
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3052421	3053180	5043703		Moraxella_phage(100.0%)	1	NA	NA
AWO26185.1|3052421_3053180_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 219
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3056234	3058181	5043703		Vibrio_phage(100.0%)	1	NA	NA
AWO26189.1|3056234_3058181_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 220
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3062806	3064471	5043703		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWO28124.1|3062806_3064471_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 221
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3069001	3070081	5043703		Pseudomonas_phage(100.0%)	1	NA	NA
AWO26197.1|3069001_3070081_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 222
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3078025	3081558	5043703		Planktothrix_phage(50.0%)	3	NA	NA
AWO26205.1|3078025_3078751_+	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	9.9e-32
AWO26206.1|3078868_3079804_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AWO26207.1|3079887_3081558_+	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.9	7.2e-78
>prophage 223
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3085690	3088273	5043703	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AWO26213.1|3085690_3088273_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 224
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3095283	3097723	5043703		Synechococcus_phage(50.0%)	2	NA	NA
AWO26222.1|3095283_3096372_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AWO26223.1|3096511_3097723_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 225
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3102140	3102787	5043703		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWO26230.1|3102140_3102524_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AWO26231.1|3102577_3102787_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 226
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3116876	3118991	5043703		Morganella_phage(50.0%)	2	NA	NA
AWO26246.1|3116876_3117305_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
AWO26247.1|3117425_3118991_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 227
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3122096	3123919	5043703		Streptococcus_phage(50.0%)	2	NA	NA
AWO26251.1|3122096_3123317_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.3	1.8e-57
AWO26252.1|3123289_3123919_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
>prophage 228
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3138210	3144253	5043703		Klosneuvirus(50.0%)	3	NA	NA
AWO26266.1|3138210_3139026_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
AWO26267.1|3139022_3140156_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AWO26268.1|3140371_3144253_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	5.8e-62
>prophage 229
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3155640	3157185	5043703		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWO26278.1|3155640_3157185_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.8e-14
>prophage 230
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3166754	3169898	5043703		Leptospira_phage(100.0%)	1	NA	NA
AWO26290.1|3166754_3169898_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	7.5e-60
>prophage 231
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3173043	3175159	5043703		Bacillus_phage(50.0%)	2	NA	NA
AWO26295.1|3173043_3173727_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AWO26296.1|3173716_3175159_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.4	1.3e-11
>prophage 232
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3183962	3188437	5043703	integrase,tail,tRNA	Enterobacteria_phage(25.0%)	7	3181920:3181933	3185228:3185241
3181920:3181933	attL	AAAACTGACAGCGC	NA	NA	NA	NA
AWO26302.1|3183962_3184319_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	68.2	1.5e-54
AWO26303.1|3184325_3184952_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	78.4	4.2e-79
AWO26304.1|3185068_3185266_-	hypothetical protein	NA	NA	NA	NA	NA
3185228:3185241	attR	AAAACTGACAGCGC	NA	NA	NA	NA
AWO26305.1|3185306_3186173_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWO26306.1|3186174_3186387_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26307.1|3186494_3187016_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWO26308.1|3187051_3188437_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 233
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3200671	3201817	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO26321.1|3200671_3201817_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 234
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3208007	3209789	5043703		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWO26326.1|3208007_3209789_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
>prophage 235
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3220893	3221580	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO26337.1|3220893_3221580_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 236
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3224836	3225514	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO26341.1|3224836_3225514_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 237
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3230882	3234124	5043703		Escherichia_phage(66.67%)	3	NA	NA
AWO26347.1|3230882_3233387_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.0e-115
AWO26348.1|3233444_3233786_-	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AWO26349.1|3233821_3234124_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
>prophage 238
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3243686	3252144	5043703		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AWO26360.1|3243686_3244646_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.0	2.9e-15
AWO26361.1|3244642_3245605_-	ferrochelatase	NA	NA	NA	NA	NA
AWO26362.1|3245736_3246381_-	adenylate kinase	NA	NA	NA	NA	NA
AWO26363.1|3246561_3248436_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
AWO26364.1|3248545_3249151_-	recombination protein RecR	NA	NA	NA	NA	NA
AWO26365.1|3249150_3249480_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWO26366.1|3249532_3251464_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	3.9e-43
AWO26367.1|3251592_3252144_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 239
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3258982	3262132	5043703		Leptospira_phage(100.0%)	1	NA	NA
AWO26376.1|3258982_3262132_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 240
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3270969	3274516	5043703		Bacillus_phage(100.0%)	2	NA	NA
AWO26387.1|3270969_3272751_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	1.5e-41
AWO26388.1|3272743_3274516_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-50
>prophage 241
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3277839	3278535	5043703		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWO26392.1|3277839_3278535_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 242
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3281675	3286722	5043703	protease	Bacillus_phage(25.0%)	4	NA	NA
AWO26396.1|3281675_3281948_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AWO26397.1|3282156_3284511_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AWO26398.1|3284698_3285973_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
AWO26399.1|3286098_3286722_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 243
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3308156	3316999	5043703	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AWO26422.1|3308156_3308627_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AWO26423.1|3308715_3309819_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
AWO26424.1|3309822_3310272_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWO26425.1|3310422_3310962_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26426.1|3311260_3312145_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AWO26427.1|3312182_3312530_-	HNH endonuclease	NA	NA	NA	NA	NA
AWO26428.1|3312659_3313631_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AWO26429.1|3313641_3315489_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWO26430.1|3315516_3315849_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AWO26431.1|3315871_3316999_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 244
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3323950	3334048	5043703		Bacillus_phage(60.0%)	7	NA	NA
AWO26437.1|3323950_3325246_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
AWO26438.1|3325303_3325993_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AWO26439.1|3326182_3327385_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AWO26440.1|3327381_3330525_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	7.6e-12
AWO28131.1|3330650_3331835_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AWO26441.1|3332103_3333012_-	fructokinase	NA	NA	NA	NA	NA
AWO28132.1|3333136_3334048_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
>prophage 245
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3338337	3339453	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO26451.1|3338337_3339453_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 246
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3346868	3348026	5043703		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWO26463.1|3346868_3348026_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 247
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3354934	3358402	5043703		Planktothrix_phage(50.0%)	4	NA	NA
AWO26469.1|3354934_3355702_-	taurine import ATP-binding protein TauB	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
AWO26470.1|3355714_3356677_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO26471.1|3356982_3357258_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO26472.1|3357292_3358402_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 248
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3361480	3363441	5043703		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
AWO26476.1|3361480_3362494_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	7.1e-44
AWO26477.1|3362490_3363441_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
>prophage 249
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3368851	3373131	5043703		Enterobacteria_phage(50.0%)	2	NA	NA
AWO26482.1|3368851_3369934_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	7.0e-191
AWO26483.1|3370056_3373131_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.5	0.0e+00
>prophage 250
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3378090	3379977	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO26487.1|3378090_3379977_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 251
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3387621	3388671	5043703		Tupanvirus(100.0%)	1	NA	NA
AWO26493.1|3387621_3388671_-	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.7	3.2e-71
>prophage 252
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3399792	3407357	5043703	holin	Vibrio_phage(33.33%)	7	NA	NA
AWO26505.1|3399792_3401826_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AWO28135.1|3401822_3402038_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26506.1|3401954_3402542_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AWO26507.1|3402555_3404028_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWO26508.1|3404041_3405712_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.2e-59
AWO26509.1|3405753_3405981_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26510.1|3406793_3407357_+	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
>prophage 253
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3417275	3420595	5043703		Erysipelothrix_phage(50.0%)	4	NA	NA
AWO26520.1|3417275_3418601_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
AWO26521.1|3418709_3418946_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWO26522.1|3418957_3419551_+	protein RclC	NA	NA	NA	NA	NA
AWO26523.1|3419710_3420595_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	2.5e-53
>prophage 254
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3426622	3427474	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO26526.1|3426622_3427474_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 255
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3444481	3445801	5043703	integrase	Pseudomonas_phage(50.0%)	2	3439270:3439283	3455727:3455740
3439270:3439283	attL	TAAAAACATCGCTG	NA	NA	NA	NA
AWO26544.1|3444481_3444817_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	44.6	1.5e-06
AWO26545.1|3445024_3445801_+|integrase	integrase	integrase	T1S9J3	Salmonella_phage	26.4	1.2e-11
3455727:3455740	attR	CAGCGATGTTTTTA	NA	NA	NA	NA
>prophage 256
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3451030	3458984	5043703		Streptococcus_phage(50.0%)	7	NA	NA
AWO26549.1|3451030_3452668_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.7	1.0e-23
AWO26550.1|3452657_3453905_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26551.1|3454084_3454270_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26552.1|3454247_3454718_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26553.1|3455271_3456525_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.0e-96
AWO26554.1|3456536_3457640_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWO26555.1|3457928_3458984_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
>prophage 257
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3463660	3464812	5043703		Mycobacterium_phage(100.0%)	1	NA	NA
AWO26561.1|3463660_3464812_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.1	6.6e-30
>prophage 258
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3469926	3473249	5043703		Clostridioides_phage(50.0%)	4	NA	NA
AWO26566.1|3469926_3470685_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AWO26567.1|3470987_3471728_+	transpeptidase	NA	NA	NA	NA	NA
AWO26568.1|3471698_3472466_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWO26569.1|3472670_3473249_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 259
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3477680	3481882	5043703		Bradyrhizobium_phage(33.33%)	5	NA	NA
AWO28140.1|3477680_3478412_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AWO26574.1|3478476_3478944_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWO26575.1|3478940_3479663_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWO26576.1|3479696_3480452_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWO26577.1|3480523_3481882_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
>prophage 260
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3492061	3493093	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO26583.1|3492061_3493093_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 261
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3506051	3510167	5043703		Saccharomonospora_phage(50.0%)	2	NA	NA
AWO26598.1|3506051_3509534_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
AWO26599.1|3509570_3510167_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 262
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3518995	3519754	5043703		Flavobacterium_phage(100.0%)	1	NA	NA
AWO26608.1|3518995_3519754_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 263
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3531333	3532758	5043703	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWO26619.1|3531333_3532758_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 264
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3536687	3537032	5043703		Lake_Baikal_phage(100.0%)	1	NA	NA
AWO26624.1|3536687_3537032_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 265
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3542943	3543741	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO26629.1|3542943_3543741_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.9	1.7e-13
>prophage 266
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3554125	3599344	5043703	bacteriocin,transposase,tRNA	Acanthamoeba_polyphaga_mimivirus(16.67%)	47	NA	NA
AWO26636.1|3554125_3556555_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.0e-40
AWO26637.1|3556628_3557159_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWO26638.1|3557173_3557878_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWO26639.1|3558055_3558511_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWO26640.1|3558547_3559474_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWO26641.1|3559512_3560931_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AWO26642.1|3560927_3561407_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AWO26643.1|3561749_3562334_+	fimbrial protein	NA	NA	NA	NA	NA
AWO26644.1|3562430_3563171_+	fimbrial chaperone	NA	NA	NA	NA	NA
AWO26645.1|3563205_3565806_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWO26646.1|3565822_3566395_+	fimbrial protein	NA	NA	NA	NA	NA
AWO26647.1|3566409_3567012_+	fimbrial protein StaE	NA	NA	NA	NA	NA
AWO26648.1|3567038_3567635_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AWO26649.1|3567686_3568940_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AWO26650.1|3569052_3569847_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AWO26651.1|3569858_3570710_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AWO26652.1|3570791_3570995_-|transposase	transposase	transposase	NA	NA	NA	NA
AWO26653.1|3571063_3571996_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
AWO26654.1|3572116_3572320_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26655.1|3572269_3572650_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AWO26656.1|3572653_3573883_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWO26657.1|3573946_3574387_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWO26658.1|3574491_3575262_-	ABC transporter permease	NA	NA	NA	NA	NA
AWO26659.1|3575258_3576185_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AWO26660.1|3576293_3576956_+	carbonic anhydrase	NA	NA	NA	NA	NA
AWO26661.1|3576996_3577533_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AWO26662.1|3577738_3580129_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AWO26663.1|3580175_3581726_-	multicopper oxidase CueO	NA	NA	NA	NA	NA
AWO26664.1|3581891_3582239_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26665.1|3582344_3583211_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AWO26666.1|3583226_3584021_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AWO26667.1|3584058_3584421_-	UPF0231 family protein	NA	NA	NA	NA	NA
AWO26668.1|3584595_3587193_-	aconitate hydratase B	NA	NA	NA	NA	NA
AWO26669.1|3587173_3587290_-	aconitate hydratase	NA	NA	NA	NA	NA
AWO26670.1|3587547_3589311_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AWO28142.1|3589381_3590806_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AWO26671.1|3591013_3592906_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AWO26672.1|3592920_3595584_-	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AWO28143.1|3595565_3595748_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26673.1|3595744_3596509_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AWO26674.1|3596964_3597255_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWO26675.1|3597255_3597495_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26676.1|3597662_3597953_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWO26677.1|3598006_3598195_-	HNH endonuclease	NA	NA	NA	NA	NA
AWO26678.1|3598361_3598652_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWO26679.1|3598652_3598892_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26680.1|3599059_3599344_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 267
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3603919	3604471	5043703		Sphingobium_phage(100.0%)	1	NA	NA
AWO26684.1|3603919_3604471_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 268
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3608717	3609761	5043703		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWO26689.1|3608717_3609761_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 269
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3635730	3637455	5043703		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWO26716.1|3635730_3637455_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 270
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3648932	3649631	5043703		Planktothrix_phage(100.0%)	1	NA	NA
AWO26727.1|3648932_3649631_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.8e-22
>prophage 271
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3661455	3666878	5043703		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AWO26737.1|3661455_3663807_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.1	6.7e-37
AWO26738.1|3663971_3666878_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 272
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3674655	3676616	5043703		Microcystis_phage(50.0%)	4	NA	NA
AWO26746.1|3674655_3675504_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
AWO26747.1|3675500_3675815_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AWO26748.1|3675817_3676051_-	antitoxin	NA	NA	NA	NA	NA
AWO26749.1|3676136_3676616_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 273
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3684510	3690160	5043703		Vibrio_phage(50.0%)	4	NA	NA
AWO26757.1|3684510_3686025_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
AWO26758.1|3686056_3687199_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWO26759.1|3687316_3688534_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AWO26760.1|3688606_3690160_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
>prophage 274
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3695663	3696812	5043703		Halovirus(100.0%)	1	NA	NA
AWO26766.1|3695663_3696812_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 275
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3701620	3704437	5043703	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWO26773.1|3701620_3704437_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 276
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3710864	3723853	5043703		uncultured_Caudovirales_phage(20.0%)	11	NA	NA
AWO26780.1|3710864_3712031_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	9.8e-90
AWO26781.1|3712265_3713525_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWO26782.1|3713653_3715147_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.8	8.0e-28
AWO26783.1|3715167_3715929_-	hypothetical protein	NA	NA	NA	NA	NA
AWO26784.1|3716798_3717929_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AWO26785.1|3718017_3719934_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AWO26786.1|3720304_3720709_+	DUF2541 domain-containing protein	NA	NA	NA	NA	NA
AWO26787.1|3720734_3721448_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
AWO26788.1|3721596_3722163_+	acetate uptake transporter	NA	NA	NA	NA	NA
AWO26789.1|3722197_3722785_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AWO26790.1|3722899_3723853_-	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 277
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3735510	3737624	5043703		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AWO26801.1|3735510_3736935_-	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	5.5e-10
AWO26802.1|3736934_3737624_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 278
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3740810	3746624	5043703		Bacillus_phage(33.33%)	6	NA	NA
AWO26807.1|3740810_3742748_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AWO28148.1|3742856_3742985_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AWO26808.1|3742958_3744626_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AWO26809.1|3744681_3744966_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWO26810.1|3744967_3745300_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AWO26811.1|3745391_3746624_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 279
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3753344	3754667	5043703		Geobacillus_virus(100.0%)	1	NA	NA
AWO26819.1|3753344_3754667_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.8e-79
>prophage 280
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3760744	3763620	5043703		Salmonella_phage(50.0%)	3	NA	NA
AWO26826.1|3760744_3760924_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AWO26827.1|3761032_3761638_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWO26828.1|3762030_3763620_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 281
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3771559	3772839	5043703		Salmonella_phage(50.0%)	2	NA	NA
AWO26839.1|3771559_3772099_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
AWO26840.1|3772101_3772839_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 282
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3776066	3781431	5043703		Tupanvirus(50.0%)	4	NA	NA
AWO26842.1|3776066_3777089_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
AWO26843.1|3777227_3778142_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AWO26844.1|3778356_3779718_+	MFS transporter	NA	NA	NA	NA	NA
AWO26845.1|3779766_3781431_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 283
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3794016	3794571	5043703		Clostridioides_phage(100.0%)	1	NA	NA
AWO26856.1|3794016_3794571_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 284
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3801915	3803376	5043703		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWO26866.1|3801915_3803376_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 285
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3813579	3815256	5043703		Escherichia_phage(100.0%)	2	NA	NA
AWO26877.1|3813579_3814176_-	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AWO26878.1|3814653_3815256_-	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 286
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3818615	3823184	5043703	transposase	Stx2-converting_phage(50.0%)	5	NA	NA
AWO26883.1|3818615_3819596_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
AWO26884.1|3820178_3820640_-	phospholipase	NA	NA	NA	NA	NA
AWO26885.1|3820767_3821193_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWO26886.1|3821189_3821540_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWO26887.1|3821570_3823184_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 287
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3845779	3847855	5043703		Acidithiobacillus_phage(100.0%)	1	NA	NA
AWO26912.1|3845779_3847855_+	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
>prophage 288
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3850995	3852186	5043703		Bacillus_phage(100.0%)	1	NA	NA
AWO26915.1|3850995_3852186_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
>prophage 289
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3857064	3864246	5043703	transposase	Klebsiella_phage(20.0%)	8	NA	NA
AWO26921.1|3857064_3857286_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
AWO28154.1|3857348_3857795_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWO26922.1|3857840_3858305_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.0	1.2e-14
AWO26923.1|3858646_3859465_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
AWO26924.1|3859485_3859620_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWO26925.1|3859619_3859814_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWO26926.1|3861943_3863485_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AWO26927.1|3863499_3864246_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 290
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3874657	3878998	5043703	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
AWO28156.1|3874657_3875038_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AWO26939.1|3875034_3875382_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
AWO28157.1|3875421_3876816_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.2	1.2e-256
AWO26940.1|3877054_3878428_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWO26941.1|3878791_3878998_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.6e-06
>prophage 291
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3884439	3890186	5043703		Enterobacteria_phage(66.67%)	7	NA	NA
AWO28159.1|3884439_3884631_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	65.6	8.3e-15
AWO26947.1|3884877_3886134_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AWO26948.1|3886146_3886434_-	PTS system transporter subunit IIB	NA	NA	NA	NA	NA
AWO26949.1|3886449_3886893_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AWO26950.1|3887163_3888195_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
AWO26951.1|3889684_3889957_+	hypothetical protein	NA	NA	NA	NA	NA
AWO26952.1|3889964_3890186_-	gyhfK	NA	H9YQA8	environmental_Halophage	94.4	1.4e-10
>prophage 292
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3900635	3904895	5043703		Nostoc_phage(50.0%)	2	NA	NA
AWO26962.1|3900635_3901832_+	DNA (cytosine-5-)-methyltransferase	NA	A0A191SAU1	Nostoc_phage	30.8	2.2e-36
AWO26963.1|3901925_3904895_+	histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	32.9	7.3e-81
>prophage 293
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3908574	3909486	5043703		Caulobacter_phage(100.0%)	1	NA	NA
AWO26967.1|3908574_3909486_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	5.5e-48
>prophage 294
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3912753	3913773	5043703		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AWO26971.1|3912753_3913773_+	alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.4e-44
>prophage 295
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3918902	3928178	5043703	tRNA	Klebsiella_phage(50.0%)	7	NA	NA
AWO26977.1|3918902_3919166_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	71.4	1.6e-11
AWO26978.1|3919184_3920405_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.9	4.8e-63
AWO26979.1|3920565_3921648_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWO26980.1|3921647_3922748_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWO26981.1|3923014_3924526_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWO26982.1|3924879_3925323_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWO26983.1|3925322_3928178_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	6.7e-140
>prophage 296
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3938524	3944621	5043703		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AWO26995.1|3938524_3939460_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AWO26996.1|3939472_3939934_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWO26997.1|3940006_3940393_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AWO26998.1|3940598_3943295_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	1.5e-45
AWO28161.1|3943435_3943489_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AWO26999.1|3943673_3944621_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 297
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3948259	3951020	5043703		Vibrio_phage(50.0%)	2	NA	NA
AWO27002.1|3948259_3950398_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AWO27003.1|3950555_3951020_+	anaerobic ribonucleotide reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.3	1.3e-53
>prophage 298
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	3955209	3961770	5043703		Klosneuvirus(33.33%)	6	NA	NA
AWO27008.1|3955209_3956208_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AWO27009.1|3956240_3957236_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWO27010.1|3957222_3958248_-	ABC transporter permease	NA	NA	NA	NA	NA
AWO27011.1|3958258_3959761_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
AWO27012.1|3959973_3960930_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWO27013.1|3961239_3961770_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
>prophage 299
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4004002	4005166	5043703		Ralstonia_phage(100.0%)	1	NA	NA
AWO27058.1|4004002_4005166_-	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 300
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4009008	4022033	5043703	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AWO27065.1|4009008_4011450_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
AWO27066.1|4011488_4011914_-	transcriptional regulator	NA	NA	NA	NA	NA
AWO27067.1|4012118_4013417_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.4	1.7e-66
AWO27068.1|4013520_4013718_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AWO27069.1|4013799_4014804_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWO27070.1|4014806_4016066_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AWO27071.1|4016151_4017432_-	GTPase HflX	NA	NA	NA	NA	NA
AWO27072.1|4017507_4017816_-	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWO27073.1|4017901_4018852_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWO27074.1|4018844_4020692_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
AWO27075.1|4020701_4022033_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	7.4e-17
>prophage 301
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4025948	4026494	5043703		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWO27079.1|4025948_4026494_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 302
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4034214	4035192	5043703		Tupanvirus(100.0%)	1	NA	NA
AWO27085.1|4034214_4035192_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 303
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4040112	4040646	5043703		Morganella_phage(100.0%)	1	NA	NA
AWO27091.1|4040112_4040646_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 304
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4044850	4046834	5043703		Vibrio_phage(50.0%)	2	NA	NA
AWO27099.1|4044850_4046497_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AWO27100.1|4046540_4046834_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 305
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4061111	4076316	5043703	tRNA	Enterobacteria_phage(50.0%)	9	NA	NA
AWO27112.1|4061111_4062569_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
AWO27113.1|4062805_4064323_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AWO27114.1|4064441_4064615_-	DUF2566 domain-containing protein	NA	NA	NA	NA	NA
AWO27115.1|4064642_4064939_-	endoribonuclease GhoS	NA	NA	NA	NA	NA
AWO27116.1|4065166_4065439_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWO27117.1|4065652_4069582_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.2	8.4e-218
AWO27118.1|4070436_4070616_+	hypothetical protein	NA	NA	NA	NA	NA
AWO27119.1|4070736_4071567_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWO27120.1|4072464_4076316_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.7	0.0e+00
>prophage 306
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4099451	4100954	5043703		Burkholderia_virus(100.0%)	1	NA	NA
AWO27138.1|4099451_4100954_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 307
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4105794	4106583	5043703		Pithovirus(100.0%)	1	NA	NA
AWO27142.1|4105794_4106583_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	2.5e-12
>prophage 308
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4112186	4113736	5043703		Bacillus_virus(50.0%)	2	NA	NA
AWO27150.1|4112186_4112945_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
AWO27151.1|4113055_4113736_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.1e-05
>prophage 309
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4119878	4126247	5043703		Bacillus_virus(50.0%)	5	NA	NA
AWO27159.1|4119878_4121411_+	allose ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.0	3.7e-12
AWO27160.1|4121389_4122370_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AWO27161.1|4122380_4123076_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AWO27162.1|4123059_4123989_+	allose kinase	NA	NA	NA	NA	NA
AWO27163.1|4124261_4126247_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.4	4.2e-149
>prophage 310
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4131492	4133640	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO27168.1|4131492_4133640_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	5.3e-33
>prophage 311
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4137557	4139085	5043703		Planktothrix_phage(100.0%)	2	NA	NA
AWO27172.1|4137557_4138394_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
AWO27173.1|4138380_4139085_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 312
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4148796	4150755	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO27185.1|4148796_4150755_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 313
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4156879	4158229	5043703		Moraxella_phage(100.0%)	1	NA	NA
AWO27192.1|4156879_4158229_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 314
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4162046	4165660	5043703		Enterobacteria_phage(50.0%)	2	NA	NA
AWO27200.1|4162046_4162583_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWO27201.1|4162837_4165660_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 315
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4175603	4177022	5043703		Erysipelothrix_phage(100.0%)	1	NA	NA
AWO27211.1|4175603_4177022_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	3.6e-38
>prophage 316
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4182421	4186550	5043703		Cronobacter_phage(25.0%)	4	NA	NA
AWO27215.1|4182421_4183426_-	ATPase	NA	K4F711	Cronobacter_phage	30.2	1.3e-26
AWO27216.1|4183422_4183980_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	28.8	2.2e-15
AWO27217.1|4184002_4185082_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.6	3.4e-28
AWO27218.1|4185134_4186550_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
>prophage 317
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4198670	4199279	5043703		Lactococcus_phage(100.0%)	1	NA	NA
AWO27230.1|4198670_4199279_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 318
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4206630	4207746	5043703		Mycoplasma_phage(100.0%)	1	NA	NA
AWO27236.1|4206630_4207746_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 319
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4232084	4235768	5043703		Dickeya_phage(100.0%)	1	NA	NA
AWO27261.1|4232084_4235768_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 320
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4249547	4251137	5043703		Prochlorococcus_phage(100.0%)	1	NA	NA
AWO27269.1|4249547_4251137_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 321
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4256499	4258263	5043703		Bacillus_phage(50.0%)	3	NA	NA
AWO27275.1|4256499_4256772_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AWO27276.1|4256958_4257549_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWO27277.1|4257591_4258263_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	3.6e-20
>prophage 322
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4266559	4274888	5043703		Vibrio_phage(50.0%)	2	NA	NA
AWO27287.1|4266559_4270783_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.3	5.5e-66
AWO27288.1|4270859_4274888_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 323
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4278883	4281936	5043703		Tupanvirus(50.0%)	4	NA	NA
AWO27295.1|4278883_4280068_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AWO27296.1|4280643_4280799_+	hypothetical protein	NA	NA	NA	NA	NA
AWO27297.1|4280808_4281003_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27298.1|4280985_4281936_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 324
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4290371	4296154	5043703	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AWO27302.1|4290371_4292216_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	9.3e-10
AWO27303.1|4292584_4293685_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
AWO27304.1|4293724_4294084_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28173.1|4294083_4294731_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWO27305.1|4294837_4296154_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.2	2.0e-59
>prophage 325
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4311906	4319153	5043703		Serratia_phage(33.33%)	5	NA	NA
AWO27318.1|4311906_4314204_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AWO27319.1|4314254_4314575_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AWO27320.1|4314589_4315669_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AWO27321.1|4315977_4318479_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AWO27322.1|4318490_4319153_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.6e-28
>prophage 326
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4325966	4327520	5043703		Pandoravirus(100.0%)	1	NA	NA
AWO27328.1|4325966_4327520_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	3.5e-10
>prophage 327
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4339142	4343645	5043703		Erwinia_phage(50.0%)	5	NA	NA
AWO27339.1|4339142_4340474_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AWO27340.1|4340540_4341467_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AWO27341.1|4341559_4342045_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWO27342.1|4342129_4342375_-	cell division protein ZapB	NA	NA	NA	NA	NA
AWO27343.1|4342799_4343645_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 328
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4355255	4360115	5043703		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AWO27356.1|4355255_4355954_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWO27357.1|4355950_4357324_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWO27358.1|4357428_4358103_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWO27359.1|4358251_4359235_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AWO27360.1|4359212_4359320_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWO27361.1|4359494_4360115_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	6.4e-64
>prophage 329
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4377732	4379568	5043703		Catovirus(100.0%)	1	NA	NA
AWO27376.1|4377732_4379568_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	24.0	6.6e-24
>prophage 330
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4394983	4397763	5043703		Escherichia_phage(50.0%)	3	NA	NA
AWO27393.1|4394983_4395769_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.4e-23
AWO27394.1|4395802_4396699_-	sugar kinase	NA	NA	NA	NA	NA
AWO27395.1|4396866_4397763_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 331
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4411487	4413958	5043703		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AWO27406.1|4411487_4412537_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
AWO28179.1|4412548_4413958_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 332
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4418079	4420866	5043703		uncultured_virus(100.0%)	1	NA	NA
AWO27410.1|4418079_4420866_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 333
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4434470	4435085	5043703		Streptococcus_phage(100.0%)	1	NA	NA
AWO27421.1|4434470_4435085_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 334
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4443864	4447151	5043703		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWO27429.1|4443864_4444641_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AWO27430.1|4444643_4445159_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWO27431.1|4445162_4445432_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AWO27432.1|4445510_4447151_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
>prophage 335
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4469145	4470654	5043703		Vibrio_phage(100.0%)	1	NA	NA
AWO27454.1|4469145_4470654_-	PTS N-acetylglucosamine transporter subunit IICB	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 336
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4478506	4481919	5043703	transposase	Sodalis_phage(50.0%)	3	NA	NA
AWO27462.1|4478506_4479367_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
AWO27463.1|4479404_4480025_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AWO28181.1|4480089_4481919_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 337
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4488523	4492382	5043703		Bacillus_phage(100.0%)	3	NA	NA
AWO27472.1|4488523_4490686_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AWO27473.1|4490769_4491486_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWO27474.1|4491485_4492382_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 338
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4503289	4504945	5043703		Tetraselmis_virus(100.0%)	1	NA	NA
AWO27487.1|4503289_4504945_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 339
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4512952	4519096	5043703		Enterobacteria_phage(40.0%)	6	NA	NA
AWO27494.1|4512952_4514083_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	7.4e-18
AWO27495.1|4514087_4514762_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWO27496.1|4514739_4515621_-	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AWO27497.1|4515639_4516707_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	1.3e-101
AWO27498.1|4516706_4517969_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
AWO27499.1|4517965_4519096_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 340
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4523138	4528552	5043703		Indivirus(33.33%)	5	NA	NA
AWO27504.1|4523138_4523468_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AWO27505.1|4523598_4524864_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AWO27506.1|4524871_4524994_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AWO27507.1|4524999_4526484_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWO27508.1|4526530_4528552_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.2e-113
>prophage 341
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4536148	4537795	5043703		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWO27515.1|4536148_4537795_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.0	2.5e-67
>prophage 342
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4551194	4557047	5043703		Enterobacteria_phage(33.33%)	5	NA	NA
AWO27523.1|4551194_4552085_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AWO27524.1|4552109_4553075_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWO27525.1|4553079_4554585_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AWO28185.1|4554592_4555012_-	D-ribose pyranase	NA	NA	NA	NA	NA
AWO27526.1|4555178_4557047_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 343
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4560215	4561208	5043703		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWO27528.1|4560215_4561208_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 344
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4573163	4580678	5043703		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AWO27543.1|4573163_4574534_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	5.3e-34
AWO27544.1|4574695_4576525_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
AWO27545.1|4576838_4577879_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AWO27546.1|4577964_4578924_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWO27547.1|4578923_4579814_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWO27548.1|4579904_4580678_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 345
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4591657	4592995	5043703		Moraxella_phage(100.0%)	1	NA	NA
AWO27559.1|4591657_4592995_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.9	1.2e-62
>prophage 346
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4603192	4610561	5043703		Staphylococcus_phage(33.33%)	8	NA	NA
AWO27568.1|4603192_4603450_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AWO27569.1|4603413_4603773_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWO27570.1|4603789_4603930_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWO27571.1|4604042_4604243_+	hypothetical protein	NA	NA	NA	NA	NA
AWO27572.1|4604536_4605940_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWO27573.1|4605944_4607045_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AWO27574.1|4607044_4608118_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWO27575.1|4608146_4610561_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 347
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4615169	4616318	5043703		Oenococcus_phage(100.0%)	1	NA	NA
AWO27582.1|4615169_4616318_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 348
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4620747	4632626	5043703		Cyanophage(16.67%)	13	NA	NA
AWO27586.1|4620747_4621161_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AWO27587.1|4621272_4621701_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AWO27588.1|4621898_4623560_+	putative transporter	NA	NA	NA	NA	NA
AWO27589.1|4623649_4624516_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWO27590.1|4624682_4626398_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.2e-40
AWO27591.1|4626394_4627888_+	DUF4976 domain-containing protein	NA	A0A2K9L727	Tupanvirus	28.6	1.1e-29
AWO27592.1|4627947_4628295_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AWO27593.1|4628284_4628647_+	hypothetical protein	NA	NA	NA	NA	NA
AWO27594.1|4628643_4629141_+	radical SAM protein	NA	NA	NA	NA	NA
AWO27595.1|4629148_4630333_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	1.2e-13
AWO27596.1|4630372_4630564_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27597.1|4630733_4630832_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWO27598.1|4630937_4632626_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.6e-56
>prophage 349
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4641267	4642602	5043703		Moraxella_phage(100.0%)	1	NA	NA
AWO28189.1|4641267_4642602_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	1.1e-65
>prophage 350
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4648852	4649890	5043703		Wolbachia_phage(100.0%)	1	NA	NA
AWO27614.1|4648852_4649890_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
>prophage 351
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4663151	4664543	5043703		environmental_Halophage(100.0%)	1	NA	NA
AWO27626.1|4663151_4664543_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	99.3	4.2e-71
>prophage 352
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4668844	4673865	5043703		Bordetella_phage(33.33%)	4	NA	NA
AWO27630.1|4668844_4670953_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWO27631.1|4670971_4671247_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWO27632.1|4671301_4671925_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AWO27633.1|4672182_4673865_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	19.7	1.9e-22
>prophage 353
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4677883	4682446	5043703		Xanthomonas_phage(25.0%)	7	NA	NA
AWO28191.1|4677883_4678339_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AWO27639.1|4678319_4679540_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.2e-43
AWO27640.1|4679711_4680380_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AWO27641.1|4680596_4680833_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWO27642.1|4680853_4681021_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWO27643.1|4681118_4681928_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AWO27644.1|4681966_4682446_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 354
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4698123	4707628	5043703		Synechococcus_phage(16.67%)	9	NA	NA
AWO27659.1|4698123_4699056_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
AWO27660.1|4699269_4700466_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.0	1.4e-35
AWO27661.1|4700475_4701501_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AWO27662.1|4701739_4702774_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AWO27663.1|4702760_4703720_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWO27664.1|4703723_4705007_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AWO27665.1|4705016_4706561_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWO27666.1|4706804_4707236_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWO27667.1|4707376_4707628_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 355
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4729336	4733948	5043703	tRNA	Tupanvirus(50.0%)	3	NA	NA
AWO27686.1|4729336_4731181_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
AWO27687.1|4731371_4732523_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AWO27688.1|4732652_4733948_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
>prophage 356
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4757996	4759538	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO27710.1|4757996_4759538_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 357
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4764855	4765851	5043703		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWO27716.1|4764855_4765851_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.4	5.4e-12
>prophage 358
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4769707	4771730	5043703	transposase	Macacine_betaherpesvirus(50.0%)	3	NA	NA
AWO27720.1|4769707_4771076_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AWO27721.1|4771177_4771330_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AWO27722.1|4771517_4771730_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 359
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4775384	4777718	5043703		Escherichia_phage(100.0%)	1	NA	NA
AWO27727.1|4775384_4777718_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 360
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4787762	4789756	5043703		Planktothrix_phage(50.0%)	2	NA	NA
AWO27736.1|4787762_4788746_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
AWO27737.1|4788742_4789756_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	5.6e-17
>prophage 361
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4838498	4839968	5043703		Bacillus_virus(50.0%)	2	NA	NA
AWO28196.1|4838498_4839146_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
AWO27778.1|4839197_4839968_-	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	29.6	2.3e-18
>prophage 362
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4850642	4856051	5043703		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
AWO27789.1|4850642_4851068_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
AWO27790.1|4851159_4851381_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27791.1|4851402_4851486_+	Damage inducible protein	NA	NA	NA	NA	NA
AWO27792.1|4851539_4852892_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AWO27793.1|4852963_4853806_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AWO27794.1|4854008_4856051_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
>prophage 363
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4865737	4868473	5043703		Staphylococcus_phage(100.0%)	1	NA	NA
AWO27804.1|4865737_4868473_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.9e-22
>prophage 364
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4875911	4876718	5043703		Bacillus_virus(100.0%)	1	NA	NA
AWO27814.1|4875911_4876718_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
>prophage 365
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4884611	4888743	5043703		Dickeya_phage(50.0%)	4	NA	NA
AWO27823.1|4884611_4885277_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
AWO27824.1|4885497_4885743_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AWO27825.1|4885844_4888043_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	1.7e-119
AWO27826.1|4888116_4888743_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 366
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4891749	4894568	5043703		Staphylococcus_phage(50.0%)	3	NA	NA
AWO27831.1|4891749_4892418_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AWO27832.1|4892410_4893469_+	ABC transporter permease	NA	NA	NA	NA	NA
AWO27833.1|4893713_4894568_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 367
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4901047	4902530	5043703		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AWO27840.1|4901047_4901815_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AWO27841.1|4901816_4902530_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 368
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4906071	4907882	5043703		Planktothrix_phage(50.0%)	2	NA	NA
AWO27845.1|4906071_4907142_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AWO27846.1|4907138_4907882_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.8	1.1e-09
>prophage 369
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4916138	4918235	5043703		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWO27855.1|4916138_4918235_+	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	34.7	6.1e-42
>prophage 370
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4928564	4931012	5043703		Dickeya_phage(100.0%)	1	NA	NA
AWO27863.1|4928564_4931012_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 371
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4941986	4944380	5043703		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWO27873.1|4941986_4944380_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 372
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4957433	4961201	5043703		Bacillus_phage(66.67%)	3	NA	NA
AWO27886.1|4957433_4958153_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AWO27887.1|4958149_4959502_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AWO27888.1|4959578_4961201_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 373
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4979672	4980509	5043703		Vibrio_phage(100.0%)	1	NA	NA
AWO27903.1|4979672_4980509_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 374
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	4999423	5008964	5043703		Acinetobacter_phage(25.0%)	10	NA	NA
AWO27924.1|4999423_4999987_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
AWO27925.1|5000072_5001293_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWO27926.1|5001359_5003462_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
AWO27927.1|5003500_5004133_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWO27928.1|5004139_5004355_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27929.1|5004434_5004839_+	OsmC family protein	NA	NA	NA	NA	NA
AWO27930.1|5004893_5005763_-	phosphoribulokinase	NA	NA	NA	NA	NA
AWO27931.1|5005816_5006035_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AWO27932.1|5006028_5007051_-	hydrolase	NA	NA	NA	NA	NA
AWO27933.1|5007050_5008964_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
>prophage 375
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	5014534	5023101	5043703		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
AWO27942.1|5014534_5014921_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
AWO27943.1|5014920_5015280_+	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AWO27944.1|5015286_5015574_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AWO27945.1|5015699_5016074_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AWO27946.1|5016170_5016641_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AWO27947.1|5016737_5018852_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AWO27948.1|5018922_5020107_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AWO27949.1|5020398_5023101_+	lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	2.0e-40
>prophage 376
CP029576	Escherichia coli strain DA33135 chromosome, complete genome	5043703	5026473	5043429	5043703	integrase	Burkholderia_virus(36.84%)	27	5023357:5023370	5037516:5037529
5023357:5023370	attL	AAAAAATTCATTCC	NA	NA	NA	NA
AWO27955.1|5026473_5026872_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
AWO27956.1|5026843_5027296_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
AWO27957.1|5027285_5027501_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27958.1|5027490_5027721_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27959.1|5027717_5028401_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
AWO27960.1|5028397_5028703_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27961.1|5028712_5028985_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27962.1|5029272_5029803_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	6.9e-59
AWO27963.1|5029830_5030100_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27964.1|5030102_5031269_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
AWO27965.1|5031279_5033049_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	68.3	4.8e-229
AWO27966.1|5033052_5033964_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
AWO27967.1|5033974_5034283_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
AWO27968.1|5034335_5034524_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AWO27969.1|5034624_5034963_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
AWO27970.1|5035079_5035844_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
AWO27971.1|5036035_5036251_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27972.1|5036249_5036654_+	hypothetical protein	NA	NA	NA	NA	NA
AWO27973.1|5036629_5037373_-	hypothetical protein	NA	NA	NA	NA	NA
AWO27974.1|5037503_5037854_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
5037516:5037529	attR	AAAAAATTCATTCC	NA	NA	NA	NA
AWO27975.1|5037856_5038594_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
AWO28204.1|5038622_5039234_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
AWO27976.1|5039230_5039557_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AWO27977.1|5039556_5039868_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
AWO27978.1|5039870_5040413_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
AWO27979.1|5040409_5041933_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
AWO27980.1|5041932_5043429_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
>prophage 1
CP029577	Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence	139191	27888	53034	139191	protease,transposase	Escherichia_phage(62.5%)	27	NA	NA
AWO28234.1|27888_28542_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWO28235.1|28761_29226_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWO28236.1|29222_29327_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28237.1|29510_30821_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWO28238.1|31097_31958_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWO28239.1|32079_32784_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO28240.1|32952_33813_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWO28241.1|35027_35948_+|transposase	IS4 family transposase	transposase	A4KWT9	Enterobacteria_phage	100.0	2.7e-175
AWO28242.1|35981_36686_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO28243.1|37677_37869_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28244.1|37874_38120_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28245.1|38170_39307_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWO28246.1|40749_41454_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO28247.1|42021_42882_+	EamA family transporter	NA	NA	NA	NA	NA
AWO28248.1|42913_44113_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWO28249.1|44191_44845_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWO28363.1|44876_45113_-	relaxase	NA	NA	NA	NA	NA
AWO28250.1|45166_46003_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AWO28251.1|46002_46806_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AWO28252.1|46866_47682_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWO28253.1|47989_48202_-	replication C family protein	NA	NA	NA	NA	NA
AWO28254.1|48226_48931_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWO28255.1|49052_49958_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWO28256.1|49954_51193_+	MFS transporter	NA	NA	NA	NA	NA
AWO28257.1|51192_51777_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWO28258.1|51722_52079_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28364.1|52269_53034_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
CP029577	Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence	139191	59012	110136	139191	integrase,transposase	Escherichia_phage(33.33%)	54	86088:86108	104755:104775
AWO28267.1|59012_59717_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWO28268.1|60065_60593_+	iron transporter	NA	NA	NA	NA	NA
AWO28269.1|60696_62076_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AWO28270.1|62078_63362_+	ABC transporter permease	NA	NA	NA	NA	NA
AWO28271.1|63321_64482_+	ABC transporter permease	NA	NA	NA	NA	NA
AWO28272.1|64486_65182_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AWO28273.1|65099_65654_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AWO28274.1|65678_66164_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28275.1|67068_67572_-	hypothetical protein	NA	A0A077SK28	Escherichia_phage	93.2	6.9e-24
AWO28276.1|67865_68237_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28277.1|69822_71097_-	TieB	NA	NA	NA	NA	NA
AWO28278.1|71066_73328_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AWO28279.1|73496_74273_-	energy transducer TonB	NA	NA	NA	NA	NA
AWO28280.1|74280_75198_-	iron-regulated protein	NA	NA	NA	NA	NA
AWO28281.1|76023_76278_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28282.1|76611_76794_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28283.1|77193_77376_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28284.1|77379_77589_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28285.1|77606_77942_-	colicin transporter	NA	NA	NA	NA	NA
AWO28286.1|77919_78138_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28287.1|78070_78418_+	hypothetical protein	NA	NA	NA	NA	NA
AWO28288.1|78437_78947_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28289.1|78943_79204_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28290.1|80037_80409_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28291.1|80702_82226_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
AWO28292.1|82727_83132_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWO28293.1|83128_83476_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWO28294.1|84555_85578_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
AWO28295.1|85574_86357_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
86088:86108	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
AWO28296.1|87095_87887_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
AWO28297.1|87893_89864_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
AWO28298.1|91106_91379_+	transcriptional regulator	NA	NA	NA	NA	NA
AWO28299.1|92225_93395_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28300.1|93761_93950_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWO28301.1|94070_94811_+	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
AWO28302.1|95053_96031_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
AWO28303.1|96340_96829_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28304.1|96942_97149_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28305.1|97205_97847_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28306.1|99303_99531_-	hypothetical protein	NA	NA	NA	NA	NA
AWO28307.1|100168_100387_+	antitoxin CcdA	NA	NA	NA	NA	NA
AWO28308.1|100388_100694_+	toxin CcdB	NA	NA	NA	NA	NA
AWO28309.1|100694_101504_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
AWO28310.1|101641_101917_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWO28311.1|101910_102555_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AWO28312.1|102783_103755_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
AWO28313.1|103723_104152_+	plasmid stability protein	NA	NA	NA	NA	NA
AWO28314.1|104469_105270_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
104755:104775	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
AWO28315.1|105266_106439_-|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
AWO28316.1|106569_107562_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.8	7.3e-102
AWO28317.1|107561_107999_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
AWO28318.1|107995_108244_-	DinI family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
AWO28319.1|108378_108897_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
AWO28320.1|108915_110136_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
