The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	27183	85412	2927257	protease,transposase	unidentified_phage(22.22%)	59	NA	NA
AWN82562.1|27183_28113_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	2.9e-20
AWN82563.1|30039_30690_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
AWN82564.1|31088_31781_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN82565.1|32030_32411_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82566.1|32475_32796_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82567.1|32984_33371_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82568.1|33411_33885_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN82569.1|33952_35545_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	8.6e-12
AWN82570.1|35882_37256_-	MFS transporter	NA	NA	NA	NA	NA
AWN82571.1|37433_37757_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82572.1|37937_41249_-	MMPL family transporter	NA	NA	NA	NA	NA
AWN82573.1|41245_41848_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWN82574.1|42098_42359_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82575.1|42572_43235_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN82576.1|43234_44164_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN82577.1|44175_44805_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN82578.1|44807_46061_-	CBS domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
AWN82579.1|46693_47347_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN82580.1|47412_47634_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82581.1|47757_47943_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82582.1|47979_49836_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.0	7.5e-68
AWN82583.1|49855_50083_+	copper chaperone	NA	NA	NA	NA	NA
AWN82584.1|50230_50815_+	DNA-binding protein	NA	NA	NA	NA	NA
AWN82585.1|50863_51523_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN82586.1|52136_52931_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWN82587.1|52923_54144_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWN82588.1|54127_54727_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AWN82589.1|54754_55537_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	39.5	7.6e-38
AWN82590.1|55533_56559_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.3	6.0e-59
AWN82591.1|56555_56663_-	anthranilate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWN82592.1|57314_58454_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82593.1|58585_60412_-	MFS transporter	NA	NA	NA	NA	NA
AWN82594.1|60570_61149_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWN82595.1|61271_61646_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82596.1|61629_62352_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82597.1|62446_63367_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AWN82598.1|63624_64134_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82599.1|64201_64396_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82600.1|64420_64927_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82601.1|65491_65608_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82602.1|65961_66312_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85231.1|66772_67585_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82603.1|67581_68118_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82604.1|68110_68746_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82605.1|68732_69227_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82606.1|69413_70181_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWN82607.1|70177_71083_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AWN82608.1|71217_72633_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN82609.1|72795_73947_-	acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AWN82610.1|73954_74659_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AWN82611.1|74669_76016_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AWN82612.1|76729_78109_+	aspartate kinase	NA	NA	NA	NA	NA
AWN82613.1|78110_79118_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AWN82614.1|79121_80180_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWN82615.1|80172_80316_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82616.1|80375_80753_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82617.1|81039_81453_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWN82618.1|82421_83438_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
AWN82619.1|84395_85412_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
>prophage 2
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	328206	408972	2927257	protease,holin,transposase	Faecalibacterium_phage(19.05%)	75	NA	NA
AWN85240.1|328206_328896_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AWN82837.1|329049_330066_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
AWN85241.1|330313_330838_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AWN82838.1|331349_332876_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	1.6e-52
AWN82839.1|333146_335243_+	transcriptional antiterminator	NA	NA	NA	NA	NA
AWN82840.1|335243_335555_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
AWN82841.1|335696_336983_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
AWN82842.1|336999_337422_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82843.1|337443_338304_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWN82844.1|338417_339059_+	kinase	NA	NA	NA	NA	NA
AWN82845.1|339345_340176_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN82846.1|340168_341038_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AWN82847.1|341077_342073_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
AWN82848.1|342627_343407_+	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	25.4	1.3e-05
AWN82849.1|343677_343932_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82850.1|344757_345687_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AWN82851.1|346298_347315_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
AWN82852.1|347582_347834_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AWN82853.1|347887_348730_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	6.7e-157
AWN82854.1|349020_349710_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
AWN82855.1|349870_351241_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.8e-11
AWN85242.1|351604_352423_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWN82856.1|352739_353009_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AWN82857.1|353249_354257_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWN82858.1|354308_354800_+	PTS mannose/fructose/sorbose transporter subunit IIB	NA	NA	NA	NA	NA
AWN82859.1|354842_355652_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWN82860.1|355644_356496_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
AWN82861.1|356525_358769_+	alpha-glucosidase	NA	NA	NA	NA	NA
AWN82862.1|358858_359275_+	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
AWN85243.1|359267_360953_+	glucohydrolase	NA	NA	NA	NA	NA
AWN82863.1|361135_362947_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.4e-45
AWN85244.1|362939_364625_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	7.9e-40
AWN82864.1|365165_365288_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AWN82865.1|368614_368803_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82866.1|368909_369776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN82867.1|369932_370949_+	linear amide C-N hydrolase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	29.2	5.8e-22
AWN82868.1|371068_372049_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82869.1|372195_373890_-	oleate hydratase	NA	NA	NA	NA	NA
AWN82870.1|373901_374030_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82871.1|374125_374689_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWN82872.1|374773_375142_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
AWN82873.1|375191_375773_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AWN82874.1|375759_376779_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AWN82875.1|376818_376959_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82876.1|377169_377598_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AWN82877.1|377783_377963_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85245.1|378171_379077_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN82878.1|379140_380157_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
AWN82879.1|380572_381985_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AWN82880.1|382217_382511_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN82881.1|382589_383753_+	MFS transporter	NA	NA	NA	NA	NA
AWN82882.1|383935_384547_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN82883.1|384536_385067_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
AWN82884.1|385186_386050_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
AWN82885.1|386046_386343_-|transposase	transposase	transposase	NA	NA	NA	NA
AWN82886.1|386573_387455_-	fructose-1,6-bisphosphate aldolase, class II	NA	NA	NA	NA	NA
AWN82887.1|388041_389775_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	23.9	2.7e-27
AWN82888.1|389860_390874_-	serine hydrolase	NA	X2KYU1	Mycobacterium_phage	26.4	1.5e-17
AWN82889.1|390952_392020_-	dipeptide epimerase	NA	NA	NA	NA	NA
AWN82890.1|392232_392982_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	56.3	1.4e-73
AWN82891.1|393011_393764_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
AWN82892.1|394091_395435_+	glutamine synthetase	NA	NA	NA	NA	NA
AWN82893.1|395564_396692_+	hydrolase	NA	NA	NA	NA	NA
AWN82894.1|396811_398167_+	APC family permease	NA	NA	NA	NA	NA
AWN82895.1|398231_398660_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWN82896.1|398831_399698_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	31.9	2.1e-28
AWN82897.1|399819_400842_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWN82898.1|400987_401332_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN82899.1|401439_402684_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	6.7e-12
AWN82900.1|402864_403467_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82901.1|403466_404897_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.3	2.8e-38
AWN82902.1|404915_405281_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWN82903.1|405317_406463_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AWN82904.1|406579_406891_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWN82905.1|407955_408972_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.4e-36
>prophage 3
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	414832	510764	2927257	integrase,transposase	Lactobacillus_phage(52.63%)	93	427121:427180	493984:495369
AWN82909.1|414832_415849_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
AWN82910.1|416856_417933_+	class C sortase	NA	NA	NA	NA	NA
AWN82911.1|418123_418858_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
AWN82912.1|418850_420467_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWN82913.1|420762_421461_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.3	5.8e-29
AWN82914.1|421448_422564_+	sensor histidine kinase	NA	NA	NA	NA	NA
AWN82915.1|422666_423548_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	6.6e-22
AWN82916.1|423544_424693_+	ABC transporter permease	NA	NA	NA	NA	NA
AWN85246.1|424721_425261_+	ABC transporter permease	NA	NA	NA	NA	NA
427121:427180	attL	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTTGTGCGATAATTGACAGATGAGGAAT	NA	NA	NA	NA
AWN82917.1|427164_427461_+|transposase	transposase	transposase	NA	NA	NA	NA
AWN82918.1|427457_428321_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
AWN82919.1|428439_433104_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82920.1|433150_434167_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
AWN82921.1|434230_434722_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82922.1|435265_440317_-	peptidase S8	NA	NA	NA	NA	NA
AWN82923.1|441299_443834_+	M1 family peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.6	6.0e-68
AWN82924.1|444070_444283_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82925.1|444417_445860_+	amino acid permease	NA	NA	NA	NA	NA
AWN82926.1|445971_446475_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AWN82927.1|446653_447547_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
AWN82928.1|447701_448568_+	AP endonuclease	NA	NA	NA	NA	NA
AWN82929.1|448584_449418_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	NA	NA	NA	NA
AWN82930.1|449514_450405_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWN82931.1|450438_451656_+	MFS transporter	NA	NA	NA	NA	NA
AWN82932.1|451674_452574_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWN82933.1|453014_453830_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AWN82934.1|453863_454793_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	5.9e-106
AWN82935.1|454982_455528_-	hydrophobic protein	NA	NA	NA	NA	NA
AWN82936.1|455848_457018_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
AWN82937.1|457130_457391_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
AWN82938.1|457480_458104_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82939.1|458171_458423_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AWN82940.1|458476_459319_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	6.7e-157
AWN82941.1|459420_459675_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82942.1|459675_459783_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82943.1|459867_460575_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWN85247.1|460734_461157_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
AWN82944.1|461149_461503_-	XRE family transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
AWN82945.1|461746_461995_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
AWN82946.1|462036_462237_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82947.1|462207_463041_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
AWN82948.1|463101_463860_+	hypothetical protein	NA	A0A1B0YEA7	Lactobacillus_phage	49.4	1.9e-41
AWN82949.1|463860_464040_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82950.1|464032_464284_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AWN82951.1|464349_464706_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
AWN82952.1|464705_464798_+	hypothetical protein	NA	A0A0P0IZE0	Lactobacillus_phage	96.7	4.5e-11
AWN82953.1|464790_464994_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82954.1|464976_465522_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82955.1|465702_466017_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82956.1|466009_466756_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	55.3	1.7e-34
AWN82957.1|466770_467595_+	DNA replication protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.5	2.3e-117
AWN82958.1|467695_467791_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWN82959.1|467817_468747_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AWN82960.1|469206_469629_+	replication terminator protein	NA	NA	NA	NA	NA
AWN82961.1|469630_470368_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	42.6	2.9e-47
AWN82962.1|470379_470667_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	76.8	1.6e-38
AWN82963.1|470736_471069_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82964.1|471583_472027_+	transcriptional regulator	NA	A0A0P0IZI6	Lactobacillus_phage	96.6	2.8e-77
AWN82965.1|472371_472569_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82966.1|472540_473194_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82967.1|473444_474443_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.7	1.0e-50
AWN82968.1|474638_474857_-	CsbD family protein	NA	NA	NA	NA	NA
AWN82969.1|476489_477652_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	9.6e-29
AWN82970.1|477743_478079_+	ribonucleoside-diphosphate reductase	NA	A0A0N7IRA2	Lactobacillus_phage	90.6	6.8e-52
AWN82971.1|478075_478186_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82972.1|478291_479308_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	2.7e-35
AWN82973.1|479438_480620_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82974.1|480723_481311_+	recombinase family protein	NA	Q2A092	Sodalis_phage	34.4	1.3e-18
AWN82975.1|481444_482806_+	MFS transporter	NA	NA	NA	NA	NA
AWN82976.1|483006_483564_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82977.1|484084_484872_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN82978.1|484921_485314_-	hypothetical protein	NA	NA	NA	NA	NA
AWN82979.1|485542_485635_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWN82980.1|485661_486591_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AWN82981.1|486686_486935_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AWN82982.1|487128_488235_-	anion permease	NA	NA	NA	NA	NA
AWN82983.1|489149_490166_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
AWN85248.1|490829_491012_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82984.1|491005_491923_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AWN82985.1|492069_492678_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	52.8	1.8e-50
AWN82986.1|492688_493957_+	NADPH-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	47.7	1.8e-49
AWN82987.1|494027_494324_+|transposase	transposase	transposase	NA	NA	NA	NA
AWN82988.1|494320_495184_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
AWN82989.1|495343_496315_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	94.0	4.2e-171
493984:495369	attR	GGCTCCTATGCTGTAATTACGGACAAAAATAGTTTGTGCGATAATTGACAGATGAGGAATATTTTATGACCAATACAGCTATTCGCTACACCCCCGAATTTAAGCAAACCTTGATTGATCTTCATGAAAAAGGACACTCATTCAAAGAACTACATGAAGAATACGGTCCTTCCTTAGACACTATTCGCAAATGGGTTCAGGCGGCCACTGTCATTGCCATTGATCATCAAGGTACTGCTGTGACCAACGAACAGTTCAAGCAACTTCAAAAAGAAAATCGCCGTTTGAGGGAAGAACTCGATATTTTAAAACGAGCGGCGGTGTTGCTGGCAAAGCGTTGATTCATAGCGGCCGAAAGGCCGCTCTTTTTATGATTCAAGATCAATTGAGCCGGGGGCACCGCATCACAGTTATTCTCCGAGCGTTACGGATCCCTTCGAGTACCTACTATGACTGGTTAAAGTGGCATCCTAAGTCACGAAATCGCCGCCGAATTAAGCTTAAAGAGCTGGTTCAGGTTCTTTGGCAACGTCGAAAATTTTACGGATACGTGCGGATTGCTAAACGCATTCGTAAATTACTTAAATGCCGCTTAAGTGACCGCACGATTTGGAAAGTCATGCGTGAATTGGGGATTCAATCGACAATGTATCGTAAACGCTCTAAAAAGCCTACCACAACCACTGACATGCCACAAAAACCTAATTTAATGCGACACCTAGCTGACTTGTCTGAGGTCGTGACCACCGATATCACCTATATTCAACTGATCAACCAAAAATGGGTTTACCTTGCAACAGCGTATGATCCAAAAGCGAGAAAAGTCTTAGCTTGGCAAGTGGGTCAACAGATGACACAAGACCTCGCGGTCGCACCGATTCAAGCGTTAATTCACCAAGGTTATACTTTTAAGATGGTGCATAGCGATATGGGTAGTCAATATACCAGTTGTTTATTTGAGACAACATTGACAGATGCGCACCTGCGTCACTCATATTCGCGCAAAGGCAAACCGGCTGATAACGGGCGGATCGAAGCCTACCATTCGCTATTGAAACGAGAATGGGTCCGGCTGGAGCAGATCAACTATGAATCAATTCTAGACGTCACTGAATCCATTGCTCGTTACAACACCTTCTACAATCATGATCGCGAGACCAACGGTCGCGGTGCTTGCAAAAGAAAGTCAGCAGCTGCATAAGTAACCTTTCAATAGGCGCACAGCCCTGGGGAAAGACCAGATGCCAGGGCTTGTTTGTAGTCTCTCTTGCACGTTAAACAAGATTAAACGCTGATAAAAGATCTGATAATGCGTGAATTTAAGTGACAACCATACGCATTCGGCAGAACCGGACAATTTTTGTCCGGACCATTGACATTCTTGCC	NA	NA	NA	NA
AWN82990.1|497022_498159_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
AWN82991.1|499963_500677_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWN82992.1|501382_502294_+	FliK family flagellar hook-length control protein	NA	NA	NA	NA	NA
AWN82993.1|502566_503955_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWN82994.1|505044_505713_+	WxL domain-containing protein	NA	NA	NA	NA	NA
AWN82995.1|506780_507158_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWN82996.1|507154_509158_+	lectin	NA	NA	NA	NA	NA
AWN82997.1|509278_509395_+	hypothetical protein	NA	NA	NA	NA	NA
AWN82998.1|509843_510764_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
>prophage 4
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	630481	654158	2927257	portal,tail,transposase,head,capsid	Acinetobacter_phage(33.33%)	29	NA	NA
AWN83100.1|630481_631644_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
AWN83101.1|631735_632089_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN83102.1|632214_633366_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	33.2	2.4e-56
AWN83103.1|633352_634897_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	3.6e-39
AWN83104.1|634960_635254_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AWN83105.1|635319_635571_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83106.1|635847_636159_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83107.1|636316_637237_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AWN83108.1|637226_638000_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83109.1|638378_639419_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83110.1|639436_639775_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWN83111.1|639935_640241_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83112.1|640396_640696_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83113.1|640756_641779_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AWN83114.1|642032_642395_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83115.1|642532_643012_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83116.1|643004_644171_-	AI-2E family transporter	NA	NA	NA	NA	NA
AWN83117.1|644674_644869_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83118.1|644997_645624_+	LexA repressor	NA	A0A1B2APZ3	Phage_Wrath	35.9	4.9e-11
AWN83119.1|645752_646226_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83120.1|646239_647187_-	AEC family transporter	NA	NA	NA	NA	NA
AWN83121.1|647209_647827_-	flavin reductase family protein	NA	NA	NA	NA	NA
AWN83122.1|647869_648037_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83123.1|648088_648997_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83124.1|649091_649652_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AWN85254.1|649659_650010_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWN83125.1|650219_651155_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWN83126.1|651379_652255_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN83127.1|652995_654158_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
>prophage 5
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	774774	841795	2927257	portal,tail,terminase,integrase,holin,tRNA,transposase,head,capsid	Lactobacillus_phage(90.0%)	80	774344:774361	849814:849831
774344:774361	attL	TCGCAGTCGCAGAAACCT	NA	NA	NA	NA
AWN83230.1|774774_777186_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
AWN83231.1|777254_777365_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83232.1|777451_779095_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWN83233.1|779099_779810_+	pseudouridine synthase	NA	NA	NA	NA	NA
AWN83234.1|779952_780168_+	DNA-binding protein	NA	NA	NA	NA	NA
AWN83235.1|780283_781105_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AWN83236.1|781101_781605_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWN83237.1|781928_783068_-|integrase	site-specific integrase	integrase	A0A0P0IXL3	Lactobacillus_phage	98.4	3.9e-216
AWN83238.1|783175_784339_-	HNH endonuclease	NA	NA	NA	NA	NA
AWN85260.1|784407_785721_-	DNA methyltransferase	NA	A0A1B0XVT8	Campylobacter_phage	36.8	2.0e-22
AWN83239.1|785841_786708_-	hypothetical protein	NA	A0A0P0IV64	Lactobacillus_phage	92.3	3.2e-146
AWN83240.1|786694_787054_-	XRE family transcriptional regulator	NA	A0A0P0I3L3	Lactobacillus_phage	63.9	1.8e-34
AWN83241.1|787323_787521_+	hypothetical protein	NA	A0A0P0IK60	Lactobacillus_phage	100.0	5.2e-28
AWN83242.1|787517_788240_+	phage regulatory protein	NA	A0A0P0IDD0	Lactobacillus_phage	99.6	6.9e-126
AWN83243.1|788247_788460_+	hypothetical protein	NA	A0A0N7IRA6	Lactobacillus_phage	98.6	1.7e-29
AWN85261.1|788568_788793_+	DUF771 domain-containing protein	NA	A0A0P0IQT9	Lactobacillus_phage	100.0	2.6e-39
AWN83244.1|788792_788885_+	hypothetical protein	NA	A0A0P0I7S8	Lactobacillus_phage	100.0	1.2e-11
AWN83245.1|788881_789094_+	hypothetical protein	NA	A0A0P0IXL9	Lactobacillus_phage	100.0	2.5e-36
AWN83246.1|789103_789979_+	hypothetical protein	NA	A0A0P0IJW5	Lactobacillus_phage	99.3	7.2e-170
AWN83247.1|789981_790176_+	hypothetical protein	NA	A0A0P0IZQ2	Lactobacillus_phage	98.4	5.5e-30
AWN83248.1|790175_791063_+	recombinase RecT	NA	A0A0P0HRX2	Lactobacillus_phage	99.3	7.3e-162
AWN83249.1|791071_791317_+	XRE family transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	96.3	3.2e-35
AWN83250.1|791321_792155_+	DNA replication protein DnaD	NA	A0A0N7IRA7	Lactobacillus_phage	90.0	6.5e-120
AWN83251.1|792192_793014_+	DNA replication protein	NA	A0A0P0I3L9	Lactobacillus_phage	99.3	8.8e-154
AWN83252.1|793010_793310_+	hypothetical protein	NA	A0A0P0IK66	Lactobacillus_phage	82.8	3.4e-39
AWN83253.1|793272_793557_+	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	97.9	7.5e-44
AWN83254.1|793525_793873_+	hypothetical protein	NA	A0A0P0IQU7	Lactobacillus_phage	98.3	1.3e-61
AWN83255.1|793865_794444_+	HNH endonuclease	NA	A0A0P0I7T6	Lactobacillus_phage	98.4	5.9e-104
AWN83256.1|794457_794880_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	98.6	4.6e-74
AWN83257.1|795172_795496_+	hypothetical protein	NA	A0A0N7IRA8	Lactobacillus_phage	99.1	2.8e-55
AWN83258.1|795574_796024_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0P0IZR0	Lactobacillus_phage	92.6	4.9e-74
AWN83259.1|796684_797065_+	hypothetical protein	NA	A0A0P0HRY0	Lactobacillus_phage	96.8	2.4e-69
AWN85262.1|797134_797509_+	hypothetical protein	NA	A0A1B0YE76	Lactobacillus_phage	98.4	3.1e-61
AWN83260.1|797511_799242_+|terminase	terminase large subunit	terminase	A0A0P0IJU3	Lactobacillus_phage	99.5	0.0e+00
AWN83261.1|799260_800496_+|portal	phage portal protein	portal	A0A1B0Y4Q9	Lactobacillus_phage	99.5	1.7e-233
AWN83262.1|800473_801181_+	peptidase	NA	A0A1B0Y857	Lactobacillus_phage	98.7	1.8e-126
AWN83263.1|801185_802418_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	95.6	1.4e-216
AWN83264.1|802491_802740_+	hypothetical protein	NA	A0A0P0I3K0	Lactobacillus_phage	96.3	1.3e-36
AWN83265.1|802753_803053_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0Y2R7	Lactobacillus_phage	100.0	8.1e-49
AWN83266.1|803018_803357_+|head,tail	phage head-tail joining protein	head,tail	A0A0N7IRA3	Lactobacillus_phage	100.0	2.2e-58
AWN83267.1|803340_803670_+	hypothetical protein	NA	A0A0P0IDB8	Lactobacillus_phage	99.1	2.6e-56
AWN83268.1|803659_804043_+	hypothetical protein	NA	A0A0P0IQS9	Lactobacillus_phage	98.4	2.2e-67
AWN83269.1|804054_804702_+|tail	phage tail protein	tail	A0A0P0I7R6	Lactobacillus_phage	94.9	2.7e-113
AWN83270.1|804778_805144_+	hypothetical protein	NA	A0A0P0IXK4	Lactobacillus_phage	99.2	1.0e-61
AWN83271.1|805203_805386_+	hypothetical protein	NA	A0A0P0IJV2	Lactobacillus_phage	100.0	2.2e-28
AWN83272.1|805405_808576_+|tail	phage tail tape measure protein	tail	A0A1B0YA78	Lactobacillus_phage	98.2	0.0e+00
AWN83273.1|808582_809278_+|tail	phage tail protein	tail	A0A1B0Y2S2	Lactobacillus_phage	98.7	3.5e-127
AWN83274.1|812640_813561_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
AWN83275.1|813587_814733_+	hypothetical protein	NA	A0A1B0Y2S0	Lactobacillus_phage	95.5	2.0e-167
AWN83276.1|814761_815187_+	hypothetical protein	NA	A0A1B0Y2S1	Lactobacillus_phage	97.9	3.7e-71
AWN83277.1|815189_815459_+	hypothetical protein	NA	A0A1B0Y3N0	Lactobacillus_phage	96.6	9.9e-38
AWN83278.1|815504_815798_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	70.8	4.9e-30
AWN83279.1|815787_816222_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	96.5	5.3e-49
AWN83280.1|816221_816410_+	hypothetical protein	NA	A0A0P0IQT6	Lactobacillus_phage	100.0	6.7e-25
AWN83281.1|816396_817371_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I7S1	Lactobacillus_phage	99.7	1.7e-196
AWN83282.1|817891_819403_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWN83283.1|819430_820990_+	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
AWN83284.1|821086_821560_+	glutathione peroxidase	NA	NA	NA	NA	NA
AWN83285.1|821904_823110_+	putative C-S lyase	NA	NA	NA	NA	NA
AWN83286.1|823243_824572_-	phosphohydrolase	NA	NA	NA	NA	NA
AWN83287.1|824761_825028_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AWN83288.1|825076_826420_+	PFL family protein	NA	NA	NA	NA	NA
AWN83289.1|826529_827585_+	competence protein	NA	NA	NA	NA	NA
AWN83290.1|827774_828410_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AWN83291.1|828479_829073_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AWN83292.1|829266_829938_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AWN83293.1|829939_830737_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWN83294.1|830736_831639_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AWN83295.1|831747_832806_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AWN83296.1|832962_833598_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWN83297.1|833619_834438_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AWN83298.1|834656_835655_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.8	1.8e-55
AWN83299.1|835759_836800_-	lactonase family protein	NA	NA	NA	NA	NA
AWN83300.1|837071_837449_+	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
AWN83301.1|837561_837831_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AWN83302.1|837958_838948_-	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	71.9	8.2e-138
AWN83303.1|839175_840123_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWN83304.1|840188_841031_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWN83305.1|841074_841287_-	hypothetical protein	NA	NA	NA	NA	NA
AWN83306.1|841285_841795_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
849814:849831	attR	AGGTTTCTGCGACTGCGA	NA	NA	NA	NA
>prophage 6
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	1319147	1326587	2927257	transposase	unidentified_phage(33.33%)	8	NA	NA
AWN83738.1|1319147_1320026_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.8	3.8e-54
AWN83739.1|1320129_1321326_+	CCA-adding enzyme	NA	H7BUW3	unidentified_phage	32.3	1.1e-43
AWN83740.1|1321463_1321919_+	hypothetical protein	NA	NA	NA	NA	NA
AWN83741.1|1322014_1323907_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	8.5e-51
AWN83742.1|1323935_1324886_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.6	1.5e-125
AWN83743.1|1325013_1325505_+	dihydrofolate reductase	NA	A0A1L7N103	Ralstonia_phage	35.9	5.3e-21
AWN83744.1|1325544_1325631_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWN83745.1|1325657_1326587_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.5	3.2e-19
>prophage 7
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	1729419	1829012	2927257	tail,portal,terminase,protease,holin,integrase,tRNA,transposase,head,capsid	Lactobacillus_phage(75.0%)	107	1763468:1763492	1834602:1834626
AWN84129.1|1729419_1730582_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	2.8e-28
AWN84130.1|1731097_1731313_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84131.1|1731309_1733064_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.5	1.1e-39
AWN84132.1|1733387_1734554_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AWN84133.1|1734537_1735818_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AWN84134.1|1735829_1737011_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AWN84135.1|1737355_1737655_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84136.1|1737655_1738486_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AWN84137.1|1738633_1739197_-	restriction endonuclease	NA	NA	NA	NA	NA
AWN84138.1|1739309_1740128_+	aldose epimerase	NA	NA	NA	NA	NA
AWN84139.1|1740187_1741327_-	M20 family peptidase	NA	NA	NA	NA	NA
AWN84140.1|1741405_1742011_-	ECF transporter S component	NA	NA	NA	NA	NA
AWN84141.1|1742738_1743203_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWN84142.1|1743195_1743648_-	SprT family protein	NA	NA	NA	NA	NA
AWN84143.1|1743789_1744542_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.9e-09
AWN84144.1|1744534_1745434_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWN84145.1|1745430_1746426_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN84146.1|1746912_1747350_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84147.1|1747486_1750147_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.8	1.4e-75
AWN84148.1|1750454_1751612_-	serine hydrolase	NA	NA	NA	NA	NA
AWN84149.1|1751878_1752706_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.3	6.1e-70
AWN84150.1|1752708_1753902_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	27.1	2.7e-10
AWN85289.1|1753905_1755369_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	2.6e-100
AWN84151.1|1755731_1756433_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84152.1|1756457_1757603_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWN84153.1|1757709_1758507_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.7	2.1e-35
AWN84154.1|1758519_1760496_-	S9 family peptidase	NA	NA	NA	NA	NA
AWN84155.1|1760824_1761652_-	phosphohydrolase	NA	NA	NA	NA	NA
AWN84156.1|1761713_1763180_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.9	8.9e-72
AWN84157.1|1763223_1763409_-	hypothetical protein	NA	NA	NA	NA	NA
1763468:1763492	attL	GGTCCTTATGTGTAGGTTTCTGGGC	NA	NA	NA	NA
AWN84158.1|1763654_1765973_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	2.8e-35
AWN84159.1|1766398_1766773_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84160.1|1766912_1767335_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84161.1|1769421_1770558_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AWN84162.1|1770666_1770984_-	glutaredoxin	NA	NA	NA	NA	NA
AWN84163.1|1771154_1772822_-	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
AWN84164.1|1773036_1773204_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
AWN84165.1|1773239_1775351_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AWN84166.1|1776028_1776781_-	acyltransferase	NA	NA	NA	NA	NA
AWN84167.1|1777268_1777778_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84168.1|1777770_1778352_-	hypothetical protein	NA	C1KFI5	Lactobacillus_virus	37.1	5.0e-10
AWN84169.1|1778378_1778963_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84170.1|1779094_1780147_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0P0I386	Lactobacillus_phage	95.4	6.1e-200
AWN84171.1|1780148_1780580_-|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	94.7	3.1e-41
AWN84172.1|1780569_1780863_-	hypothetical protein	NA	A0A0P0IK41	Lactobacillus_phage	78.4	1.1e-34
AWN84173.1|1780892_1781024_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	93.0	1.2e-17
AWN84174.1|1781010_1781307_-	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	89.6	6.6e-43
AWN84175.1|1781316_1783836_-|tail	phage tail protein	tail	Q9T0W6	Lactobacillus_phage	87.2	1.4e-295
AWN84176.1|1783832_1785731_-|tail	phage tail protein	tail	A0A2D1GPH2	Lactobacillus_phage	79.0	1.1e-287
AWN84177.1|1785731_1790606_-|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	93.2	0.0e+00
AWN84178.1|1790728_1791142_-	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
AWN84179.1|1791212_1791341_-	hypothetical protein	NA	A0A2D1GPF6	Lactobacillus_phage	85.4	1.2e-09
AWN84180.1|1791344_1791956_-|tail	phage tail protein	tail	B4XYQ1	Lactobacillus_phage	95.1	5.1e-106
AWN84181.1|1791989_1792376_-|tail	phage tail protein	tail	U5U3W4	Lactobacillus_phage	94.5	2.3e-67
AWN84182.1|1792375_1792762_-	hypothetical protein	NA	B4XYP9	Lactobacillus_phage	97.7	1.5e-66
AWN84183.1|1792761_1793091_-|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	96.3	7.6e-56
AWN84184.1|1793080_1793440_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	94.1	2.0e-57
AWN84185.1|1793450_1793690_-	hypothetical protein	NA	U5U4N8	Lactobacillus_phage	81.0	2.1e-15
AWN84186.1|1793707_1794910_-|capsid	phage major capsid protein	capsid	B4XYP6	Lactobacillus_phage	97.7	3.2e-213
AWN84187.1|1794951_1795581_-|head,protease	HK97 family phage prohead protease	head,protease	U5U3W0	Lactobacillus_phage	97.6	9.6e-116
AWN84188.1|1795534_1796788_-|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.3	2.2e-236
AWN84189.1|1796793_1796985_-	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	98.4	5.0e-28
AWN84190.1|1796996_1798709_-	amino acid transporter	NA	A0A2D1GPB8	Lactobacillus_phage	98.9	0.0e+00
AWN84191.1|1798730_1799186_-|terminase	terminase	terminase	U5U3Z1	Lactobacillus_phage	99.3	4.7e-80
AWN84192.1|1799386_1800181_-	HNH endonuclease	NA	U5U440	Lactobacillus_phage	98.5	8.3e-149
AWN84193.1|1800170_1800752_-	hypothetical protein	NA	U5U409	Lactobacillus_phage	88.6	8.9e-92
AWN84194.1|1800764_1801088_-	hypothetical protein	NA	U5U7A9	Lactobacillus_phage	71.1	2.0e-29
AWN84195.1|1801090_1801411_-	ribonucleoside-diphosphate reductase	NA	U5U741	Lactobacillus_phage	98.1	3.1e-54
AWN84196.1|1801414_1801747_-	hypothetical protein	NA	U5U4N5	Lactobacillus_phage	69.0	9.7e-35
AWN84197.1|1801781_1802943_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.5e-29
AWN84198.1|1802926_1803205_-	hypothetical protein	NA	B4XYU1	Lactobacillus_phage	49.4	3.2e-15
AWN84199.1|1803191_1804409_-	hypothetical protein	NA	A8YQN3	Lactobacillus_phage	98.0	8.6e-238
AWN84200.1|1804445_1804763_-	hypothetical protein	NA	A0A0P0IV15	Lactobacillus_phage	100.0	8.4e-28
AWN84201.1|1805283_1805718_-	transcriptional regulator	NA	B4XYT9	Lactobacillus_phage	73.4	1.5e-51
AWN84202.1|1805969_1806188_-	XRE family transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	91.7	9.5e-31
AWN85290.1|1806200_1806269_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84203.1|1806265_1806460_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	72.4	2.1e-13
AWN84204.1|1806456_1806903_-	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	93.7	6.7e-39
AWN84205.1|1806899_1807202_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84206.1|1807212_1807443_-	hypothetical protein	NA	U5U426	Lactobacillus_phage	67.1	1.2e-20
AWN84207.1|1807445_1807691_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84208.1|1807687_1808080_-	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	70.4	2.9e-46
AWN84209.1|1808069_1808330_-	hypothetical protein	NA	A0A2D1GPC7	Lactobacillus_phage	38.0	5.7e-06
AWN84210.1|1808319_1808553_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84211.1|1808539_1808935_-	hypothetical protein	NA	A0A140HLR7	Bacillus_phage	50.0	6.4e-25
AWN84212.1|1808921_1809488_-	hypothetical protein	NA	B4XYT4	Lactobacillus_phage	46.9	2.4e-33
AWN84213.1|1809649_1810114_-	endonuclease	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	5.0e-13
AWN84214.1|1810126_1810528_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	71.5	5.8e-50
AWN84215.1|1810569_1810914_-	hypothetical protein	NA	U5U420	Lactobacillus_phage	100.0	1.3e-61
AWN84216.1|1810915_1812178_-	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	98.3	6.4e-236
AWN84217.1|1812174_1813002_-	helix-turn-helix domain-containing protein	NA	A0A2D1GPH5	Lactobacillus_phage	76.7	3.3e-116
AWN84218.1|1812994_1813309_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84219.1|1813383_1813587_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84220.1|1813579_1813672_-	hypothetical protein	NA	A0A0P0IZE0	Lactobacillus_phage	100.0	1.6e-11
AWN84221.1|1813668_1814028_-	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	7.0e-63
AWN84222.1|1814093_1814345_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AWN84223.1|1814337_1814517_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84224.1|1814730_1815501_-	phage antirepressor protein	NA	Q6J1W3	Lactobacillus_phage	60.0	2.1e-72
AWN84225.1|1815497_1815773_-	phage repressor protein	NA	A0A0P0IX93	Lactobacillus_phage	97.1	7.8e-30
AWN84226.1|1815906_1816680_+	multidrug transporter	NA	Q6J1W4	Lactobacillus_phage	93.4	1.6e-133
AWN84227.1|1816735_1817533_+	SHOCT domain-containing protein	NA	NA	NA	NA	NA
AWN84228.1|1817623_1818250_+	hypothetical protein	NA	A0A0A0RSV1	Bacillus_phage	44.3	5.9e-09
AWN84229.1|1818452_1819622_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.7	4.7e-217
AWN84230.1|1820072_1820711_+	NADH-flavin reductase	NA	NA	NA	NA	NA
AWN84231.1|1820749_1821262_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84232.1|1821414_1821939_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84233.1|1827728_1829012_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.7	2.3e-84
1834602:1834626	attR	GCCCAGAAACCTACACATAAGGACC	NA	NA	NA	NA
>prophage 8
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	1873524	1922988	2927257	tail,transposase	Faecalibacterium_phage(33.33%)	42	NA	NA
AWN84279.1|1873524_1874541_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
AWN84280.1|1874629_1875268_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.8e-24
AWN84281.1|1875405_1875966_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWN84282.1|1875988_1876867_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	3.2e-16
AWN84283.1|1876863_1877952_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.0e-16
AWN84284.1|1878002_1878314_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84285.1|1878417_1879401_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN84286.1|1879669_1880623_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN85292.1|1880727_1882398_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN84287.1|1882760_1883441_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AWN84288.1|1883437_1883770_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84289.1|1883981_1884245_-	Na+-transporting malonate decarboxylase, carboxybiotin decarboxylase subunit, madB	NA	NA	NA	NA	NA
AWN84290.1|1884351_1886007_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	21.1	3.4e-11
AWN84291.1|1887653_1888670_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
AWN84292.1|1888962_1889064_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84293.1|1889214_1889613_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AWN84294.1|1889704_1889998_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84295.1|1890146_1893749_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
AWN84296.1|1894101_1894863_+	peptidase M10	NA	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
AWN84297.1|1894849_1895056_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84298.1|1895037_1895805_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWN84299.1|1898412_1898742_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN84300.1|1899116_1899761_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AWN84301.1|1901368_1902531_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.1	2.8e-28
AWN84302.1|1902879_1903503_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84303.1|1903885_1904179_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84304.1|1904927_1906706_-	ATPase	NA	NA	NA	NA	NA
AWN84305.1|1906950_1907967_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
AWN84306.1|1908037_1909054_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84307.1|1909307_1910324_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
AWN84308.1|1910630_1912184_-	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
AWN84309.1|1912356_1913283_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.9	3.1e-30
AWN84310.1|1913438_1913801_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84311.1|1913847_1914138_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84312.1|1914201_1915611_-	dipeptidase	NA	NA	NA	NA	NA
AWN84313.1|1915942_1916419_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWN84314.1|1916423_1918715_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AWN84315.1|1918856_1919096_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84316.1|1919412_1919607_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AWN84317.1|1919678_1921508_+	potassium transporter	NA	NA	NA	NA	NA
AWN84318.1|1921563_1922469_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AWN84319.1|1922526_1922988_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 9
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	1980508	2039999	2927257	protease,transposase	unidentified_phage(21.43%)	57	NA	NA
AWN84366.1|1980508_1981429_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	2.6e-21
AWN84367.1|1981913_1984064_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.6	5.2e-121
AWN84368.1|1984445_1985210_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
AWN84369.1|1985387_1986281_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN84370.1|1986668_1987913_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.2	1.1e-09
AWN84371.1|1987990_1988659_-	sugar transferase	NA	NA	NA	NA	NA
AWN84372.1|1988914_1989757_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.5	7.2e-34
AWN84373.1|1989831_1990857_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.4	2.0e-70
AWN84374.1|1990859_1991432_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	43.0	3.2e-33
AWN84375.1|1991443_1992316_-	glucose-1-phosphate thymidylyltransferase	NA	K7QKA7	Escherichia_phage	58.9	5.6e-98
AWN84376.1|1992529_1993522_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
AWN84377.1|1993525_1994599_-	glycosyl transferase	NA	NA	NA	NA	NA
AWN84378.1|1994620_1995709_-	EpsG family protein	NA	NA	NA	NA	NA
AWN84379.1|1995705_1996728_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWN84380.1|1996708_1997521_-	glycosyl transferase	NA	NA	NA	NA	NA
AWN84381.1|1997510_1998590_-	glycosyl transferase	NA	NA	NA	NA	NA
AWN84382.1|1998601_1999384_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWN84383.1|1999380_2000772_-	glycosyl transferase	NA	NA	NA	NA	NA
AWN84384.1|2001217_2001982_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWN84385.1|2001998_2002913_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AWN84386.1|2003274_2003994_+	acyltransferase	NA	NA	NA	NA	NA
AWN84387.1|2004275_2004776_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84388.1|2004887_2005601_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AWN84389.1|2005597_2005822_-	DUF2829 domain-containing protein	NA	A8AT88	Listeria_phage	35.2	4.0e-08
AWN84390.1|2005820_2006012_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84391.1|2006106_2006418_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN84392.1|2006677_2007316_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWN84393.1|2007624_2008602_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	6.2e-21
AWN84394.1|2008603_2009656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	4.3e-20
AWN84395.1|2009667_2010666_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN84396.1|2010665_2011589_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN84397.1|2011763_2013386_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN85294.1|2013817_2015242_-	MFS transporter	NA	NA	NA	NA	NA
AWN84398.1|2015425_2015629_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84399.1|2015780_2016344_-	elongation factor P	NA	NA	NA	NA	NA
AWN84400.1|2016894_2017086_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84401.1|2017563_2018271_-	lactate utilization protein C	NA	NA	NA	NA	NA
AWN84402.1|2018263_2019748_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWN84403.1|2019744_2020527_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84404.1|2020998_2021565_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84405.1|2021816_2022152_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWN84406.1|2022208_2023309_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWN84407.1|2023417_2023828_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
AWN84408.1|2023799_2024006_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84409.1|2024002_2025427_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AWN84410.1|2025677_2025941_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84411.1|2025870_2026161_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84412.1|2026230_2028453_+	alpha-galactosidase	NA	NA	NA	NA	NA
AWN84413.1|2028515_2029259_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AWN84414.1|2030748_2033331_-	ATP-dependent endonuclease	NA	U5J9B0	Bacillus_phage	25.3	1.3e-49
AWN84415.1|2033371_2033962_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84416.1|2034387_2034993_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85295.1|2035516_2035675_-	alpha-galactosidase	NA	NA	NA	NA	NA
AWN84417.1|2035677_2036490_-	sugar kinase	NA	NA	NA	NA	NA
AWN84418.1|2036900_2037917_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	9.3e-36
AWN84419.1|2038136_2039057_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AWN84420.1|2039156_2039999_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	1.1e-154
>prophage 10
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2195009	2282009	2927257	tail,portal,terminase,protease,holin,integrase,tRNA,transposase,head,capsid	Lactobacillus_phage(54.55%)	102	2214172:2214186	2273539:2273553
AWN84555.1|2195009_2195654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN85308.1|2195797_2196793_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84556.1|2196854_2197883_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84557.1|2197883_2198771_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AWN84558.1|2198767_2199133_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84559.1|2199274_2199928_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AWN84560.1|2200145_2202098_+	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	9.7e-58
AWN84561.1|2202374_2202710_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWN84562.1|2202805_2203831_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	5.4e-60
AWN84563.1|2203864_2204398_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AWN84564.1|2204381_2205104_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWN84565.1|2205587_2206193_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84566.1|2206481_2207759_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
AWN84567.1|2207927_2208446_-	folate transporter FolT	NA	NA	NA	NA	NA
AWN84568.1|2208935_2209910_+	asparaginase	NA	NA	NA	NA	NA
AWN84569.1|2210005_2210749_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AWN84570.1|2210843_2211701_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.4	9.4e-74
AWN84571.1|2211702_2212041_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	38.9	4.6e-16
AWN84572.1|2212045_2213023_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	27.8	1.1e-25
AWN84573.1|2213022_2213352_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85309.1|2213386_2214031_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.1	3.1e-53
2214172:2214186	attL	AGGCAAAAAGCGGCA	NA	NA	NA	NA
AWN84574.1|2214285_2214546_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84575.1|2214540_2214804_-	DUF2508 domain-containing protein	NA	NA	NA	NA	NA
AWN84576.1|2214803_2215403_-	recombination protein RecR	NA	NA	NA	NA	NA
AWN84577.1|2215718_2216027_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWN84578.1|2216043_2217741_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	44.4	3.0e-55
AWN84579.1|2218213_2218720_-	nucleoside deaminase	NA	NA	NA	NA	NA
AWN84580.1|2218861_2219191_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84581.1|2219247_2219844_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWN84582.1|2219948_2222558_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
AWN84583.1|2222960_2223374_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN84584.1|2223523_2224456_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWN84585.1|2228372_2229572_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	38.0	9.2e-67
AWN84586.1|2232204_2233104_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWN84587.1|2233601_2234651_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC8	Lactobacillus_phage	64.9	1.1e-124
AWN84588.1|2234650_2234923_-|holin	holin	holin	Q9MCC7	Lactobacillus_phage	92.2	1.4e-39
AWN84589.1|2234912_2235146_-	hypothetical protein	NA	U5U779	Lactobacillus_phage	75.0	4.7e-12
AWN84590.1|2235138_2235516_-	hypothetical protein	NA	A0A0P0IJI4	Lactobacillus_phage	94.4	2.4e-61
AWN84591.1|2235537_2238693_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84592.1|2238661_2240758_-	hypothetical protein	NA	Q597U4	Lactobacillus_virus	51.8	7.7e-202
AWN84593.1|2240770_2242036_-	hypothetical protein	NA	Q597U5	Lactobacillus_virus	42.0	4.8e-90
AWN84594.1|2242039_2245036_-|tail	phage tail tape measure protein	tail	A0A097BYC3	Leuconostoc_phage	66.7	9.8e-126
AWN84595.1|2245035_2245305_-	hypothetical protein	NA	Q597U7	Lactobacillus_virus	35.2	7.9e-11
AWN84596.1|2245340_2245781_-	hypothetical protein	NA	A0A2P0ZL56	Lactobacillus_phage	50.7	3.2e-25
AWN84597.1|2245844_2246474_-|tail	phage major tail protein, TP901-1 family	tail	G8FV40	Pediococcus_virus	77.9	1.9e-87
AWN84598.1|2246475_2246841_-	hypothetical protein	NA	Q597V0	Lactobacillus_virus	46.6	2.3e-21
AWN84599.1|2246837_2247212_-|tail	phage tail protein	tail	Q597V1	Lactobacillus_virus	36.1	7.6e-12
AWN84600.1|2247204_2247501_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84601.1|2247500_2247860_-	DNA packaging protein	NA	A0A2K9VBX4	Lactobacillus_phage	62.7	8.3e-24
AWN84602.1|2247859_2248738_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	81.5	1.5e-146
AWN84603.1|2248806_2249727_-|capsid	phage capsid protein	capsid	A0A2P0ZL66	Lactobacillus_phage	74.2	4.8e-116
AWN84604.1|2249740_2250283_-	scaffolding protein	NA	Q597V6	Lactobacillus_virus	54.5	8.5e-20
AWN84605.1|2250434_2250704_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84606.1|2250654_2250888_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85310.1|2250897_2251608_-|head	phage head morphogenesis protein	head	Q597V7	Lactobacillus_virus	50.9	2.6e-61
AWN84607.1|2251633_2253154_-|portal	phage portal protein	portal	Q597V8	Lactobacillus_virus	63.7	5.1e-179
AWN84608.1|2253155_2254454_-|terminase	PBSX family phage terminase large subunit	terminase	Q597V9	Lactobacillus_virus	69.1	1.1e-179
AWN84609.1|2254437_2255022_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	46.6	1.7e-26
AWN84610.1|2255168_2256317_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.1	3.2e-218
AWN84611.1|2256341_2256596_-	hypothetical protein	NA	U5U404	Lactobacillus_phage	96.4	1.9e-43
AWN84612.1|2257275_2257704_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN84613.1|2257779_2257998_-	XRE family transcriptional regulator	NA	A0A0P0IXA5	Lactobacillus_phage	94.4	2.5e-31
AWN85311.1|2258010_2258079_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84614.1|2258075_2258270_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	72.4	2.1e-13
AWN84615.1|2258266_2258713_-	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	93.7	6.7e-39
AWN84616.1|2258709_2259012_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84617.1|2259172_2259418_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84618.1|2259503_2259692_-	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	91.9	1.1e-24
AWN84619.1|2259688_2260006_-	hypothetical protein	NA	C1KFE7	Lactobacillus_virus	48.6	1.3e-20
AWN84620.1|2260116_2260671_-	endonuclease	NA	B4XYU1	Lactobacillus_phage	38.1	4.4e-24
AWN84621.1|2260663_2261185_-	hypothetical protein	NA	Q8LTB6	Lactobacillus_phage	60.1	2.2e-41
AWN84622.1|2261181_2261445_-	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	96.6	2.5e-41
AWN84623.1|2261552_2261918_-	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
AWN84624.1|2261914_2262169_-	hypothetical protein	NA	A0A0P0IQP0	Lactobacillus_phage	97.6	6.5e-39
AWN84625.1|2262215_2262665_-	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	91.9	1.0e-66
AWN84626.1|2262661_2262877_-	XRE family transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	88.6	2.0e-28
AWN84627.1|2262907_2263456_-	hypothetical protein	NA	A8YQL7	Lactobacillus_phage	78.2	5.6e-80
AWN84628.1|2263476_2263959_-	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	90.7	4.7e-62
AWN84629.1|2263971_2264928_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	85.8	3.2e-115
AWN85312.1|2264943_2265768_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.7	2.5e-148
AWN84630.1|2265724_2266618_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	94.8	1.7e-150
AWN85313.1|2266587_2267028_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	58.3	7.3e-38
AWN84631.1|2267020_2267272_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84632.1|2267259_2267388_-	hypothetical protein	NA	A0A0P0IQL2	Lactobacillus_phage	97.6	3.0e-16
AWN84633.1|2267390_2267717_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84634.1|2267707_2268181_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWN84635.1|2268243_2268402_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84636.1|2268398_2268665_-	XRE family transcriptional regulator	NA	A0A0K2CYW6	Paenibacillus_phage	37.5	4.4e-06
AWN84637.1|2268814_2269240_+	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	44.6	8.9e-25
AWN85314.1|2269324_2269711_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84638.1|2269770_2270349_+	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	92.2	3.1e-97
AWN84639.1|2270442_2271657_+|integrase	integrase	integrase	A0A1X9I5L3	Streptococcus_phage	27.2	1.4e-35
AWN84640.1|2271792_2272161_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AWN84641.1|2272201_2272708_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
AWN84642.1|2273132_2274365_+	MFS transporter	NA	NA	NA	NA	NA
2273539:2273553	attR	AGGCAAAAAGCGGCA	NA	NA	NA	NA
AWN85315.1|2274422_2275211_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84643.1|2275248_2275767_-	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
AWN84644.1|2276023_2277229_+	MFS transporter	NA	NA	NA	NA	NA
AWN84645.1|2277299_2278673_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWN84646.1|2278860_2279550_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
AWN84647.1|2279649_2280075_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
AWN84648.1|2280992_2282009_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
>prophage 11
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2307854	2368552	2927257	portal,protease,bacteriocin,tRNA,transposase	Streptococcus_phage(25.0%)	56	NA	NA
AWN84677.1|2307854_2309261_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.6	8.8e-53
AWN84678.1|2309934_2310951_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
AWN84679.1|2312213_2312801_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84680.1|2312800_2312992_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84681.1|2313126_2313234_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84682.1|2313467_2314961_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AWN84683.1|2315108_2316089_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWN84684.1|2316204_2316876_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AWN84685.1|2317059_2317890_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84686.1|2318036_2318876_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN84687.1|2318888_2319905_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84688.1|2319911_2320286_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84689.1|2320450_2321722_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AWN84690.1|2322039_2322816_-	ABC transporter permease	NA	NA	NA	NA	NA
AWN84691.1|2322833_2323721_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
AWN84692.1|2324023_2325139_-	PIN domain nuclease	NA	NA	NA	NA	NA
AWN84693.1|2325161_2326526_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AWN84694.1|2326542_2327085_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
AWN84695.1|2327305_2327596_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWN84696.1|2328334_2329654_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
AWN84697.1|2330012_2331359_+	aminopeptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
AWN84698.1|2331586_2332687_+	ABC transporter permease	NA	NA	NA	NA	NA
AWN84699.1|2332686_2333880_+	ABC transporter permease	NA	NA	NA	NA	NA
AWN84700.1|2333942_2334821_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
AWN84701.1|2334982_2337037_+|portal	portal protein	portal	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
AWN84702.1|2339985_2340609_-	CBS domain-containing protein	NA	NA	NA	NA	NA
AWN84703.1|2341108_2341780_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AWN84704.1|2342289_2343411_+	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AWN84705.1|2343424_2343709_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AWN84706.1|2343899_2345015_-	lactate oxidase	NA	NA	NA	NA	NA
AWN84707.1|2345202_2345409_-	CsbD family protein	NA	NA	NA	NA	NA
AWN84708.1|2345541_2345799_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84709.1|2345869_2346076_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84710.1|2346300_2346552_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84711.1|2346678_2346855_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85317.1|2346879_2348112_+	MFS transporter	NA	NA	NA	NA	NA
AWN84712.1|2348190_2349447_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	5.6e-99
AWN84713.1|2349535_2350369_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
AWN84714.1|2350685_2350880_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84715.1|2351133_2351670_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84716.1|2351858_2353082_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84717.1|2353317_2354145_-	class C sortase	NA	NA	NA	NA	NA
AWN84718.1|2354151_2355711_-	pilus assembly protein	NA	NA	NA	NA	NA
AWN84719.1|2355707_2357030_-	pilus assembly protein	NA	NA	NA	NA	NA
AWN84720.1|2357031_2360037_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84721.1|2360314_2360872_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84722.1|2360966_2362163_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
AWN84723.1|2362371_2363427_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
AWN84724.1|2363392_2363611_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84725.1|2363697_2364327_+	XRE family transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
AWN84726.1|2364472_2365750_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	1.9e-49
AWN84727.1|2365965_2366295_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84728.1|2366291_2367080_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84729.1|2367132_2367921_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84730.1|2367965_2368244_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWN84731.1|2368267_2368552_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 12
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2371686	2417048	2927257	bacteriocin,protease,transposase	Indivirus(33.33%)	46	NA	NA
AWN84733.1|2371686_2373066_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
AWN84734.1|2373562_2374978_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN84735.1|2375127_2375301_-|bacteriocin	ComC/BlpC family peptide pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
AWN84736.1|2375622_2375847_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84737.1|2375878_2376049_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84738.1|2376267_2376537_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84739.1|2376648_2377506_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN84740.1|2378018_2378351_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84741.1|2378602_2378794_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84742.1|2379107_2379443_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWN84743.1|2380309_2380564_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWN84744.1|2380565_2380973_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
AWN84745.1|2381124_2382078_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	8.2e-10
AWN84746.1|2382282_2383017_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN84747.1|2383042_2384206_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
AWN84748.1|2384381_2385758_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AWN84749.1|2385890_2386649_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84750.1|2386813_2386957_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84751.1|2386940_2388548_-	divalent metal cation transporter	NA	NA	NA	NA	NA
AWN84752.1|2388935_2391653_+	cation-transporting ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.5	1.7e-60
AWN84753.1|2391952_2392318_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84754.1|2392471_2393845_-	MFS transporter	NA	NA	NA	NA	NA
AWN84755.1|2393884_2395414_-	copper oxidase	NA	NA	NA	NA	NA
AWN84756.1|2395540_2395732_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84757.1|2395860_2396499_+	cation transporter	NA	NA	NA	NA	NA
AWN84758.1|2396519_2396852_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84759.1|2396971_2397913_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN84760.1|2397909_2398806_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWN84761.1|2398802_2399546_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	1.3e-15
AWN84762.1|2399821_2401288_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWN84763.1|2401488_2401758_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AWN84764.1|2401846_2401966_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84765.1|2402166_2403084_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN84766.1|2403323_2403965_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWN84767.1|2404082_2404715_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWN84768.1|2404871_2405396_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84769.1|2407603_2407762_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84770.1|2407760_2408663_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWN84771.1|2408673_2408913_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84772.1|2408906_2409056_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84773.1|2409204_2410224_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWN84774.1|2410304_2410718_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84775.1|2411768_2414300_-	cell surface protein	NA	NA	NA	NA	NA
AWN84776.1|2414635_2415397_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWN84777.1|2415564_2416437_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWN84778.1|2416529_2417048_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2514435	2621345	2927257	tRNA,integrase,transposase	Streptococcus_phage(29.03%)	96	2570501:2570515	2624278:2624292
AWN84867.1|2514435_2514993_-|tRNA	peptidyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWN84868.1|2515667_2516648_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWN84869.1|2517054_2518425_+	L,D-transpeptidase/peptidoglycan binding protein	NA	NA	NA	NA	NA
AWN84870.1|2518926_2519592_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AWN85321.1|2519714_2519810_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84871.1|2519867_2520572_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWN84872.1|2520965_2521277_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84873.1|2521520_2522954_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
AWN84874.1|2523089_2527547_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AWN84875.1|2527534_2527759_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84876.1|2527820_2528342_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.3	4.6e-07
AWN84877.1|2528525_2528909_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V2U7	Faecalibacterium_phage	36.1	1.2e-09
AWN84878.1|2528928_2529177_-	antitoxin	NA	NA	NA	NA	NA
AWN84879.1|2529244_2530381_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.8	1.8e-35
AWN84880.1|2530367_2530742_-	holo-ACP synthase	NA	NA	NA	NA	NA
AWN84881.1|2530911_2532420_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.3	4.1e-72
AWN84882.1|2532719_2534108_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AWN84883.1|2534168_2534933_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84884.1|2535064_2535712_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AWN84885.1|2535708_2536386_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84886.1|2536485_2536914_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84887.1|2536939_2537026_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84888.1|2541428_2541671_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84889.1|2541712_2542036_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	42.3	1.2e-16
AWN84890.1|2542053_2542425_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	52.0	1.7e-27
AWN84891.1|2542502_2542766_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84892.1|2542776_2543016_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84893.1|2543050_2543299_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84894.1|2543318_2543606_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84895.1|2545252_2545513_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84896.1|2545828_2547019_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	43.7	7.9e-95
AWN84897.1|2547008_2547335_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84898.1|2547465_2548200_+	site-specific DNA-methyltransferase	NA	A0A2K8IKC3	Lactococcus_phage	54.0	6.6e-68
AWN84899.1|2548298_2548520_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
AWN84900.1|2548523_2549021_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	45.2	7.7e-36
AWN84901.1|2549082_2549475_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.6	6.5e-46
AWN84902.1|2549458_2551924_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.7	0.0e+00
AWN84903.1|2551910_2554004_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	51.0	3.0e-145
AWN84904.1|2554000_2554996_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	60.0	2.1e-109
AWN84905.1|2555005_2555539_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84906.1|2555535_2556459_+	conjugal transfer protein	NA	A0A2K5B2A4	Erysipelothrix_phage	39.7	6.3e-07
AWN84907.1|2556630_2557629_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.0	5.3e-52
AWN84908.1|2558173_2558960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN84909.1|2559091_2559316_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84910.1|2559406_2562352_-	phage infection protein	NA	NA	NA	NA	NA
AWN84911.1|2562359_2562929_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWN84912.1|2563285_2563609_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWN84913.1|2563648_2564435_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN84914.1|2564534_2564696_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84915.1|2564986_2565895_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AWN84916.1|2566319_2566862_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN84917.1|2566819_2566948_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84918.1|2568185_2569865_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
AWN84919.1|2569956_2570340_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AWN84920.1|2570374_2571196_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
2570501:2570515	attL	GCCGAAATGATCGAC	NA	NA	NA	NA
AWN84921.1|2571205_2572630_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.4e-69
AWN84922.1|2572676_2573870_+	MFS transporter	NA	NA	NA	NA	NA
AWN84923.1|2575518_2576202_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.3	1.1e-59
AWN84924.1|2576282_2577203_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	4.0e-22
AWN84925.1|2577566_2578250_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.4	3.1e-59
AWN84926.1|2578347_2578596_+	hypothetical protein	NA	C1KFC0	Lactobacillus_virus	91.5	3.2e-35
AWN84927.1|2580098_2580296_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84928.1|2580270_2580624_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AWN84929.1|2580724_2582227_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AWN84930.1|2583356_2583938_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
AWN84931.1|2584303_2585011_-	aquaporin	NA	M1I8Y5	Paramecium_bursaria_Chlorella_virus	34.1	3.0e-25
AWN84932.1|2585025_2586879_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AWN84933.1|2586943_2588461_-	glycerol kinase	NA	NA	NA	NA	NA
AWN84934.1|2588666_2589368_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWN84935.1|2590045_2590297_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
AWN84936.1|2590350_2591193_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	6.1e-158
AWN84937.1|2591233_2591503_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84938.1|2593184_2593649_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84939.1|2593666_2595676_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84940.1|2595842_2596628_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84941.1|2596573_2597503_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AWN84942.1|2597597_2598263_-	hypothetical protein	NA	A0A2H4UTW8	Bodo_saltans_virus	25.0	9.1e-08
AWN84943.1|2598259_2601508_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84944.1|2601619_2602018_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84945.1|2602108_2604055_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84946.1|2604192_2605122_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
AWN84947.1|2605087_2605684_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84948.1|2605700_2605967_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84949.1|2606912_2607929_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
AWN84950.1|2610338_2610683_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84951.1|2610781_2612197_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWN84952.1|2612168_2612774_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84953.1|2612985_2613849_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	3.1e-24
AWN84954.1|2613845_2614142_-|transposase	transposase	transposase	NA	NA	NA	NA
AWN84955.1|2614154_2614460_-	hypothetical protein	NA	NA	NA	NA	NA
AWN84956.1|2615366_2616383_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
AWN84957.1|2617721_2618405_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	52.9	3.6e-60
AWN84958.1|2618732_2619131_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AWN84959.1|2619151_2619409_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWN85322.1|2619758_2620031_+	DNA-binding protein	NA	NA	NA	NA	NA
AWN84960.1|2620082_2621345_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2624278:2624292	attR	GCCGAAATGATCGAC	NA	NA	NA	NA
>prophage 14
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2656149	2720296	2927257	protease,tRNA,holin,transposase	Acinetobacter_phage(16.67%)	56	NA	NA
AWN84991.1|2656149_2657312_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
AWN84992.1|2657951_2659934_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.1	1.5e-93
AWN84993.1|2660012_2660891_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWN85327.1|2661099_2661912_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AWN84994.1|2661904_2662384_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWN84995.1|2662528_2663434_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWN84996.1|2663461_2664070_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AWN84997.1|2664161_2664854_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AWN84998.1|2665137_2665284_+	hypothetical protein	NA	NA	NA	NA	NA
AWN84999.1|2665280_2666207_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85000.1|2666418_2667581_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	1.9e-29
AWN85001.1|2667794_2668778_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
AWN85002.1|2668995_2669937_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWN85003.1|2669933_2672096_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AWN85004.1|2672092_2673622_-	exopolyphosphatase	NA	NA	NA	NA	NA
AWN85005.1|2673594_2673774_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85006.1|2674008_2674941_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	24.3	8.9e-09
AWN85007.1|2675107_2675932_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWN85008.1|2675954_2676455_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWN85009.1|2676742_2678098_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AWN85010.1|2678312_2679173_-	methanol dehydrogenase beta-propeller domain-containing protein	NA	NA	NA	NA	NA
AWN85011.1|2679181_2679790_-	LemA family protein	NA	NA	NA	NA	NA
AWN85012.1|2679975_2680992_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AWN85013.1|2683655_2684981_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWN85014.1|2684986_2685946_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.9	8.8e-28
AWN85015.1|2685945_2687478_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AWN85328.1|2687680_2687878_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85016.1|2688001_2689018_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	8.4e-37
AWN85017.1|2689327_2691616_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AWN85018.1|2691750_2692584_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN85019.1|2692608_2693580_-	tellurium resistance protein	NA	NA	NA	NA	NA
AWN85020.1|2694015_2694660_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWN85021.1|2695183_2695858_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.5	3.3e-13
AWN85022.1|2695985_2696402_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWN85023.1|2696614_2699143_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.1	8.3e-110
AWN85024.1|2699206_2700211_-	aldo/keto reductase	NA	NA	NA	NA	NA
AWN85025.1|2700512_2701325_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWN85026.1|2701387_2701732_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85027.1|2702039_2702303_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AWN85028.1|2702386_2702593_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85029.1|2702591_2703269_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AWN85030.1|2703274_2703961_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
AWN85031.1|2704005_2704818_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AWN85032.1|2704914_2705397_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	1.8e-21
AWN85033.1|2705402_2706305_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWN85034.1|2706554_2707757_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.9	5.6e-24
AWN85035.1|2708061_2709255_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.8	1.9e-104
AWN85036.1|2709655_2710354_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AWN85037.1|2710512_2710986_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85038.1|2711180_2711519_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85039.1|2711567_2713550_-	PTS fructose transporter subunit IIABC	NA	NA	NA	NA	NA
AWN85040.1|2713553_2714483_-	1-phosphofructokinase	NA	NA	NA	NA	NA
AWN85041.1|2714608_2715361_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWN85329.1|2718298_2718490_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85042.1|2718742_2719945_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.3	4.2e-88
AWN85043.1|2720182_2720296_-|holin	holin	holin	NA	NA	NA	NA
>prophage 15
CP029546	Lactobacillus paracasei strain EG9 chromosome, complete genome	2927257	2858804	2873412	2927257	portal,terminase,integrase,transposase,capsid	Lactobacillus_phage(25.0%)	19	2861148:2861167	2875257:2875276
AWN85167.1|2858804_2859725_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
AWN85168.1|2859873_2860095_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85333.1|2860779_2860977_-	hypothetical protein	NA	NA	NA	NA	NA
2861148:2861167	attL	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
AWN85169.1|2861264_2862422_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	33.2	1.3e-46
AWN85170.1|2862515_2863169_-	transcriptional regulator	NA	NA	NA	NA	NA
AWN85171.1|2863297_2863576_+	DNA-binding protein	NA	NA	NA	NA	NA
AWN85172.1|2863663_2863885_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85173.1|2863995_2864187_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85174.1|2864231_2864507_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85175.1|2864503_2864692_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85176.1|2864675_2865503_+	DNA replication protein	NA	Q854C1	Mycobacterium_phage	32.5	3.4e-12
AWN85177.1|2865495_2866887_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	33.1	5.3e-42
AWN85178.1|2867438_2867780_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85179.1|2867811_2868180_+	endonuclease	NA	D2JLE2	Staphylococcus_phage	42.9	3.6e-14
AWN85180.1|2868361_2868832_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AWN85181.1|2868828_2870532_+|terminase	terminase	terminase	E9LUI0	Lactobacillus_phage	40.0	6.6e-119
AWN85182.1|2870497_2870677_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85183.1|2870681_2871866_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	34.4	5.3e-59
AWN85184.1|2871852_2873412_+|capsid	phage major capsid protein	capsid	A0A2H4J9X8	uncultured_Caudovirales_phage	29.8	3.3e-32
2875257:2875276	attR	TATTCTGGGTGGTCAGGGGA	NA	NA	NA	NA
>prophage 1
CP029547	Lactobacillus paracasei strain EG9 plasmid pEG9A, complete sequence	79815	4568	54937	79815	bacteriocin,transposase	Lactobacillus_phage(36.36%)	54	NA	NA
AWN85343.1|4568_5813_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	4.9e-47
AWN85344.1|6012_6267_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85345.1|6341_6530_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85346.1|6542_6701_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85347.1|6789_7188_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85348.1|7199_7466_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85349.1|7484_7661_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85350.1|7662_7890_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85351.1|7932_9174_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85352.1|9151_10711_+	pullulanase	NA	NA	NA	NA	NA
AWN85353.1|10720_11140_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWN85354.1|11148_11727_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85355.1|11753_14213_+	type IV secretion system protein VirD4	NA	NA	NA	NA	NA
AWN85356.1|14209_16273_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85357.1|16278_16614_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85358.1|16597_17194_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85359.1|17174_19103_+	type IV secretion system protein VirB4	NA	NA	NA	NA	NA
AWN85360.1|19104_20115_+	hydrolase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	39.1	9.0e-15
AWN85361.1|20130_20775_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85362.1|20771_21179_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AWN85363.1|21168_21990_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85420.1|22362_22563_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85364.1|22584_22785_+	plasmid replication protein	NA	NA	NA	NA	NA
AWN85365.1|22781_23039_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85366.1|23077_23515_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85367.1|23507_24752_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85368.1|24787_25039_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85369.1|25025_27569_+	LtrC-like protein	NA	NA	NA	NA	NA
AWN85370.1|27909_28014_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85371.1|28281_29712_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AWN85372.1|29951_30206_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85373.1|30344_30794_-	nitroreductase	NA	NA	NA	NA	NA
AWN85374.1|31108_31555_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85375.1|32040_33240_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.8	1.6e-66
AWN85376.1|33699_34581_+	endonuclease	NA	NA	NA	NA	NA
AWN85377.1|34597_34957_+	transcriptional regulator	NA	NA	NA	NA	NA
AWN85378.1|35035_35707_+	class A sortase	NA	NA	NA	NA	NA
AWN85379.1|35841_36039_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85380.1|36040_37066_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.1	1.3e-42
AWN85421.1|45299_46124_+	hypothetical protein	NA	NA	NA	NA	NA
AWN85381.1|46737_46989_+	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	95.2	7.8e-37
AWN85382.1|47042_47885_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.1e-156
AWN85422.1|47886_47997_-	benzoate transporter	NA	NA	NA	NA	NA
AWN85383.1|48063_48327_+	hypothetical protein	NA	Q6J1X3	Lactobacillus_phage	88.0	2.6e-30
AWN85384.1|48521_49223_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.3	2.7e-127
AWN85385.1|49263_49479_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85386.1|49665_50064_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AWN85387.1|50176_50548_-	hypothetical protein	NA	NA	NA	NA	NA
AWN85388.1|50751_51672_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	3.4e-37
AWN85389.1|51661_51961_-	cytosolic protein	NA	NA	NA	NA	NA
AWN85390.1|51966_52617_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
AWN85391.1|53460_53667_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AWN85392.1|53666_53978_+	Gar-IM	NA	NA	NA	NA	NA
AWN85393.1|54253_54937_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
