The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029553	Methylobacterium sp. 17Sr1-28 chromosome, complete genome	6162702	3068467	3076979	6162702		Acinetobacter_phage(50.0%)	8	NA	NA
AWN47317.1|3068467_3069361_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	32.8	2.0e-10
AWN47318.1|3069365_3070214_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.0	3.9e-56
AWN47319.1|3070273_3071287_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.1	8.9e-55
AWN47320.1|3071332_3071968_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	52.8	2.3e-53
AWN47321.1|3072134_3072617_-	peroxiredoxin	NA	A0A1D7SMT0	Cyanophage	46.8	6.8e-21
AWN50051.1|3072997_3073543_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AWN47322.1|3073583_3074585_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47323.1|3075056_3076979_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.9	6.7e-152
>prophage 2
CP029553	Methylobacterium sp. 17Sr1-28 chromosome, complete genome	6162702	3450873	3505185	6162702	integrase,protease,transposase,head,portal,capsid,terminase	Burkholderia_virus(30.0%)	48	3493190:3493234	3510808:3510852
AWN47598.1|3450873_3451869_+|protease	serine protease	protease	NA	NA	NA	NA
AWN47599.1|3451979_3452822_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
AWN47600.1|3452851_3453799_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47601.1|3453818_3454772_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47602.1|3454784_3455072_+	hypothetical protein	NA	NA	NA	NA	NA
AWN50084.1|3455116_3455380_+	hypothetical protein	NA	NA	NA	NA	NA
AWN50085.1|3455666_3456938_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47603.1|3456951_3457530_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47604.1|3457729_3458779_-	serine endopeptidase	NA	NA	NA	NA	NA
AWN47605.1|3458784_3459264_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47606.1|3459287_3459680_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47607.1|3459935_3461873_-	hypothetical protein	NA	C6ZR20	Salmonella_phage	28.6	8.2e-41
AWN47608.1|3462423_3463761_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47609.1|3464203_3464515_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47610.1|3464759_3465761_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47611.1|3465762_3466932_-	group 1 glycosyl transferase	NA	NA	NA	NA	NA
AWN47612.1|3467747_3468134_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47613.1|3469005_3471774_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47614.1|3471855_3473577_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.6	8.7e-18
AWN47615.1|3473576_3474890_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWN47616.1|3475328_3475535_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47617.1|3476324_3476906_+	resolvase	NA	A0A0C4UR34	Shigella_phage	52.5	1.2e-43
AWN47618.1|3477125_3477605_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47619.1|3477657_3478116_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWN47620.1|3478968_3480252_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
AWN47621.1|3480565_3481474_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47622.1|3482498_3485984_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47623.1|3486194_3486689_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47624.1|3486690_3487086_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47625.1|3487740_3488892_-	hypothetical protein	NA	NA	NA	NA	NA
AWN47626.1|3488888_3489974_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AWN47627.1|3489984_3492348_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AWN47628.1|3492725_3492950_-	hypothetical protein	NA	NA	NA	NA	NA
3493190:3493234	attL	TGGTAGCGGAGGAGGGATTTGAACCCCCGACACAAGGATTATGAT	NA	NA	NA	NA
AWN47629.1|3493296_3494442_-|integrase	site-specific integrase	integrase	Q9ZWV7	Corynephage	25.5	1.9e-13
AWN47630.1|3495235_3495481_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47631.1|3495477_3495729_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47632.1|3496325_3496535_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47633.1|3497110_3497329_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47634.1|3497634_3497832_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47635.1|3497828_3498173_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47636.1|3498172_3498481_+	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	45.4	3.6e-15
AWN47637.1|3498616_3498997_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47638.1|3499009_3500680_+|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	37.9	7.5e-75
AWN47639.1|3500667_3501918_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	38.3	1.1e-73
AWN47640.1|3501914_3502616_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	57.6	5.8e-53
AWN47641.1|3502626_3503913_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	45.5	2.6e-83
AWN47642.1|3504235_3504856_+	hypothetical protein	NA	NA	NA	NA	NA
AWN47643.1|3504852_3505185_+	hypothetical protein	NA	A0A286S2A2	Klebsiella_phage	32.2	1.2e-05
3510808:3510852	attR	TGGTAGCGGAGGAGGGATTTGAACCCCCGACACAAGGATTATGAT	NA	NA	NA	NA
