The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	876508	883647	4685200		Escherichia_phage(83.33%)	6	NA	NA
AZR17520.1|876508_877147_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AZR17521.1|877238_878405_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AZR17522.1|878401_879310_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AZR17523.1|879505_880273_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AZR17524.1|880323_880980_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AZR17525.1|881085_883647_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	1265356	1276566	4685200	integrase,tail	Enterobacteria_phage(50.0%)	17	1261666:1261682	1278576:1278592
1261666:1261682	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
AZR17866.1|1265356_1265557_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AZR17867.1|1265688_1265994_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AZR17868.1|1265993_1266356_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AZR17869.1|1266346_1266883_-	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AZR17870.1|1267010_1267835_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AZR17871.1|1267900_1268263_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AZR17872.1|1268620_1268989_+	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
AZR17873.1|1268985_1269480_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AZR17874.1|1269479_1269755_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AZR20913.1|1269804_1270323_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AZR17875.1|1270349_1270790_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AZR17876.1|1271088_1271370_+	hypothetical protein	NA	NA	NA	NA	NA
AZR17877.1|1271404_1272736_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AZR17878.1|1272732_1273653_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
AZR17879.1|1273649_1274012_-	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AZR20914.1|1274164_1275322_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AZR17880.1|1275633_1276566_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1278576:1278592	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	1524459	1533900	4685200		Enterobacteria_phage(85.71%)	10	NA	NA
AZR18090.1|1524459_1525386_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AZR18091.1|1525390_1526122_+	ABC transporter permease	NA	NA	NA	NA	NA
AZR18092.1|1526102_1526210_-	protein YohO	NA	NA	NA	NA	NA
AZR18093.1|1526269_1527001_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AZR18094.1|1527222_1528908_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZR18095.1|1528904_1529624_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AZR18096.1|1529670_1530141_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AZR18097.1|1530180_1530642_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AZR18098.1|1530922_1532767_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AZR18099.1|1532763_1533900_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	1627306	1637315	4685200	transposase	Enterobacteria_phage(25.0%)	9	NA	NA
AZR18170.1|1627306_1628701_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
AZR18171.1|1628875_1629769_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AZR18172.1|1630141_1631227_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AZR18173.1|1631226_1632126_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
AZR18174.1|1632183_1633065_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AZR18175.1|1633064_1633622_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AZR18176.1|1633618_1633771_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18177.1|1633840_1635049_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AZR18178.1|1636211_1637315_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 5
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	2072321	2115650	4685200	integrase,tail,terminase,holin,protease	Enterobacteria_phage(33.33%)	61	2079897:2079912	2106045:2106060
AZR18585.1|2072321_2073143_-|protease	serine protease	protease	NA	NA	NA	NA
AZR20944.1|2073242_2073326_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18586.1|2073418_2073754_-	acid shock protein	NA	NA	NA	NA	NA
AZR18587.1|2074150_2075404_-	MFS transporter	NA	NA	NA	NA	NA
AZR18588.1|2075510_2076404_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZR18589.1|2076538_2077759_+	protein mlc	NA	NA	NA	NA	NA
AZR18590.1|2077883_2078579_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AZR18591.1|2078531_2079824_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2079897:2079912	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AZR18592.1|2079982_2080597_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AZR18593.1|2080639_2081494_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AZR18594.1|2081495_2082113_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AZR20945.1|2082123_2084547_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AZR18595.1|2084607_2087034_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AZR20946.1|2087232_2087538_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AZR18596.1|2087645_2088356_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AZR18597.1|2088358_2088919_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AZR18598.1|2088953_2089295_-	DUF1283 family protein	NA	NA	NA	NA	NA
AZR18599.1|2089429_2089756_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AZR18600.1|2089961_2091176_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AZR18601.1|2091187_2092207_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AZR18602.1|2092264_2092375_+	transporter	NA	NA	NA	NA	NA
AZR18603.1|2092394_2093591_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.2	7.9e-135
AZR18604.1|2095117_2095309_-	DUF1482 family protein	NA	NA	NA	NA	NA
AZR18605.1|2095305_2095494_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AZR20947.1|2095893_2096058_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18606.1|2096061_2096280_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18607.1|2096439_2096595_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AZR18608.1|2096761_2097169_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AZR18609.1|2097252_2097483_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR18610.1|2097779_2097929_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18611.1|2098365_2098698_-	protein FlxA	NA	NA	NA	NA	NA
AZR18612.1|2098900_2099206_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18613.1|2099230_2099470_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AZR18614.1|2099469_2099757_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AZR18615.1|2099828_2099984_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AZR18616.1|2100200_2100452_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18617.1|2100518_2100797_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18618.1|2100798_2101848_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AZR18619.1|2101861_2102614_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AZR18620.1|2102891_2102981_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18621.1|2103035_2103248_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AZR18622.1|2103548_2103764_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AZR18623.1|2104517_2104733_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AZR18624.1|2104737_2105049_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AZR18625.1|2105045_2105579_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AZR18626.1|2105575_2106073_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2106045:2106060	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
AZR18627.1|2106435_2106648_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AZR20948.1|2106658_2106847_+	cold-shock protein	NA	NA	NA	NA	NA
AZR20949.1|2106849_2106915_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18628.1|2106993_2107149_+	hypothetical protein	NA	NA	NA	NA	NA
AZR20950.1|2107320_2107494_+	protein GnsB	NA	NA	NA	NA	NA
AZR18629.1|2107645_2108056_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AZR18630.1|2108113_2108347_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AZR18631.1|2108735_2109305_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.7e-92
AZR18632.1|2109255_2110218_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AZR18633.1|2110217_2110793_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AZR18634.1|2110890_2111481_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AZR18635.1|2111797_2112031_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AZR18636.1|2112099_2112213_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AZR18637.1|2112817_2114101_+	MFS transporter	NA	NA	NA	NA	NA
AZR18638.1|2114189_2115650_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 6
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	2309547	2339878	4685200	tRNA,transposase,tail	Escherichia_phage(43.33%)	36	NA	NA
AZR18793.1|2309547_2310681_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
AZR18794.1|2310821_2311256_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AZR18795.1|2312034_2312148_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AZR18796.1|2312216_2312450_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AZR18797.1|2312766_2313357_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AZR18798.1|2313454_2314030_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AZR18799.1|2314029_2317392_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AZR20957.1|2317456_2317672_-	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AZR18800.1|2317714_2318695_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AZR18801.1|2320152_2320353_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18802.1|2320460_2320820_-	hypothetical protein	NA	NA	NA	NA	NA
AZR18803.1|2320800_2321064_-	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AZR20958.1|2321201_2322659_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AZR18804.1|2322855_2323041_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AZR18805.1|2323128_2323689_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
AZR18806.1|2323711_2324458_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AZR18807.1|2324464_2325322_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AZR18808.1|2325334_2325757_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AZR18809.1|2325779_2326076_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AZR18810.1|2326199_2326676_+	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AZR18811.1|2326984_2327119_+	hypothetical protein	NA	NA	NA	NA	NA
AZR18812.1|2327129_2327285_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AZR20959.1|2327281_2327770_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AZR18813.1|2328211_2328433_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AZR18814.1|2328432_2328603_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AZR18815.1|2328677_2328953_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AZR18816.1|2329054_2331655_+	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AZR18817.1|2331647_2332457_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AZR18818.1|2332513_2332708_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AZR18819.1|2332700_2332910_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AZR18820.1|2332988_2333204_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AZR18821.1|2333205_2334441_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AZR18822.1|2334492_2335428_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AZR18823.1|2335556_2336930_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AZR18824.1|2337407_2338391_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AZR18825.1|2338645_2339878_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 7
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	2532520	2546901	4685200	portal,integrase,plate,tail	Shigella_phage(33.33%)	24	2529896:2529909	2547927:2547940
2529896:2529909	attL	AAAATAAGATGAAT	NA	NA	NA	NA
AZR19000.1|2532520_2533252_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AZR19001.1|2533472_2533877_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AZR19002.1|2533929_2534040_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19003.1|2534576_2534900_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AZR19004.1|2535002_2535167_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AZR19005.1|2535400_2536234_-	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AZR19006.1|2536340_2536895_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
AZR20969.1|2537303_2537717_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
AZR19007.1|2537688_2538291_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
AZR19008.1|2538290_2539079_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
AZR19009.1|2539082_2539667_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	2.0e-112
AZR19010.1|2539657_2540449_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
AZR19011.1|2540375_2540849_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
AZR19012.1|2540848_2541031_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AZR19013.1|2541042_2542410_-	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
AZR19014.1|2542399_2542579_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AZR19015.1|2542754_2543312_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
AZR19016.1|2543355_2543556_-	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AZR19017.1|2543646_2544321_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AZR19018.1|2544495_2544804_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
AZR19019.1|2544741_2545083_-	hypothetical protein	NA	NA	NA	NA	NA
AZR19020.1|2545199_2545511_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19021.1|2545547_2545793_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AZR19022.1|2545773_2546901_+|integrase	integrase	integrase	O21925	Phage_21	61.5	7.2e-122
2547927:2547940	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 8
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	2938660	2989005	4685200	integrase,capsid,tail,portal,terminase,holin,head,protease	Enterobacteria_phage(75.36%)	70	2965913:2965928	2990713:2990728
AZR19377.1|2938660_2939950_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
AZR19378.1|2940008_2940485_+	kinase inhibitor	NA	NA	NA	NA	NA
AZR19379.1|2941340_2942918_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
AZR19380.1|2942914_2943805_+	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
AZR19381.1|2944395_2945628_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
AZR19382.1|2945756_2946341_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
AZR19383.1|2946340_2948665_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
AZR19384.1|2948729_2949350_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
AZR19385.1|2949411_2952810_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
AZR19386.1|2952870_2953503_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
AZR19387.1|2953439_2954183_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AZR19388.1|2954188_2954887_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AZR19389.1|2954886_2955216_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AZR19390.1|2955212_2957774_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
AZR19391.1|2957766_2958201_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZR19392.1|2958182_2958605_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AZR19393.1|2958620_2959361_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AZR19394.1|2959368_2959764_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AZR19395.1|2959760_2960339_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AZR19396.1|2960350_2960704_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AZR19397.1|2960715_2961114_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
AZR19398.1|2961155_2962181_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
AZR19399.1|2962236_2962569_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
AZR19400.1|2962578_2963898_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
AZR19401.1|2963878_2965480_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
AZR19402.1|2965476_2965683_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZR19403.1|2965679_2967605_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
2965913:2965928	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
AZR19404.1|2967579_2968125_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AZR19405.1|2968513_2968708_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AZR19406.1|2968872_2969079_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AZR19407.1|2969364_2969775_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
AZR19408.1|2970064_2970358_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
AZR19409.1|2970448_2970631_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
AZR19410.1|2970847_2971324_-	lysozyme	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
AZR19411.1|2971307_2971631_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
AZR19412.1|2972001_2972196_-	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
AZR19413.1|2972307_2972931_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
AZR19414.1|2972927_2973593_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
AZR19415.1|2973570_2973777_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AZR20979.1|2973773_2974385_-	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
AZR19416.1|2974377_2974548_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
AZR19417.1|2974544_2974727_-	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
AZR19418.1|2974693_2974867_-	protein ninD	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
AZR19419.1|2974863_2975736_-	hypothetical protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
AZR19420.1|2975732_2976173_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
AZR19421.1|2976246_2976537_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
AZR19422.1|2976533_2977235_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
AZR19423.1|2977231_2978131_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AZR19424.1|2978163_2978457_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AZR19425.1|2978575_2978776_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AZR19426.1|2978876_2979590_+	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
AZR19427.1|2979702_2980542_+	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
AZR19428.1|2980557_2980992_+	biopolymer transporter ExbB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
AZR20980.1|2981456_2981780_+	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
AZR19429.1|2981780_2982263_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
AZR19430.1|2982529_2982730_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AZR19431.1|2982912_2983281_+	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AZR19432.1|2983353_2983518_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
AZR19433.1|2983486_2983630_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
AZR19434.1|2983704_2984001_+	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
AZR19435.1|2984006_2984792_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
AZR19436.1|2984788_2985469_+	exonuclease	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
AZR19437.1|2985465_2985648_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
AZR19438.1|2985620_2985812_+	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
AZR19439.1|2986203_2986425_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AZR19440.1|2986421_2986970_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
AZR19441.1|2987161_2987443_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
AZR19442.1|2987531_2987699_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AZR19443.1|2987738_2987957_+	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
AZR19444.1|2987934_2989005_+|integrase	integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
2990713:2990728	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 9
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	3187243	3231606	4685200	integrase,capsid,transposase,terminase,holin,protease	Enterobacteria_phage(56.0%)	49	3210318:3210364	3231620:3231666
AZR20987.1|3187243_3188356_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AZR19608.1|3188432_3188585_-	protein HokE	NA	NA	NA	NA	NA
AZR19609.1|3189037_3190156_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AZR19610.1|3190221_3190470_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
AZR19611.1|3190534_3190903_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AZR19612.1|3190996_3191650_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AZR19613.1|3191757_3193005_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AZR19614.1|3193085_3194462_-	phenylalanine-specific permease	NA	NA	NA	NA	NA
AZR19615.1|3194563_3197707_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
AZR19616.1|3197718_3198942_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
AZR19617.1|3198957_3199290_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
AZR19618.1|3199447_3200821_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AZR19619.1|3200977_3201661_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AZR19620.1|3201650_3203093_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
AZR19621.1|3203242_3205480_+	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AZR19622.1|3205466_3208439_+	phage receptor	NA	NA	NA	NA	NA
AZR19623.1|3208439_3209330_+	DUF4434 family protein	NA	NA	NA	NA	NA
AZR19624.1|3209512_3210274_+	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
3210318:3210364	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AZR19625.1|3210787_3211741_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AZR19626.1|3211990_3212740_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR20988.1|3213642_3214269_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZR19627.1|3214213_3214351_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZR19628.1|3214323_3215067_-|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
AZR19629.1|3215041_3215587_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AZR19630.1|3215975_3216170_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AZR19631.1|3216334_3216541_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AZR19632.1|3216826_3217237_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AZR19633.1|3217527_3217821_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AZR19634.1|3217911_3218094_-	Spanin from lambdoid prophage DLP12, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
AZR19635.1|3218310_3218808_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AZR19636.1|3218807_3219023_-|holin	holin	holin	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AZR19637.1|3219595_3220663_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AZR19638.1|3220667_3221684_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AZR19639.1|3222081_3222465_-	antitermination protein	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AZR19640.1|3222550_3222691_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AZR19641.1|3222687_3223050_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AZR19642.1|3223046_3223337_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AZR19643.1|3223329_3223500_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AZR19644.1|3223499_3223955_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AZR19645.1|3223951_3224053_-	hypothetical protein	NA	NA	NA	NA	NA
AZR19646.1|3224169_3224967_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZR19647.1|3224976_3225528_-	kinase inhibitor	NA	NA	NA	NA	NA
AZR19648.1|3225992_3227519_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AZR19649.1|3227576_3227726_-	hypothetical protein	NA	NA	NA	NA	NA
AZR19650.1|3227773_3228106_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AZR19651.1|3228416_3229579_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AZR19652.1|3229641_3229737_-	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AZR19653.1|3230059_3230323_+	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AZR19654.1|3230442_3231606_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3231620:3231666	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 10
CP034595	Escherichia coli strain WCHEC035053S1G0 chromosome, complete genome	4685200	3464924	3517735	4685200	holin,transposase	Acinetobacter_phage(25.0%)	48	NA	NA
AZR19860.1|3464924_3466958_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AZR19861.1|3467086_3467674_+	transcriptional regulator	NA	NA	NA	NA	NA
AZR19862.1|3467687_3469160_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZR19863.1|3469173_3470844_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AZR19864.1|3471056_3471725_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19865.1|3471967_3472663_-	lactate utilization protein C	NA	NA	NA	NA	NA
AZR19866.1|3472655_3474083_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AZR19867.1|3474093_3474813_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AZR19868.1|3475339_3476194_-	transcriptional regulator	NA	NA	NA	NA	NA
AZR19869.1|3476419_3477745_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AZR19870.1|3477853_3478090_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZR19871.1|3478101_3478695_+	protein RclC	NA	NA	NA	NA	NA
AZR19872.1|3479967_3481130_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AZR19873.1|3481176_3482064_-	attaching and effacing-like protein	NA	NA	NA	NA	NA
AZR19874.1|3483178_3483280_+	hypothetical protein	NA	NA	NA	NA	NA
AZR20995.1|3483643_3483907_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AZR19875.1|3483906_3484047_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AZR19876.1|3484081_3484309_-	hypothetical protein	NA	NA	NA	NA	NA
AZR20996.1|3485132_3485675_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZR19877.1|3485749_3486337_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AZR19878.1|3486394_3487063_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AZR19879.1|3487088_3489614_+	usher protein EcpC	NA	NA	NA	NA	NA
AZR19880.1|3489603_3491247_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AZR19881.1|3491215_3491926_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
AZR19882.1|3492238_3492568_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AZR19883.1|3493024_3494233_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AZR19884.1|3494201_3494768_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AZR19885.1|3495185_3495875_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AZR19886.1|3495871_3496828_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AZR19887.1|3496824_3499023_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AZR19888.1|3499032_3499989_+	XdhC family protein	NA	NA	NA	NA	NA
AZR19889.1|3499967_3500378_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19890.1|3500662_3502063_+	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
AZR19891.1|3502179_3502620_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19892.1|3502616_3502841_+	DNA-binding protein	NA	NA	NA	NA	NA
AZR19893.1|3502959_3503814_+	hypothetical protein	NA	NA	NA	NA	NA
AZR19894.1|3503840_3504539_+	recombinase family protein	NA	NA	NA	NA	NA
AZR19895.1|3504810_3505437_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZR19896.1|3505527_3506259_-	hypothetical protein	NA	NA	NA	NA	NA
AZR19897.1|3507453_3508458_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AZR19898.1|3508596_3509355_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AZR19899.1|3509359_3510970_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
AZR19900.1|3510981_3512364_-	MFS transporter	NA	NA	NA	NA	NA
AZR19901.1|3512590_3514558_-	YjhG/YagF family D-xylonate dehydratase	NA	NA	NA	NA	NA
AZR19902.1|3514572_3515481_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AZR19903.1|3515775_3516930_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
AZR19904.1|3517023_3517374_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AZR19905.1|3517396_3517735_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
