The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029481	Microvirga sp. 17 mud 1-3 chromosome, complete genome	4403107	2444391	2507336	4403107	plate,terminase,portal,tRNA,capsid,tail,integrase	Pseudomonas_phage(42.55%)	72	2453007:2453024	2512342:2512359
AWM87320.1|2444391_2445105_+|tRNA	Ala-tRNA(Pro) hydrolase	tRNA	NA	NA	NA	NA
AWM87321.1|2445135_2445990_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
AWM87322.1|2446139_2446925_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.8e-31
AWM87323.1|2446929_2448249_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWM87324.1|2448258_2449461_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWM87325.1|2449593_2450616_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	5.1e-74
AWM87326.1|2450840_2452037_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
AWM87327.1|2452070_2452451_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87328.1|2452450_2453182_-	dolichol-phosphate mannosyltransferase	NA	V9QJB1	Oenococcus_phage	22.0	1.5e-08
2453007:2453024	attL	TTCAGGACCACGTCCGCC	NA	NA	NA	NA
AWM87329.1|2453224_2454934_-	glycosyl transferase	NA	NA	NA	NA	NA
AWM87330.1|2455106_2456894_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
AWM87331.1|2456921_2458280_+	cation transporter	NA	NA	NA	NA	NA
AWM87332.1|2458422_2459415_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
AWM87333.1|2459458_2459947_+|tRNA	cys-tRNA(pro)/cys-tRNA(cys) deacylase	tRNA	NA	NA	NA	NA
AWM87334.1|2460161_2460590_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87335.1|2460727_2460958_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87336.1|2461338_2462574_+	hypothetical protein	NA	V5YSU2	Pseudomonas_phage	52.7	1.1e-102
AWM87337.1|2462698_2463121_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	34.5	2.0e-08
AWM87338.1|2463175_2463394_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87339.1|2463386_2463752_-	hypothetical protein	NA	A0A1W6JT30	Escherichia_phage	63.0	1.4e-21
AWM87340.1|2463754_2463982_-	hypothetical protein	NA	V5YSU5	Pseudomonas_phage	64.4	2.5e-18
AWM87341.1|2463997_2464990_-	hypothetical protein	NA	V5YUP8	Pseudomonas_phage	59.2	7.0e-105
AWM87342.1|2465005_2466211_-	hypothetical protein	NA	V5YTC9	Pseudomonas_phage	51.2	2.2e-105
AWM87343.1|2466315_2466717_-	hypothetical protein	NA	V5YTJ2	Pseudomonas_phage	46.4	2.7e-15
AWM87344.1|2466782_2468213_+	hypothetical protein	NA	A0A193GYQ8	Enterobacter_phage	57.7	6.3e-155
AWM87345.1|2468602_2469136_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87346.1|2469123_2469360_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87347.1|2469528_2469855_+	hypothetical protein	NA	Q546W6	Burkholderia_phage	56.8	2.2e-23
AWM87348.1|2469851_2470850_+	hypothetical protein	NA	V5YTD4	Pseudomonas_phage	50.9	8.2e-69
AWM87349.1|2470846_2471140_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87350.1|2471136_2471532_+	VRR-NUC domain-containing protein	NA	V5YTP9	Pseudomonas_phage	58.0	2.0e-31
AWM89117.1|2471567_2472017_+	dUTP diphosphatase	NA	A0A2H4GY78	Pseudomonas_phage	61.2	1.3e-45
AWM87351.1|2472018_2472489_+	hypothetical protein	NA	V5YSV3	Pseudomonas_phage	47.3	2.6e-09
AWM87352.1|2472485_2472824_+	hypothetical protein	NA	V5YTD7	Pseudomonas_phage	45.9	4.8e-13
AWM89118.1|2472934_2474386_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	49.9	3.4e-116
AWM87353.1|2474388_2474568_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87354.1|2474564_2474822_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87355.1|2474802_2477082_+|integrase	integrase	integrase	A0A088FVF8	Escherichia_phage	47.9	3.5e-160
AWM87356.1|2477179_2477392_+	hypothetical protein	NA	A0A193GYF6	Enterobacter_phage	53.0	6.0e-14
AWM87357.1|2477429_2477618_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87358.1|2477837_2478407_+	hypothetical protein	NA	S4TSU4	Salmonella_phage	26.5	7.1e-09
AWM87359.1|2478406_2478676_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87360.1|2478740_2479877_+	hypothetical protein	NA	I6NVL3	Burkholderia_virus	81.2	3.2e-13
AWM87361.1|2479873_2480077_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87362.1|2480632_2480935_+	hypothetical protein	NA	V5YTF6	Pseudomonas_phage	51.0	1.9e-21
AWM89119.1|2480991_2481348_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	42.6	1.1e-20
AWM87363.1|2481347_2481851_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	56.2	7.3e-42
AWM89120.1|2481733_2482402_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87364.1|2482540_2483047_+	DNA-packaging protein	NA	A0A193GYK5	Enterobacter_phage	62.0	1.2e-47
AWM87365.1|2483039_2485103_+|terminase	terminase	terminase	V5YTA4	Pseudomonas_phage	70.3	2.6e-271
AWM87366.1|2485106_2485661_+	hypothetical protein	NA	V5YTG8	Pseudomonas_phage	55.8	7.5e-48
AWM87367.1|2485657_2487253_+|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	56.7	3.0e-166
AWM87368.1|2487249_2489223_+|capsid	phage major capsid protein	capsid	V5YSS9	Pseudomonas_phage	62.4	4.6e-233
AWM87369.1|2489307_2489601_+	hypothetical protein	NA	A0A088FQV7	Escherichia_phage	53.8	3.7e-14
AWM87370.1|2489600_2489942_+	hypothetical protein	NA	A0A088FQK9	Escherichia_phage	53.2	2.9e-26
AWM89121.1|2489950_2490487_+	hypothetical protein	NA	Q75QM4	Wolbachia_phage	29.0	3.9e-09
AWM87371.1|2490462_2491065_+	hypothetical protein	NA	A0A193GYB4	Enterobacter_phage	58.5	5.3e-55
AWM87372.1|2491061_2491697_+|plate	phage baseplate assembly protein V	plate	D5LGZ5	Escherichia_phage	49.1	1.2e-44
AWM89122.1|2491748_2492087_+|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	73.0	1.9e-41
AWM87373.1|2492086_2492992_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	72.4	1.1e-117
AWM87374.1|2492936_2493605_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	52.5	2.2e-57
AWM87375.1|2495302_2495626_+	hypothetical protein	NA	A0A088FQL9	Escherichia_phage	40.3	6.0e-13
AWM87376.1|2495760_2497194_+|tail	phage tail protein	tail	V5YTI0	Pseudomonas_phage	69.4	4.5e-177
AWM87377.1|2497206_2497713_+|tail	phage major tail tube protein	tail	V5YTN5	Pseudomonas_phage	70.8	1.2e-63
AWM87378.1|2497767_2498052_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	51.6	8.3e-19
AWM87379.1|2498192_2500469_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	51.3	4.9e-194
AWM87380.1|2500465_2500882_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	59.1	6.9e-38
AWM87381.1|2500865_2501078_+|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	63.8	1.3e-19
AWM89123.1|2501074_2502112_+|tail	phage tail protein	tail	A0A088FRU7	Escherichia_phage	60.9	4.7e-112
AWM87382.1|2502462_2504856_+	transketolase	NA	NA	NA	NA	NA
AWM87383.1|2505003_2506188_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	53.4	3.8e-105
AWM87384.1|2506253_2507336_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
2512342:2512359	attR	TTCAGGACCACGTCCGCC	NA	NA	NA	NA
>prophage 2
CP029481	Microvirga sp. 17 mud 1-3 chromosome, complete genome	4403107	2574967	2584744	4403107	tRNA	uncultured_Mediterranean_phage(66.67%)	11	NA	NA
AWM87440.1|2574967_2576251_-	peptidase M23	NA	Q8SBN9	Clostridium_phage	39.1	3.9e-15
AWM87441.1|2576367_2577078_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1J0MC37	Streptomyces_phage	37.3	1.4e-06
AWM87442.1|2577094_2577856_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
AWM87443.1|2577857_2579222_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	2.6e-94
AWM87444.1|2579322_2580123_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.2	2.5e-52
AWM87445.1|2580119_2580662_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWM87446.1|2580739_2580982_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	54.9	3.7e-07
AWM89131.1|2581037_2582138_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.1	7.7e-12
AWM87447.1|2582155_2582884_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	48.5	2.9e-39
AWM87448.1|2582885_2583686_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	39.4	3.6e-27
AWM87449.1|2583724_2584744_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	41.7	8.7e-26
>prophage 3
CP029481	Microvirga sp. 17 mud 1-3 chromosome, complete genome	4403107	2936810	2986492	4403107	protease,head,tail,tRNA	Acinetobacter_phage(25.0%)	44	NA	NA
AWM87723.1|2936810_2937521_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
AWM87724.1|2937504_2938356_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87725.1|2938636_2939413_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87726.1|2940207_2940516_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87727.1|2940737_2941742_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWM87728.1|2942362_2942845_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWM87729.1|2942871_2943468_-	urease accessory protein UreE	NA	NA	NA	NA	NA
AWM87730.1|2943526_2944012_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	38.8	3.6e-22
AWM87731.1|2944179_2945178_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	37.7	7.2e-41
AWM87732.1|2945188_2947633_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	54.1	5.6e-228
AWM87733.1|2947637_2949119_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	43.2	1.8e-96
AWM87734.1|2949238_2949679_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWM87735.1|2949871_2952523_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.6	1.5e-16
AWM87736.1|2952717_2955045_+	PAS domain-containing sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	34.1	2.9e-24
AWM87737.1|2955176_2956742_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87738.1|2956981_2958061_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87739.1|2959276_2962228_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
AWM89160.1|2962317_2963745_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AWM87740.1|2963762_2964461_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.0	2.9e-28
AWM87741.1|2964623_2965832_-|protease	HtrA protease/chaperone protein	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	5.3e-22
AWM87742.1|2965948_2966398_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
AWM87743.1|2966401_2968384_-	heme lyase NrfEFG subunit NrfE	NA	NA	NA	NA	NA
AWM87744.1|2968396_2968876_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
AWM87745.1|2968872_2969973_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
AWM89161.1|2970044_2971379_-	ATP-binding protein	NA	NA	NA	NA	NA
AWM87746.1|2971438_2972113_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWM87747.1|2972128_2972443_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87748.1|2972515_2972725_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87749.1|2972721_2973282_-	hypothetical protein	NA	A0A1X9HX89	Ruegeria_phage	52.2	6.4e-39
AWM87750.1|2973283_2974813_-	hypothetical protein	NA	A0A0K1LM54	Rhodobacter_phage	37.7	8.2e-36
AWM87751.1|2974923_2976060_-	hypothetical protein	NA	NA	NA	NA	NA
AWM87752.1|2976169_2980036_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	40.2	7.4e-243
AWM87753.1|2980050_2980476_-	peptidase P60	NA	A0A1V0DYB6	Dinoroseobacter_phage	52.6	4.3e-35
AWM87754.1|2980661_2981552_-	beta tubulin	NA	A0A1V0DY93	Dinoroseobacter_phage	42.6	2.6e-66
AWM87755.1|2981801_2982440_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	52.4	5.2e-53
AWM87756.1|2982529_2982772_+	GTP-binding protein	NA	NA	NA	NA	NA
AWM87757.1|2982778_2983435_-|tail	phage tail protein	tail	C0LP53	Escherichia_virus	32.1	1.3e-06
AWM87758.1|2983475_2983706_+	hypothetical protein	NA	NA	NA	NA	NA
AWM87759.1|2983755_2983956_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AWM87760.1|2983952_2984300_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AWM87761.1|2984352_2984763_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWM87762.1|2984812_2985247_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AWM87763.1|2985219_2985555_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AWM87764.1|2985811_2986492_-	hypothetical protein	NA	A0A0F7L420	uncultured_marine_virus	33.5	2.5e-13
>prophage 4
CP029481	Microvirga sp. 17 mud 1-3 chromosome, complete genome	4403107	4029529	4074982	4403107	terminase,portal,head,protease,capsid,tail,integrase	Enterobacteria_phage(28.57%)	48	4061202:4061249	4077333:4077380
AWM88591.1|4029529_4029988_-|protease	serine protease	protease	NA	NA	NA	NA
AWM88592.1|4030140_4031412_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
AWM88593.1|4031408_4033211_+	DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.6	2.2e-72
AWM88594.1|4033433_4034573_-	myo-inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AWM88595.1|4034574_4035360_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	1.0e-10
AWM88596.1|4035361_4036513_-	ATPase	NA	NA	NA	NA	NA
AWM88597.1|4036586_4037528_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWM88598.1|4037815_4038664_+	RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWM88599.1|4038743_4039733_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AWM88600.1|4039872_4041789_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
AWM88601.1|4041882_4043730_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
AWM88602.1|4043754_4044639_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
AWM88603.1|4045704_4045914_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88604.1|4046006_4046969_+	hypothetical protein	NA	NA	NA	NA	NA
AWM89241.1|4046992_4047292_-	hypothetical protein	NA	NA	NA	NA	NA
AWM88605.1|4047361_4048165_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWM88606.1|4048299_4049160_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AWM88607.1|4049176_4050331_+	aminotransferase	NA	NA	NA	NA	NA
AWM88608.1|4050342_4051242_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWM88609.1|4051241_4052186_-	ABC transporter permease	NA	NA	NA	NA	NA
AWM88610.1|4052247_4053558_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWM88611.1|4053630_4054683_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.9	8.4e-24
AWM88612.1|4055090_4056074_+	NAD-dependent epimerase	NA	NA	NA	NA	NA
AWM88613.1|4056097_4056844_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AWM88614.1|4056863_4057622_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AWM88615.1|4057838_4058345_+	DUF4188 domain-containing protein	NA	NA	NA	NA	NA
AWM88616.1|4058283_4058799_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88617.1|4058818_4059580_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88618.1|4059935_4060274_-	hypothetical protein	NA	NA	NA	NA	NA
AWM88619.1|4060517_4060997_-	polyketide cyclase	NA	NA	NA	NA	NA
4061202:4061249	attL	ATGGCGCACCCGACACGATTCGAACGTGTGACCTTTGCCTTCGGAGGG	NA	NA	NA	NA
AWM88620.1|4061421_4062702_+|integrase	integrase	integrase	NA	NA	NA	NA
AWM88621.1|4062952_4063480_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88622.1|4063638_4063929_+	HNH endonuclease	NA	NA	NA	NA	NA
AWM88623.1|4063941_4064193_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88624.1|4064378_4064639_-	hypothetical protein	NA	NA	NA	NA	NA
AWM89242.1|4064669_4064894_-	transcriptional regulator	NA	NA	NA	NA	NA
AWM88625.1|4065072_4065459_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88626.1|4065602_4066067_+	hypothetical protein	NA	NA	NA	NA	NA
AWM89243.1|4066123_4066360_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88627.1|4066362_4066590_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88628.1|4066939_4067446_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88629.1|4067414_4068794_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88630.1|4069876_4070425_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	40.8	4.4e-32
AWM88631.1|4070424_4072083_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	32.0	1.1e-38
AWM88632.1|4072113_4072485_+	hypothetical protein	NA	NA	NA	NA	NA
AWM88633.1|4072641_4073229_+	hypothetical protein	NA	A0A0H4AEL5	Pseudoalteromonas_phage	28.1	2.2e-05
AWM88634.1|4073231_4073549_+|head,tail	head-tail adaptor protein	head,tail	A0A1J0GUY4	Halomonas_phage	42.0	2.5e-08
AWM88635.1|4074571_4074982_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
4077333:4077380	attR	ATGGCGCACCCGACACGATTCGAACGTGTGACCTTTGCCTTCGGAGGG	NA	NA	NA	NA
