The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	0	7403	5416268		Escherichia_phage(100.0%)	7	NA	NA
AWL72354.1|1348_1717_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AWL72355.1|1716_2643_-	glutaminase	NA	NA	NA	NA	NA
AWL72356.1|2723_4109_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWL72357.1|4215_5094_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL72358.1|5047_5530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL72359.1|5675_6620_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AWL72360.1|6641_7403_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	4.7e-32
>prophage 2
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	11936	12887	5416268		Catovirus(100.0%)	1	NA	NA
AWL72365.1|11936_12887_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.7	2.8e-34
>prophage 3
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	17964	18345	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL77221.1|17964_18345_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.8e-08
>prophage 4
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	21583	23089	5416268		Staphylococcus_phage(50.0%)	2	NA	NA
AWL72374.1|21583_22282_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	7.3e-16
AWL72375.1|22291_23089_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 5
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	27239	43142	5416268		Escherichia_phage(70.0%)	15	NA	NA
AWL72379.1|27239_28343_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.6	5.2e-101
AWL72380.1|28491_28890_-	rhodanese	NA	NA	NA	NA	NA
AWL72381.1|28957_30055_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AWL72382.1|30023_30239_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AWL72383.1|30293_30734_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL72384.1|30998_32063_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.2	1.5e-65
AWL72385.1|32258_35366_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
AWL72386.1|35420_36686_+	MFS transporter	NA	NA	NA	NA	NA
AWL72387.1|36715_37804_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	97.0	1.0e-205
AWL77223.1|37888_38149_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWL72388.1|38445_39306_+	OKP family class A broad-spectrum beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.1	4.9e-139
AWL72389.1|39326_40088_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AWL72390.1|40349_41252_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.7	1.6e-156
AWL72391.1|41263_42529_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	91.7	1.9e-216
AWL72392.1|42521_43142_+	aldolase	NA	A0A077SK32	Escherichia_phage	94.2	2.2e-109
>prophage 6
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	52252	69548	5416268		Escherichia_phage(37.5%)	18	NA	NA
AWL72400.1|52252_52924_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.7	3.4e-79
AWL72401.1|53002_53539_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWL72402.1|53745_54639_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL72403.1|54633_55236_-	lysine transporter LysE	NA	NA	NA	NA	NA
AWL72404.1|55484_57530_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.4	3.3e-16
AWL72405.1|57660_58410_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AWL72406.1|58501_59188_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL72407.1|59239_59671_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	1.6e-21
AWL72408.1|59939_61403_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.3e-42
AWL72409.1|61672_62956_-	MFS transporter	NA	NA	NA	NA	NA
AWL72410.1|63070_63397_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	4.9e-23
AWL72411.1|63541_63883_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWL72412.1|63949_64510_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWL72413.1|64503_65214_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWL72414.1|65315_65585_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWL72415.1|65735_68171_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.8e-215
AWL72416.1|68181_68898_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	3.1e-54
AWL72417.1|68939_69548_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	4.9e-24
>prophage 7
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	87849	88809	5416268		Salmonella_phage(100.0%)	1	NA	NA
AWL72433.1|87849_88809_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	88.7	3.0e-52
>prophage 8
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	98249	101027	5416268		Lactobacillus_phage(100.0%)	1	NA	NA
AWL72443.1|98249_101027_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	3.6e-66
>prophage 9
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	117966	118482	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL77227.1|117966_118482_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	52.5	1.0e-22
>prophage 10
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	129728	131030	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL72473.1|129728_131030_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.1	1.3e-18
>prophage 11
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	142741	146278	5416268		Salmonella_phage(50.0%)	6	NA	NA
AWL72482.1|142741_142945_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
AWL72483.1|143015_143534_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72484.1|143734_144088_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AWL72485.1|144191_145403_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AWL72486.1|145399_145633_+	putative sulfurtransferase YedF	NA	NA	NA	NA	NA
AWL72487.1|145885_146278_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	37.8	5.2e-19
>prophage 12
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	158735	159941	5416268		Klosneuvirus(100.0%)	1	NA	NA
AWL72498.1|158735_159941_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.5e-21
>prophage 13
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	175010	179648	5416268		Bacillus_phage(50.0%)	2	NA	NA
AWL72512.1|175010_175685_+	methyltransferase	NA	W8CYT3	Bacillus_phage	53.3	9.2e-32
AWL72513.1|175745_179648_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	2.2e-53
>prophage 14
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	188484	189555	5416268		Synechococcus_phage(100.0%)	1	NA	NA
AWL72523.1|188484_189555_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	38.1	1.2e-09
>prophage 15
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	204677	206198	5416268		Indivirus(100.0%)	1	NA	NA
AWL72537.1|204677_206198_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.8	1.5e-10
>prophage 16
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	216365	217355	5416268		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL72549.1|216365_217355_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.6	2.8e-69
>prophage 17
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	222460	232135	5416268	bacteriocin,tRNA	Escherichia_phage(40.0%)	10	NA	NA
AWL72553.1|222460_223585_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.3	5.0e-115
AWL72554.1|223729_223942_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AWL77231.1|224032_224458_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	5.4e-30
AWL77232.1|225243_225501_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWL72555.1|225998_226319_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72556.1|227248_228184_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	4.1e-139
AWL72557.1|228229_229603_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	5.1e-53
AWL72558.1|229617_229812_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72559.1|230129_231113_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWL72560.1|231391_232135_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.2e-16
>prophage 18
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	238924	239938	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL77233.1|238924_239938_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	5.8e-30
>prophage 19
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	265978	271004	5416268		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWL72593.1|265978_268357_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	1.4e-18
AWL72594.1|268349_271004_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	2.5e-96
>prophage 20
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	278900	279662	5416268		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWL72601.1|278900_279662_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.0e-18
>prophage 21
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	292165	297938	5416268		Hokovirus(50.0%)	3	NA	NA
AWL72613.1|292165_294856_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.9	9.3e-59
AWL72614.1|294845_297044_+	glycoside hydrolase family 2	NA	NA	NA	NA	NA
AWL72615.1|297068_297938_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.0	2.2e-46
>prophage 22
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	327804	331928	5416268		Planktothrix_phage(50.0%)	4	NA	NA
AWL72641.1|327804_328797_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWL72642.1|328798_329608_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	33.7	1.2e-14
AWL72643.1|329637_331137_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.5e-61
AWL72644.1|331133_331928_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	37.4	6.6e-29
>prophage 23
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	337414	339349	5416268		Bodo_saltans_virus(100.0%)	1	NA	NA
AWL72651.1|337414_339349_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.0	2.7e-07
>prophage 24
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	344935	345538	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL72660.1|344935_345538_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	9.3e-44
>prophage 25
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	350377	355759	5416268	protease	Tupanvirus(50.0%)	5	NA	NA
AWL72664.1|350377_352975_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.3	6.4e-89
AWL72665.1|353074_353290_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72666.1|353381_353633_+	DUF2498 domain-containing protein	NA	NA	NA	NA	NA
AWL77237.1|353695_354742_-|protease	protease SohB	protease	NA	NA	NA	NA
AWL72667.1|354997_355759_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.1	1.4e-07
>prophage 26
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	361784	364748	5416268		Acinetobacter_phage(100.0%)	2	NA	NA
AWL72674.1|361784_363380_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	6.3e-47
AWL72675.1|363383_364748_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	2.5e-36
>prophage 27
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	375156	375834	5416268		Cyanophage(100.0%)	1	NA	NA
AWL72684.1|375156_375834_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.3	4.7e-20
>prophage 28
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	380676	386411	5416268		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AWL72692.1|380676_381438_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	6.1e-16
AWL72693.1|381529_382120_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWL72694.1|382255_383647_+	L-cystine transporter	NA	NA	NA	NA	NA
AWL72695.1|383707_384040_-	cell division activator CedA	NA	NA	NA	NA	NA
AWL72696.1|384152_386411_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.3	9.3e-145
>prophage 29
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	392674	393502	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL72704.1|392674_393502_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	1.6e-70
>prophage 30
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	400184	401405	5416268		Klosneuvirus(100.0%)	1	NA	NA
AWL72711.1|400184_401405_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.5	3.6e-26
>prophage 31
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	407461	408094	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL72718.1|407461_408094_+	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.1	2.7e-09
>prophage 32
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	413367	415314	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL72723.1|413367_415314_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 33
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	421581	423648	5416268		Tupanvirus(50.0%)	2	NA	NA
AWL72730.1|421581_422223_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.9e-18
AWL72731.1|422394_423648_+	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	26.4	8.2e-26
>prophage 34
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	427335	428190	5416268		Indivirus(100.0%)	1	NA	NA
AWL72737.1|427335_428190_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.3	2.4e-16
>prophage 35
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	431464	433998	5416268		Bacillus_phage(50.0%)	3	NA	NA
AWL72740.1|431464_432748_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
AWL72741.1|432793_433357_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72742.1|433515_433998_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	41.0	2.0e-17
>prophage 36
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	437970	438693	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL77239.1|437970_438693_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	45.0	9.2e-38
>prophage 37
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	448159	448909	5416268		Mollivirus(100.0%)	1	NA	NA
AWL72754.1|448159_448909_-	KR domain-containing protein	NA	A0A0M4JSW6	Mollivirus	29.8	5.1e-15
>prophage 38
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	464715	515518	5416268	tail,integrase,transposase,plate,portal,capsid,terminase	Enterobacteria_phage(50.0%)	62	474516:474533	511783:511800
AWL72768.1|464715_465624_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.6	1.7e-17
AWL72769.1|466583_466889_+	DUF596 domain-containing protein	NA	NA	NA	NA	NA
AWL72770.1|467499_467742_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	73.4	1.1e-27
AWL72771.1|467903_469043_-	glycosyl transferase	NA	NA	NA	NA	NA
AWL72772.1|469286_469787_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72773.1|469904_470351_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWL77243.1|470334_471126_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL72774.1|471227_472412_+	MFS transporter	NA	NA	NA	NA	NA
AWL72775.1|472443_473136_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72776.1|473281_473791_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWL77244.1|473777_474134_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWL72777.1|474123_474363_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
474516:474533	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWL72778.1|474628_474880_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWL72779.1|474923_476063_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AWL72780.1|476217_477390_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
AWL72781.1|477389_477905_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWL72782.1|477950_478268_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWL77245.1|478267_478426_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWL72783.1|478412_481388_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.1	1.3e-223
AWL72784.1|481402_481861_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.4	4.0e-55
AWL72785.1|482219_484205_+	DNA helicase	NA	NA	NA	NA	NA
AWL72786.1|484201_484840_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72787.1|485073_486171_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	73.3	1.4e-08
AWL72788.1|486170_486383_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72789.1|486379_489406_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AWL72790.1|489395_490319_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.9	3.4e-53
AWL72791.1|490320_490671_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AWL72792.1|490667_491255_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	9.1e-60
AWL72793.1|491251_491887_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
AWL72794.1|491883_492351_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	1.6e-46
AWL72795.1|492351_492543_-	peptidase	NA	NA	NA	NA	NA
AWL77246.1|492532_492862_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWL72796.1|492873_493419_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	1.1e-30
AWL72797.1|493415_493700_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWL72798.1|493690_493891_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWL72799.1|493890_494406_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	6.3e-41
AWL72800.1|494518_495376_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	4.9e-70
AWL72801.1|495425_496460_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	48.5	1.7e-93
AWL72802.1|496469_497309_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
AWL72803.1|497465_499193_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	4.1e-233
AWL72804.1|499186_500248_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.8e-144
AWL72805.1|500434_500650_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72806.1|500813_503036_-	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AWL72807.1|503047_504187_-	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.8	1.4e-16
AWL72808.1|504314_506888_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	59.7	6.2e-246
AWL72809.1|506925_507861_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.8	3.2e-83
AWL77247.1|507857_508085_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AWL72810.1|508093_508660_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.7	7.2e-14
AWL72811.1|508656_508881_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72812.1|508958_509222_-	hypothetical protein	NA	NA	NA	NA	NA
AWL77248.1|509237_509615_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72813.1|509630_509849_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWL72814.1|509869_510148_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWL72815.1|510268_510568_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.7e-36
AWL72816.1|510683_511697_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	3.8e-154
AWL72817.1|511931_512945_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	5.5e-12
511783:511800	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AWL72818.1|513002_513104_+	hypothetical protein	NA	NA	NA	NA	NA
AWL77249.1|513061_513178_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72819.1|513296_513422_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72820.1|513481_513745_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWL72821.1|513875_514514_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AWL72822.1|514603_515518_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
>prophage 39
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	518821	520606	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL72825.1|518821_520606_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	5.8e-17
>prophage 40
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	541382	582041	5416268	holin,tail,portal,head,capsid,terminase	Klebsiella_phage(62.86%)	38	NA	NA
AWL72850.1|541382_541535_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.4e-17
AWL72851.1|541867_542065_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72852.1|543182_544241_-	diguanylate cyclase AdrA	NA	A0A2L1IV26	Escherichia_phage	96.2	8.0e-06
AWL72853.1|544663_546073_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.9	1.5e-84
AWL72854.1|546134_558722_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.9	0.0e+00
AWL72855.1|558784_559390_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	71.8	2.9e-77
AWL77250.1|559441_559777_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	44.1	2.1e-21
AWL72856.1|559812_560523_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
AWL72857.1|560524_561280_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
AWL72858.1|561276_561615_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
AWL72859.1|561614_564950_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
AWL72860.1|564949_565162_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AWL72861.1|565182_565548_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWL72862.1|565605_566067_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWL72863.1|566098_566500_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
AWL72864.1|566496_566886_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWL72865.1|566866_567205_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AWL72866.1|567201_567519_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWL72867.1|567499_567760_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWL72868.1|567818_569105_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
AWL72869.1|569182_570103_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
AWL72870.1|570139_571399_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
AWL72871.1|571398_571578_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
AWL72872.1|571571_573293_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AWL72873.1|573292_573727_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWL72874.1|573976_574408_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AWL72875.1|574404_574722_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72876.1|574673_575036_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWL77251.1|575363_575561_+	hypothetical protein	NA	H6WRV6	Salmonella_phage	73.8	1.1e-20
AWL72877.1|576636_576987_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWL72878.1|576983_577481_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	6.2e-78
AWL72879.1|577480_577696_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWL72880.1|579222_579825_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.4e-76
AWL72881.1|579841_580873_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.9	5.6e-97
AWL72882.1|580872_581076_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72883.1|581072_581465_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
AWL72884.1|581505_581796_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AWL72885.1|581807_582041_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	2.2e-25
>prophage 41
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	588124	658653	5416268	holin,tail,integrase,protease,transposase,portal,head,capsid,terminase	Salmonella_phage(16.13%)	86	630880:630895	666357:666372
AWL72890.1|588124_588589_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
AWL72891.1|588581_589565_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	6.9e-44
AWL72892.1|589616_590171_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72893.1|590173_590389_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AWL72894.1|590490_590880_+	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AWL72895.1|591494_591713_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72896.1|591722_591917_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWL72897.1|591959_592304_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL72898.1|592445_594584_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.5	5.6e-99
AWL72899.1|594636_594882_+	excisionase	NA	NA	NA	NA	NA
AWL72900.1|594862_595990_+|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AWL72901.1|596107_596260_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWL72902.1|596451_597036_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72903.1|597788_598766_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72904.1|598955_599483_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.7	1.7e-65
AWL72905.1|602694_603960_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.6	1.1e-208
AWL72906.1|603961_604381_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	6.5e-36
AWL72907.1|605041_605464_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
AWL72908.1|605514_606093_-	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	92.9	1.4e-89
AWL72909.1|606231_607857_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWL77252.1|607906_608104_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72910.1|608151_608355_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72911.1|610847_613931_-	kinase	NA	A0A286S259	Klebsiella_phage	70.7	0.0e+00
AWL72912.1|613927_614308_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AWL72913.1|614317_614803_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AWL72914.1|614789_615263_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.1	1.0e-53
AWL72915.1|615283_618877_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.3	2.3e-222
AWL72916.1|619251_619557_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
AWL72917.1|619559_619964_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	53.1	1.5e-29
AWL72918.1|619994_620699_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.0e-78
AWL72919.1|620755_621103_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
AWL72920.1|621099_621549_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.1e-62
AWL72921.1|621545_621884_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	3.6e-37
AWL77253.1|621896_622229_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	30.7	3.4e-11
AWL72922.1|622234_622489_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72923.1|622534_623755_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	3.7e-140
AWL72924.1|623764_624472_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AWL72925.1|624447_625767_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	7.6e-139
AWL72926.1|625773_627510_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AWL72927.1|627463_627928_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AWL72928.1|628110_628452_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
AWL72929.1|628507_628753_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	64.2	1.9e-19
AWL72930.1|628819_629209_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	6.7e-27
AWL72931.1|629293_629782_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72932.1|629852_630050_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.3	5.6e-22
AWL72933.1|630000_630276_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	6.8e-10
AWL72934.1|630832_631015_+	hypothetical protein	NA	NA	NA	NA	NA
630880:630895	attL	CTGCATCACCGCCAGC	NA	NA	NA	NA
AWL72935.1|631027_631213_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72936.1|631228_631708_-	lysozyme	NA	A5VW81	Enterobacteria_phage	83.6	1.2e-70
AWL72937.1|631691_632015_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	8.0e-42
AWL77254.1|632728_633496_-	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	74.7	2.9e-106
AWL77255.1|633767_634025_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	9.2e-25
AWL72938.1|634027_634288_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72939.1|634429_635479_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	77.6	6.2e-168
AWL72940.1|635628_635820_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	82.5	1.9e-22
AWL72941.1|636514_637564_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72942.1|637658_638042_-	DUF1133 domain-containing protein	NA	U5P0A5	Shigella_phage	80.8	3.8e-51
AWL77256.1|638059_639046_-	hypothetical protein	NA	Q8SBE5	Shigella_phage	48.0	8.3e-90
AWL72943.1|639127_639949_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AWL72944.1|640038_640437_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
AWL72945.1|640433_640910_-|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	56.3	9.4e-15
AWL72946.1|640906_642757_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.3	6.3e-200
AWL72947.1|642749_644132_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	1.5e-105
AWL72948.1|644119_644578_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWL72949.1|644574_645486_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	9.8e-53
AWL72950.1|645475_645655_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AWL72951.1|645827_646376_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.5	2.7e-66
AWL72952.1|646455_646926_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72953.1|647294_647672_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AWL72954.1|647668_648016_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AWL72955.1|648065_649604_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
AWL72956.1|649510_649825_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72957.1|649919_650564_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.2	1.7e-38
AWL72958.1|650750_650840_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72959.1|650836_651064_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72960.1|651761_652133_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.0	2.7e-49
AWL72961.1|652185_653016_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	82.1	5.5e-127
AWL72962.1|653151_653679_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	1.8e-62
AWL72963.1|653678_653879_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72964.1|653871_654657_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AWL72965.1|654784_655249_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.1	1.0e-10
AWL72966.1|655245_655515_+	antitoxin	NA	NA	NA	NA	NA
AWL72967.1|655617_655893_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
AWL72968.1|655921_656158_+	excisionase	NA	NA	NA	NA	NA
AWL72969.1|656147_657290_+|integrase	integrase	integrase	Q77Z02	Phage_21	81.4	1.1e-170
AWL72970.1|657402_658653_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
666357:666372	attR	GCTGGCGGTGATGCAG	NA	NA	NA	NA
>prophage 42
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	661881	663252	5416268		Bodo_saltans_virus(100.0%)	1	NA	NA
AWL72974.1|661881_663252_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.6e-107
>prophage 43
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	669814	670951	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL72981.1|669814_670951_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	3.5e-31
>prophage 44
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	675383	681481	5416268		Staphylococcus_phage(33.33%)	6	NA	NA
AWL72986.1|675383_677012_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	4.8e-26
AWL72987.1|677295_677640_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72988.1|677730_678561_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
AWL72989.1|678575_679487_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWL72990.1|679535_680780_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWL72991.1|680779_681481_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 45
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	701199	701841	5416268		Pseudomonas_phage(100.0%)	1	NA	NA
AWL73008.1|701199_701841_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	6.5e-27
>prophage 46
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	705120	706302	5416268		Ralstonia_phage(50.0%)	2	NA	NA
AWL73012.1|705120_705357_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AWL73013.1|705567_706302_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 47
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	725470	725722	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL73030.1|725470_725722_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	46.2	1.8e-12
>prophage 48
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	728964	729885	5416268		Morganella_phage(100.0%)	1	NA	NA
AWL73035.1|728964_729885_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.2	5.6e-56
>prophage 49
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	738247	738775	5416268		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AWL73044.1|738247_738775_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	3.7e-28
>prophage 50
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	746874	747933	5416268		Cronobacter_phage(100.0%)	1	NA	NA
AWL73053.1|746874_747933_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 51
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	764440	768840	5416268		Enterobacteria_phage(100.0%)	6	NA	NA
AWL73067.1|764440_764935_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
AWL73068.1|764956_766279_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	1.4e-201
AWL73069.1|766347_766734_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73070.1|766940_767327_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73071.1|767563_768502_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWL73072.1|768666_768840_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 52
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	783978	790555	5416268		Hokovirus(50.0%)	4	NA	NA
AWL73089.1|783978_786480_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	8.7e-11
AWL73090.1|786789_787866_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AWL73091.1|787886_788207_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AWL73092.1|788257_790555_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
>prophage 53
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	793646	795819	5416268		Bacillus_phage(100.0%)	2	NA	NA
AWL73097.1|793646_794546_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.2	2.3e-14
AWL73098.1|794790_795819_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.2	2.3e-18
>prophage 54
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	800820	806357	5416268	protease	Iris_mild_mosaic_virus(50.0%)	3	NA	NA
AWL73103.1|800820_803247_-	glycogen phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.4	1.9e-10
AWL73104.1|803776_805429_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AWL73105.1|805697_806357_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 55
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	811297	813352	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL73113.1|811297_813352_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.3	7.4e-16
>prophage 56
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	826055	827963	5416268		Tupanvirus(100.0%)	1	NA	NA
AWL73127.1|826055_827963_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	6.2e-49
>prophage 57
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	836728	844984	5416268	tRNA	Bacillus_virus(20.0%)	5	NA	NA
AWL73136.1|836728_837502_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
AWL73137.1|837599_840215_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	9.7e-21
AWL73138.1|840541_841744_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	3.0e-41
AWL73139.1|841909_843310_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
AWL73140.1|843901_844984_+	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	52.8	1.2e-97
>prophage 58
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	862347	866887	5416268		Bacillus_phage(100.0%)	3	NA	NA
AWL73155.1|862347_864096_-	lipid ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	6.0e-59
AWL73156.1|864132_866397_-	ComEC family protein	NA	NA	NA	NA	NA
AWL73157.1|866599_866887_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 59
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	871972	873061	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL73162.1|871972_873061_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	1.3e-80
>prophage 60
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	877112	908105	5416268	protease,tRNA	Tetraselmis_virus(13.33%)	22	NA	NA
AWL73165.1|877112_879395_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	8.4e-162
AWL73166.1|879586_880327_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
AWL73167.1|880480_881629_-	MFS transporter	NA	NA	NA	NA	NA
AWL73168.1|881745_881892_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AWL73169.1|881903_882767_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AWL73170.1|882768_883068_-	(4Fe-4S)-binding protein	NA	A0A077SL61	Escherichia_phage	57.6	3.0e-27
AWL73171.1|884173_886612_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	8.9e-218
AWL73172.1|886810_888103_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWL73173.1|888194_889538_-	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	41.2	1.9e-81
AWL73174.1|889546_890158_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWL73175.1|890280_894633_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.3e-88
AWL73176.1|894768_895263_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWL73177.1|895795_896764_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWL73178.1|896878_898645_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.6e-22
AWL73179.1|898645_900367_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	6.4e-13
AWL73180.1|900406_901108_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWL73181.1|901461_901680_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWL73182.1|901801_904081_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
AWL73183.1|904111_904429_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWL73184.1|904754_904976_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWL73185.1|905052_906993_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AWL73186.1|906989_908105_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 61
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	920795	925156	5416268		Roseobacter_phage(50.0%)	5	NA	NA
AWL73195.1|920795_921626_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	2.4e-05
AWL73196.1|921657_922797_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWL73197.1|923143_923431_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL73198.1|923685_924201_+	lipoprotein	NA	NA	NA	NA	NA
AWL73199.1|924427_925156_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
>prophage 62
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	928291	939877	5416268		Bacillus_phage(33.33%)	13	NA	NA
AWL73203.1|928291_929764_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	1.1e-26
AWL73204.1|929760_930477_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	6.1e-34
AWL73205.1|930555_931683_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	26.5	8.7e-19
AWL73206.1|931724_932213_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWL73207.1|932270_933116_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWL73208.1|933112_934066_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWL77269.1|934076_935210_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWL73209.1|935371_936484_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWL73210.1|936832_937312_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWL73211.1|937400_938303_-	alpha-L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	9.1e-35
AWL73212.1|938417_939140_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWL77270.1|939123_939411_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWL73213.1|939613_939877_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 63
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	947352	949367	5416268		Escherichia_phage(50.0%)	2	NA	NA
AWL73221.1|947352_948111_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	1.4e-12
AWL73222.1|948164_949367_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	9.4e-96
>prophage 64
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	959666	961526	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL73233.1|959666_961526_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.0	2.4e-13
>prophage 65
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	965771	968204	5416268		Bacteriophage(100.0%)	1	NA	NA
AWL73238.1|965771_968204_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 66
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	976031	981988	5416268		Tupanvirus(50.0%)	5	NA	NA
AWL73244.1|976031_977624_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	1.4e-59
AWL73245.1|977801_978587_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWL73246.1|978764_979679_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWL73247.1|979826_980543_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL73248.1|980611_981988_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	23.6	2.7e-22
>prophage 67
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	985997	991157	5416268		Escherichia_phage(33.33%)	6	NA	NA
AWL73253.1|985997_986510_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	2.9e-14
AWL73254.1|986861_987749_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWL73255.1|987986_988490_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	7.1e-05
AWL73256.1|988906_989653_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AWL73257.1|989778_990438_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AWL73258.1|990434_991157_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 68
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	995200	1005246	5416268		Erwinia_phage(20.0%)	9	NA	NA
AWL73262.1|995200_995491_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	50.0	1.1e-05
AWL73263.1|995512_995779_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
AWL73264.1|996064_996325_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL73265.1|996434_997403_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWL73266.1|997432_999589_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	2.0e-43
AWL73267.1|999781_1001137_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	2.4e-47
AWL73268.1|1001859_1002519_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL73269.1|1002518_1003514_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWL73270.1|1003506_1005246_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	5.7e-17
>prophage 69
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1015541	1016447	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL73285.1|1015541_1016447_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.8	2.8e-28
>prophage 70
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1022946	1023669	5416268		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWL73293.1|1022946_1023669_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.7	4.4e-08
>prophage 71
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1027471	1028761	5416268		Klosneuvirus(100.0%)	1	NA	NA
AWL77272.1|1027471_1028761_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	5.9e-19
>prophage 72
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1031851	1033387	5416268		Catovirus(100.0%)	1	NA	NA
AWL73302.1|1031851_1033387_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.6	5.4e-80
>prophage 73
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1039785	1047642	5416268		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
AWL73308.1|1039785_1042473_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.8	1.3e-68
AWL73309.1|1042524_1042956_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	42.1	7.7e-24
AWL73310.1|1043490_1044576_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL73311.1|1044576_1047642_+	MFS transporter	NA	S5VL66	Leptospira_phage	20.7	8.7e-21
>prophage 74
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1050750	1051485	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL73316.1|1050750_1051485_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	49.7	3.1e-49
>prophage 75
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1056324	1062847	5416268		Planktothrix_phage(33.33%)	7	NA	NA
AWL77273.1|1056324_1057383_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	5.3e-18
AWL73323.1|1057382_1058075_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AWL73324.1|1058074_1058848_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL73325.1|1058990_1059140_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AWL73326.1|1059292_1060081_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWL73327.1|1060148_1061621_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	23.7	2.6e-10
AWL73328.1|1061830_1062847_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.3	7.5e-78
>prophage 76
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1071341	1072589	5416268		Oenococcus_phage(100.0%)	1	NA	NA
AWL77274.1|1071341_1072589_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.4	9.0e-33
>prophage 77
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1076373	1079928	5416268		Edwardsiella_phage(33.33%)	4	NA	NA
AWL73341.1|1076373_1077426_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.7	1.5e-81
AWL73342.1|1077741_1078149_+	hypothetical protein	NA	NA	NA	NA	NA
AWL73343.1|1078267_1079212_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.6e-24
AWL73344.1|1079208_1079928_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
>prophage 78
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1104828	1105620	5416268		Kaumoebavirus(100.0%)	1	NA	NA
AWL73367.1|1104828_1105620_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.8	2.9e-08
>prophage 79
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1109659	1117089	5416268		Acinetobacter_phage(33.33%)	6	NA	NA
AWL73372.1|1109659_1111138_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.9e-46
AWL73373.1|1111109_1112552_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.6	1.3e-46
AWL77278.1|1112734_1112941_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AWL73374.1|1113251_1113341_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWL73375.1|1113340_1115020_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AWL73376.1|1115040_1117089_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.5	4.6e-26
>prophage 80
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1123915	1124689	5416268		Mycobacterium_phage(100.0%)	1	NA	NA
AWL73383.1|1123915_1124689_+	esterase	NA	A0A222ZNA0	Mycobacterium_phage	31.6	3.8e-05
>prophage 81
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1127693	1137649	5416268	tRNA	Lactobacillus_phage(25.0%)	7	NA	NA
AWL73388.1|1127693_1129097_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	7.1e-10
AWL73389.1|1129083_1130223_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
AWL73390.1|1130277_1131573_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.9	3.1e-60
AWL73391.1|1131624_1131957_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73392.1|1132004_1133408_-	chitoporin	NA	NA	NA	NA	NA
AWL73393.1|1133847_1135515_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.1	0.0e+00
AWL73394.1|1135693_1137649_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 82
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1142408	1144073	5416268		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL73399.1|1142408_1144073_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	2.7e-85
>prophage 83
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1148115	1149162	5416268		Pseudomonas_phage(100.0%)	1	NA	NA
AWL73403.1|1148115_1149162_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 84
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1155170	1163310	5416268	tRNA	Planktothrix_phage(33.33%)	5	NA	NA
AWL73410.1|1155170_1155896_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.6e-29
AWL73411.1|1156196_1157867_+	hemin-binding protein	NA	NA	NA	NA	NA
AWL73412.1|1157930_1159709_+	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	33.7	2.0e-25
AWL77279.1|1160018_1160501_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AWL73413.1|1160727_1163310_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	3.1e-184
>prophage 85
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1170354	1172842	5416268		Synechococcus_phage(50.0%)	2	NA	NA
AWL73422.1|1170354_1171503_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	8.4e-09
AWL73423.1|1171642_1172842_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	1.1e-104
>prophage 86
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1176841	1178380	5416268		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
AWL73429.1|1176841_1177630_-	deaminated glutathione amidase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	26.6	2.1e-11
AWL73430.1|1177719_1178103_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
AWL73431.1|1178170_1178380_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 87
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1182471	1184542	5416268		Morganella_phage(50.0%)	2	NA	NA
AWL73436.1|1182471_1182900_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
AWL73437.1|1182976_1184542_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	8.4e-44
>prophage 88
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1187861	1201575	5416268	tRNA	Streptococcus_phage(20.0%)	12	NA	NA
AWL73441.1|1187861_1189085_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.6	2.6e-61
AWL73442.1|1189069_1189696_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	4.5e-57
AWL73443.1|1189696_1190857_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AWL73444.1|1190983_1191673_+	acireductone synthase	NA	NA	NA	NA	NA
AWL73445.1|1191669_1192212_+	acireductone dioxygenase	NA	NA	NA	NA	NA
AWL73446.1|1192319_1194629_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.9	3.9e-82
AWL73447.1|1195037_1196018_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL73448.1|1196014_1197565_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	6.6e-17
AWL73449.1|1197561_1198551_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL73450.1|1198547_1199552_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL73451.1|1199563_1200505_+	sugar kinase	NA	NA	NA	NA	NA
AWL73452.1|1200546_1201575_-	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.4	7.2e-28
>prophage 89
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1219203	1220706	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL73466.1|1219203_1220706_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	6.4e-17
>prophage 90
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1236066	1240807	5416268		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AWL73478.1|1236066_1236861_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
AWL73479.1|1236925_1240807_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.8	2.4e-55
>prophage 91
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1252196	1253741	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL73490.1|1252196_1253741_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	2.8e-15
>prophage 92
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1260335	1266249	5416268	holin	Vibrio_phage(50.0%)	5	NA	NA
AWL73498.1|1260335_1262369_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.1	2.9e-20
AWL77285.1|1262365_1262581_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73499.1|1262497_1263085_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AWL73500.1|1263098_1264571_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWL73501.1|1264584_1266249_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	1.2e-59
>prophage 93
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1270827	1272355	5416268		Planktothrix_phage(100.0%)	2	NA	NA
AWL73506.1|1270827_1271664_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.0e-11
AWL73507.1|1271650_1272355_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	9.6e-24
>prophage 94
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1275855	1280534	5416268		Bacillus_virus(50.0%)	5	NA	NA
AWL73510.1|1275855_1276617_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	9.1e-20
AWL73511.1|1276609_1277275_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL73512.1|1277289_1277931_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWL73513.1|1277978_1278830_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL73514.1|1279070_1280534_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.6	1.8e-16
>prophage 95
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1284289	1286327	5416268		Planktothrix_phage(50.0%)	2	NA	NA
AWL73517.1|1284289_1285300_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.8e-15
AWL73518.1|1285289_1286327_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.2e-15
>prophage 96
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1296555	1299270	5416268		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL73526.1|1296555_1299270_-	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.8	2.7e-66
>prophage 97
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1322060	1323176	5416268		Tupanvirus(100.0%)	1	NA	NA
AWL73550.1|1322060_1323176_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	33.3	1.1e-37
>prophage 98
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1339107	1339905	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL73567.1|1339107_1339905_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	2.7e-14
>prophage 99
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1346529	1352333	5416268		Bacillus_phage(50.0%)	5	NA	NA
AWL73573.1|1346529_1347930_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.4	3.3e-15
AWL77291.1|1347959_1348964_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWL73574.1|1348979_1349621_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73575.1|1349806_1350838_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL73576.1|1350848_1352333_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 100
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1360270	1363607	5416268	tRNA	Catovirus(50.0%)	2	NA	NA
AWL73583.1|1360270_1361788_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.7	1.2e-84
AWL73584.1|1362131_1363607_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.9	3.4e-47
>prophage 101
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1369827	1370748	5416268		Morganella_phage(100.0%)	1	NA	NA
AWL73589.1|1369827_1370748_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.9	6.4e-52
>prophage 102
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1382343	1384855	5416268	tRNA	Enterococcus_phage(50.0%)	3	NA	NA
AWL73602.1|1382343_1383210_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AWL73603.1|1383211_1383424_+	hypothetical protein	NA	NA	NA	NA	NA
AWL73604.1|1383469_1384855_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 103
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1393410	1394097	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL77293.1|1393410_1394097_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.7e-31
>prophage 104
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1397278	1402484	5416268		Bacillus_virus(50.0%)	5	NA	NA
AWL73617.1|1397278_1397956_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
AWL73618.1|1398096_1399014_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AWL73619.1|1399010_1399469_+	NfeD family protein	NA	NA	NA	NA	NA
AWL73620.1|1399465_1399876_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AWL77295.1|1399982_1402484_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	7.2e-114
>prophage 105
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1412684	1420495	5416268	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AWL73630.1|1412684_1414559_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	8.3e-115
AWL73631.1|1414670_1415276_-	recombination protein RecR	NA	NA	NA	NA	NA
AWL73632.1|1415275_1415608_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWL73633.1|1415665_1417573_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
AWL73634.1|1417665_1418217_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.3e-28
AWL73635.1|1418367_1418745_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWL73636.1|1418814_1419342_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AWL73637.1|1419354_1419528_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AWL73638.1|1419595_1420495_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	1.4e-64
>prophage 106
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1426016	1435410	5416268		Leptospira_phage(33.33%)	10	NA	NA
AWL73642.1|1426016_1429163_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.4	6.6e-48
AWL73643.1|1429646_1430021_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AWL73644.1|1430047_1430266_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL73645.1|1430424_1430991_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AWL73646.1|1431127_1431598_+	hypothetical protein	NA	NA	NA	NA	NA
AWL73647.1|1431566_1433024_-	DNA-binding protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	1.0e-11
AWL73648.1|1433124_1433823_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL73649.1|1433819_1433960_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWL73650.1|1433959_1434223_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AWL73651.1|1434339_1435410_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 107
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1444581	1445691	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL77296.1|1444581_1445691_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	32.7	5.4e-13
>prophage 108
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1456600	1460144	5416268		Bacillus_phage(100.0%)	2	NA	NA
AWL73672.1|1456600_1458379_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	2.7e-38
AWL73673.1|1458371_1460144_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	1.2e-49
>prophage 109
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1464569	1465271	5416268		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL73678.1|1464569_1465271_+	7-cyano-7-deazaguanine synthase	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	5.5e-88
>prophage 110
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1468517	1473685	5416268	protease	Sodalis_phage(25.0%)	4	NA	NA
AWL73682.1|1468517_1468790_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AWL73683.1|1468999_1471354_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	4.7e-224
AWL73684.1|1471537_1472812_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AWL73685.1|1473061_1473685_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 111
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1487989	1489681	5416268		Lactobacillus_phage(100.0%)	1	NA	NA
AWL73701.1|1487989_1489681_+	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	27.4	8.8e-15
>prophage 112
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1502495	1507155	5416268		Klosneuvirus(33.33%)	6	NA	NA
AWL73714.1|1502495_1503470_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	5.4e-09
AWL73715.1|1503515_1504019_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AWL73716.1|1504011_1504983_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AWL73717.1|1505054_1505474_-	N utilization substance protein B	NA	NA	NA	NA	NA
AWL73718.1|1505493_1505964_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AWL73719.1|1506051_1507155_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.9	1.1e-50
>prophage 113
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1510743	1515082	5416268	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AWL73725.1|1510743_1511715_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.4	1.6e-45
AWL73726.1|1511725_1513573_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWL73727.1|1513599_1513932_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AWL73728.1|1513954_1515082_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
>prophage 114
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1531851	1540372	5416268		Bacillus_phage(60.0%)	6	NA	NA
AWL73744.1|1531851_1533147_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.5	2.9e-26
AWL73745.1|1533168_1533858_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	2.2e-36
AWL73746.1|1534040_1535246_+	exonuclease subunit SbcD	NA	L0LAJ8	Bacillus_phage	25.2	4.5e-05
AWL73747.1|1535242_1538380_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.3e-08
AWL73748.1|1538454_1539369_-	fructokinase	NA	NA	NA	NA	NA
AWL73749.1|1539460_1540372_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 115
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1561445	1562213	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL73771.1|1561445_1562213_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.1	8.6e-26
>prophage 116
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1573216	1576938	5416268		Hokovirus(33.33%)	5	NA	NA
AWL73781.1|1573216_1573999_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	25.6	2.0e-09
AWL73782.1|1573991_1574687_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
AWL73783.1|1574803_1574974_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73784.1|1575308_1576118_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL73785.1|1576119_1576938_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	2.4e-34
>prophage 117
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1586064	1586907	5416268		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL73794.1|1586064_1586907_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	8.3e-14
>prophage 118
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1593182	1600240	5416268		Streptococcus_phage(50.0%)	8	NA	NA
AWL73801.1|1593182_1594235_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.8e-111
AWL73802.1|1594524_1595628_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	8.2e-62
AWL73803.1|1595638_1596892_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	2.0e-88
AWL73804.1|1597379_1597586_+	hypothetical protein	NA	NA	NA	NA	NA
AWL73805.1|1597582_1597789_+	hypothetical protein	NA	NA	NA	NA	NA
AWL73806.1|1597853_1598999_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73807.1|1599223_1599424_-	hypothetical protein	NA	NA	NA	NA	NA
AWL73808.1|1599670_1600240_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.0	2.2e-18
>prophage 119
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1611668	1613066	5416268		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL73815.1|1611668_1613066_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	9.7e-44
>prophage 120
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1617718	1618714	5416268		Catovirus(100.0%)	1	NA	NA
AWL73821.1|1617718_1618714_+	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.1	1.3e-26
>prophage 121
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1626249	1627533	5416268		Klosneuvirus(100.0%)	1	NA	NA
AWL73829.1|1626249_1627533_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.3	3.8e-34
>prophage 122
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1644740	1645322	5416268		Caulobacter_phage(100.0%)	1	NA	NA
AWL73847.1|1644740_1645322_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 123
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1652176	1656386	5416268		Bradyrhizobium_phage(33.33%)	5	NA	NA
AWL77303.1|1652176_1652908_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.4	1.6e-37
AWL73852.1|1652972_1653440_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.1	3.0e-50
AWL73853.1|1653436_1654159_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWL73854.1|1654191_1654947_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWL73855.1|1655018_1656386_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 124
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1660438	1661242	5416268		Indivirus(100.0%)	1	NA	NA
AWL73859.1|1660438_1661242_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.9	1.1e-39
>prophage 125
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1668053	1669085	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL73861.1|1668053_1669085_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 126
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1682095	1686195	5416268		Saccharomonospora_phage(50.0%)	2	NA	NA
AWL73874.1|1682095_1685578_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.6	6.3e-209
AWL73875.1|1685595_1686195_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.1	6.0e-27
>prophage 127
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1695026	1695785	5416268		Flavobacterium_phage(100.0%)	1	NA	NA
AWL73884.1|1695026_1695785_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	7.9e-24
>prophage 128
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1707362	1708796	5416268	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWL73895.1|1707362_1708796_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.0e-24
>prophage 129
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1712765	1713110	5416268		Lake_Baikal_phage(100.0%)	1	NA	NA
AWL73900.1|1712765_1713110_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 130
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1719163	1719961	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL73905.1|1719163_1719961_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	7.1e-15
>prophage 131
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1742084	1748855	5416268	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AWL73924.1|1742084_1744514_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	8.7e-40
AWL73925.1|1744586_1745123_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWL73926.1|1745122_1745839_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWL73927.1|1746001_1746457_+	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
AWL73928.1|1746516_1747398_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWL73929.1|1747460_1748855_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.2e-25
>prophage 132
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1754260	1760883	5416268		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AWL73937.1|1754260_1755187_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	2.0e-21
AWL73938.1|1755365_1756028_+	carbonate dehydratase	NA	NA	NA	NA	NA
AWL73939.1|1756076_1756613_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AWL73940.1|1756816_1759207_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AWL73941.1|1759281_1760883_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	58.5	6.0e-21
>prophage 133
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1772376	1773801	5416268		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL73952.1|1772376_1773801_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 134
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1785127	1785691	5416268		Sphingobium_phage(100.0%)	1	NA	NA
AWL73960.1|1785127_1785691_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	8.2e-10
>prophage 135
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1789958	1791002	5416268		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWL73965.1|1789958_1791002_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.0	3.1e-103
>prophage 136
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1817195	1818920	5416268		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWL73991.1|1817195_1818920_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 137
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1839798	1840500	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL74010.1|1839798_1840500_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.7	2.1e-23
>prophage 138
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1846796	1852248	5416268		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
AWL74016.1|1846796_1849154_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	4.0e-13
AWL74017.1|1849341_1852248_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 139
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1864671	1866596	5416268		Pseudomonas_phage(50.0%)	2	NA	NA
AWL74029.1|1864671_1865520_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	50.0	5.2e-08
AWL74030.1|1866116_1866596_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	2.0e-28
>prophage 140
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1872936	1874085	5416268		Halovirus(100.0%)	1	NA	NA
AWL74035.1|1872936_1874085_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.2e-47
>prophage 141
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1892363	1893626	5416268		Oenococcus_phage(100.0%)	1	NA	NA
AWL74053.1|1892363_1893626_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	34.4	5.9e-56
>prophage 142
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1900534	1915951	5416268	tRNA	Tupanvirus(20.0%)	11	NA	NA
AWL77312.1|1900534_1903351_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	25.9	1.1e-75
AWL74061.1|1903394_1904333_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AWL74062.1|1904662_1904926_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWL74063.1|1905036_1905933_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AWL74064.1|1905987_1907163_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	1.7e-89
AWL74065.1|1907334_1908603_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWL77313.1|1908630_1909830_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AWL74066.1|1909929_1911423_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	30.3	7.0e-32
AWL74067.1|1911443_1912211_-	hypothetical protein	NA	NA	NA	NA	NA
AWL74068.1|1912813_1913947_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AWL74069.1|1914034_1915951_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	1.1e-146
>prophage 143
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1920348	1921302	5416268		Cyanophage(100.0%)	1	NA	NA
AWL74075.1|1920348_1921302_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 144
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1937747	1942907	5416268		Bacillus_phage(33.33%)	3	NA	NA
AWL77317.1|1937747_1939685_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
AWL74091.1|1939913_1941581_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.9e-41
AWL74092.1|1941674_1942907_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.6	3.3e-88
>prophage 145
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1949241	1950564	5416268		Geobacillus_virus(100.0%)	1	NA	NA
AWL74099.1|1949241_1950564_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	1.2e-78
>prophage 146
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1955293	1958014	5416268		Salmonella_phage(50.0%)	3	NA	NA
AWL74104.1|1955293_1955455_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
AWL74105.1|1955584_1956205_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWL74106.1|1956424_1958014_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 147
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1971231	1972511	5416268		Salmonella_phage(50.0%)	2	NA	NA
AWL74120.1|1971231_1971771_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
AWL74121.1|1971773_1972511_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.6e-64
>prophage 148
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	1975674	1978842	5416268	transposase	Sodalis_phage(50.0%)	3	NA	NA
AWL77320.1|1975674_1976613_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.3	5.9e-69
AWL74124.1|1976752_1977784_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AWL74125.1|1977780_1978842_-	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.4	5.0e-08
>prophage 149
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2020938	2021853	5416268	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWL74166.1|2020938_2021853_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	50.3	3.2e-72
>prophage 150
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2037449	2038949	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL74184.1|2037449_2038949_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	8.6e-14
>prophage 151
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2042845	2045590	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL74187.1|2042845_2045590_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	5.1e-20
>prophage 152
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2054695	2056811	5416268		Hokovirus(50.0%)	2	NA	NA
AWL74191.1|2054695_2056138_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.2	7.0e-13
AWL74192.1|2056127_2056811_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.0e-30
>prophage 153
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2060058	2065016	5416268		Leptospira_phage(33.33%)	4	NA	NA
AWL74195.1|2060058_2063208_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	2.0e-60
AWL74196.1|2063280_2063628_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AWL74197.1|2063637_2064171_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AWL74198.1|2064287_2065016_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 154
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2081764	2082969	5416268	transposase	Shigella_phage(100.0%)	1	NA	NA
AWL77325.1|2081764_2082969_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	1.9e-112
>prophage 155
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2087008	2092862	5416268	integrase	Bacillus_phage(50.0%)	3	2081461:2081475	2093390:2093404
2081461:2081475	attL	CGAAGGCCGGACTCG	NA	NA	NA	NA
AWL74218.1|2087008_2088682_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.3	1.2e-11
AWL74219.1|2089605_2091039_-	restriction endonuclease	NA	NA	NA	NA	NA
AWL74220.1|2091479_2092862_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	35.2	2.8e-51
2093390:2093404	attR	CGAAGGCCGGACTCG	NA	NA	NA	NA
>prophage 156
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2096311	2101137	5416268		Tupanvirus(50.0%)	5	NA	NA
AWL74224.1|2096311_2097331_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	4.9e-45
AWL77326.1|2097473_2098346_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWL74225.1|2098335_2099223_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWL74226.1|2099233_2100058_+	phosphodiesterase	NA	NA	NA	NA	NA
AWL74227.1|2100063_2101137_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.1e-21
>prophage 157
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2115840	2124894	5416268	tRNA	Klebsiella_phage(33.33%)	7	NA	NA
AWL74239.1|2115840_2117343_+	hypothetical protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	2.7e-84
AWL74240.1|2117393_2118476_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWL74241.1|2118475_2119573_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWL74242.1|2119562_2119682_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWL74243.1|2119962_2121474_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	5.4e-48
AWL74244.1|2121595_2122039_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWL74245.1|2122038_2124894_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	9.3e-142
>prophage 158
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2130378	2136438	5416268		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AWL74254.1|2130378_2131314_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
AWL74255.1|2131327_2131789_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWL74256.1|2131942_2132329_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AWL74257.1|2132402_2135111_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.4	1.8e-46
AWL74258.1|2135490_2136438_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	1.9e-11
>prophage 159
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2140079	2143363	5416268		Vibrio_phage(66.67%)	3	NA	NA
AWL74261.1|2140079_2142218_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	6.9e-267
AWL74262.1|2142613_2143078_+	anaerobic ribonucleotide reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	5.5e-52
AWL74263.1|2143081_2143363_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	58.5	4.5e-25
>prophage 160
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2159167	2165748	5416268		Klosneuvirus(33.33%)	6	NA	NA
AWL74282.1|2159167_2160166_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.3	1.6e-69
AWL74283.1|2160210_2161209_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWL74284.1|2161195_2162221_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL74285.1|2162231_2163734_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AWL74286.1|2163857_2164814_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL74287.1|2165217_2165748_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 161
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2185273	2186098	5416268		Bordetella_phage(100.0%)	1	NA	NA
AWL74302.1|2185273_2186098_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 162
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2199494	2203844	5416268		Lactococcus_phage(50.0%)	3	NA	NA
AWL74318.1|2199494_2201933_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	4.9e-67
AWL74319.1|2201969_2202395_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL74320.1|2202545_2203844_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	1.3e-66
>prophage 163
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2209776	2213008	5416268		Wolbachia_phage(50.0%)	2	NA	NA
AWL74328.1|2209776_2211636_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	3.8e-59
AWL74329.1|2211646_2213008_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 164
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2217850	2218396	5416268		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWL74334.1|2217850_2218396_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 165
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2225733	2230926	5416268		Tupanvirus(33.33%)	6	NA	NA
AWL74340.1|2225733_2226711_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.4	4.7e-29
AWL74341.1|2226985_2228776_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	2.9e-16
AWL74342.1|2228768_2229503_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AWL74343.1|2229513_2229909_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
AWL74344.1|2229919_2230279_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AWL74345.1|2230392_2230926_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	47.8	1.1e-40
>prophage 166
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2241695	2247365	5416268		Bacillus_phage(33.33%)	5	NA	NA
AWL74357.1|2241695_2243822_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.8	1.2e-29
AWL74358.1|2243843_2244701_+	hypothetical protein	NA	NA	NA	NA	NA
AWL74359.1|2244774_2245128_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AWL74360.1|2245387_2247034_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AWL74361.1|2247071_2247365_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 167
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2267497	2271464	5416268		Escherichia_phage(50.0%)	5	NA	NA
AWL74374.1|2267497_2268181_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.8	2.3e-30
AWL74375.1|2268326_2269244_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AWL74376.1|2269243_2269549_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
AWL74377.1|2270126_2270498_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	63.2	5.4e-10
AWL74378.1|2270507_2271464_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	2.2e-143
>prophage 168
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2275827	2277330	5416268		Burkholderia_virus(100.0%)	1	NA	NA
AWL74382.1|2275827_2277330_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 169
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2282689	2284236	5416268		Bacillus_virus(50.0%)	2	NA	NA
AWL74389.1|2282689_2283448_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.2	3.3e-14
AWL74390.1|2283555_2284236_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
>prophage 170
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2289632	2291153	5416268		Pithovirus(100.0%)	1	NA	NA
AWL74396.1|2289632_2291153_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	8.8e-06
>prophage 171
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2295252	2302003	5416268		Escherichia_phage(50.0%)	4	NA	NA
AWL74401.1|2295252_2297400_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.2	4.5e-32
AWL74402.1|2297597_2298284_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AWL74403.1|2298318_2299632_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AWL74404.1|2300044_2302003_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.1	1.9e-90
>prophage 172
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2314280	2315630	5416268		Moraxella_phage(100.0%)	1	NA	NA
AWL74415.1|2314280_2315630_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 173
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2323163	2324195	5416268		Mycoplasma_phage(100.0%)	1	NA	NA
AWL74424.1|2323163_2324195_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	53.3	1.6e-19
>prophage 174
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2336172	2341486	5416268		Vibrio_phage(33.33%)	3	NA	NA
AWL74433.1|2336172_2337753_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.0	8.3e-07
AWL74434.1|2337881_2338406_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AWL74435.1|2338660_2341486_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 175
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2344670	2347197	5416268		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AWL74440.1|2344670_2345750_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	4.9e-27
AWL74441.1|2345781_2347197_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 176
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2353193	2353802	5416268		Lactococcus_phage(100.0%)	1	NA	NA
AWL74449.1|2353193_2353802_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	39.8	4.6e-14
>prophage 177
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2360886	2361996	5416268		Mycoplasma_phage(100.0%)	1	NA	NA
AWL74456.1|2360886_2361996_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 178
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2378496	2379300	5416268		Moumouvirus(100.0%)	1	NA	NA
AWL74474.1|2378496_2379300_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.2	1.3e-05
>prophage 179
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2385868	2389552	5416268		Dickeya_phage(100.0%)	1	NA	NA
AWL74482.1|2385868_2389552_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 180
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2403121	2404711	5416268		Prochlorococcus_phage(100.0%)	1	NA	NA
AWL74489.1|2403121_2404711_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	9.0e-70
>prophage 181
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2410131	2411895	5416268		Bacillus_phage(50.0%)	3	NA	NA
AWL74496.1|2410131_2410404_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
AWL74497.1|2410590_2411181_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWL74498.1|2411223_2411895_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.2	2.6e-18
>prophage 182
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2420385	2432760	5416268		Bacillus_phage(33.33%)	6	NA	NA
AWL77340.1|2420385_2421855_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.7e-12
AWL74508.1|2422027_2422333_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWL74509.1|2422336_2422654_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWL74510.1|2422697_2424038_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AWL74511.1|2424431_2428655_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	1.2e-68
AWL74512.1|2428731_2432760_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	4.0e-21
>prophage 183
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2436864	2439986	5416268		Tupanvirus(50.0%)	2	NA	NA
AWL74520.1|2436864_2438049_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AWL77341.1|2439035_2439986_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	3.5e-29
>prophage 184
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2449856	2450471	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL74525.1|2449856_2450471_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 185
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2459274	2462606	5416268		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWL74533.1|2459274_2460054_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
AWL74534.1|2460056_2460581_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWL74535.1|2460584_2460836_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AWL74536.1|2460965_2462606_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.9e-39
>prophage 186
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2474590	2478076	5416268	transposase	Sodalis_phage(50.0%)	3	NA	NA
AWL74548.1|2474590_2475523_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	1.2e-66
AWL74549.1|2475567_2476188_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AWL74550.1|2476249_2478076_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.0	1.9e-84
>prophage 187
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2481956	2485801	5416268		Bacillus_phage(50.0%)	3	NA	NA
AWL74555.1|2481956_2484119_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
AWL74556.1|2484182_2484899_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWL74557.1|2484898_2485801_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 188
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2502161	2508302	5416268		uncultured_marine_virus(20.0%)	6	NA	NA
AWL74572.1|2502161_2503292_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	1.5e-18
AWL74573.1|2503296_2503971_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWL74574.1|2503948_2504830_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	4.6e-108
AWL74575.1|2504848_2505916_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.2e-99
AWL74576.1|2505912_2507175_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.7	7.3e-22
AWL74577.1|2507171_2508302_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 189
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2512353	2517975	5416268		Indivirus(33.33%)	4	NA	NA
AWL74581.1|2512353_2512683_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
AWL74582.1|2513025_2514291_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
AWL74583.1|2514417_2515899_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AWL74584.1|2515950_2517975_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	8.4e-113
>prophage 190
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2526077	2527724	5416268		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL74593.1|2526077_2527724_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	5.3e-65
>prophage 191
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2537796	2539635	5416268		Acinetobacter_phage(100.0%)	1	NA	NA
AWL74599.1|2537796_2539635_-	vitamin B12/cobalamin outer membrane transporter	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 192
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2554270	2554933	5416268		Cyanophage(100.0%)	1	NA	NA
AWL74612.1|2554270_2554933_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	3.0e-27
>prophage 193
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2568522	2569857	5416268		Erwinia_phage(100.0%)	1	NA	NA
AWL74626.1|2568522_2569857_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 194
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2574359	2577888	5416268		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
AWL74631.1|2574359_2575058_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AWL74632.1|2575054_2576428_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	3.1e-10
AWL74633.1|2576520_2577195_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWL74634.1|2577267_2577888_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	7.1e-63
>prophage 195
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2586194	2587706	5416268		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWL74643.1|2586194_2587706_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.9	3.3e-13
>prophage 196
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2617615	2618533	5416268		Pandoravirus(100.0%)	1	NA	NA
AWL74673.1|2617615_2618533_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.6	4.6e-18
>prophage 197
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2628617	2631085	5416268		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AWL74683.1|2628617_2629667_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
AWL74684.1|2629675_2631085_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 198
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2634990	2637783	5416268		uncultured_virus(100.0%)	1	NA	NA
AWL74689.1|2634990_2637783_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.3	1.9e-70
>prophage 199
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2652237	2658116	5416268		Enterobacteria_phage(33.33%)	5	NA	NA
AWL74700.1|2652237_2653128_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.8	1.1e-05
AWL74701.1|2653155_2654121_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWL74702.1|2654126_2655632_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.5	1.1e-19
AWL74703.1|2655642_2656062_-	D-ribose pyranase	NA	NA	NA	NA	NA
AWL74704.1|2656247_2658116_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	6.4e-67
>prophage 200
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2674625	2682188	5416268		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AWL74721.1|2674625_2675996_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.1	8.1e-35
AWL74722.1|2676182_2678012_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	41.6	1.9e-124
AWL74723.1|2678351_2679392_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AWL74724.1|2679519_2680479_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AWL74725.1|2680478_2681369_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWL74726.1|2681414_2682188_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
>prophage 201
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2687275	2688613	5416268		Moraxella_phage(100.0%)	1	NA	NA
AWL74732.1|2687275_2688613_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.3	3.1e-63
>prophage 202
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2696033	2703564	5416268		Staphylococcus_phage(33.33%)	7	NA	NA
AWL74740.1|2696033_2696291_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
AWL74741.1|2696254_2696614_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AWL74742.1|2696629_2696770_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWL74743.1|2697391_2698795_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWL74744.1|2698799_2699900_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
AWL74745.1|2700047_2701121_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWL74746.1|2701149_2703564_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	6.3e-115
>prophage 203
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2708899	2709858	5416268		Cyanophage(50.0%)	2	NA	NA
AWL77346.1|2708899_2709313_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AWL74752.1|2709429_2709858_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.0e-16
>prophage 204
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2720833	2726269	5416268		Salmonella_phage(50.0%)	7	NA	NA
AWL74763.1|2720833_2722018_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	6.4e-12
AWL74764.1|2722193_2723027_-	EamA family transporter	NA	NA	NA	NA	NA
AWL74765.1|2723093_2723540_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL74766.1|2723630_2723720_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AWL74767.1|2723955_2724207_-	hypothetical protein	NA	NA	NA	NA	NA
AWL74768.1|2724380_2724476_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWL74769.1|2724580_2726269_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	7.6e-59
>prophage 205
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2738409	2739522	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL74783.1|2738409_2739522_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	5.6e-26
>prophage 206
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2758024	2759188	5416268		Salmonella_phage(100.0%)	1	NA	NA
AWL74802.1|2758024_2759188_-	MFS transporter	NA	S4TR35	Salmonella_phage	26.3	1.9e-24
>prophage 207
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2776577	2777627	5416268		Tupanvirus(100.0%)	1	NA	NA
AWL74821.1|2776577_2777627_-	zinc-binding dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	5.7e-73
>prophage 208
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2787288	2788680	5416268		environmental_Halophage(100.0%)	1	NA	NA
AWL74832.1|2787288_2788680_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 209
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2791919	2792771	5416268		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWL74835.1|2791919_2792771_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	9.9e-15
>prophage 210
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2803935	2808966	5416268		Bordetella_phage(33.33%)	4	NA	NA
AWL74847.1|2803935_2806056_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AWL74848.1|2806074_2806350_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWL74849.1|2806404_2807028_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AWL74850.1|2807286_2808966_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.5	7.1e-25
>prophage 211
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2814353	2819031	5416268		Xanthomonas_phage(25.0%)	7	NA	NA
AWL74857.1|2814353_2814809_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
AWL77349.1|2814789_2816004_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	2.1e-42
AWL74858.1|2816176_2816842_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AWL74859.1|2817058_2817295_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWL74860.1|2817315_2817483_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWL74861.1|2817618_2818428_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	1.7e-24
AWL74862.1|2818551_2819031_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.9	2.8e-27
>prophage 212
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2831799	2840959	5416268		Prochlorococcus_phage(20.0%)	9	NA	NA
AWL74873.1|2831799_2832732_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	6.5e-36
AWL74874.1|2832945_2834139_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	6.4e-36
AWL74875.1|2834151_2835177_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AWL74876.1|2835346_2836135_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWL74877.1|2836140_2837097_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWL74878.1|2837100_2838372_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	2.7e-08
AWL74879.1|2838381_2839926_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWL74880.1|2840171_2840603_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWL74881.1|2840707_2840959_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 213
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2856811	2858653	5416268	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWL74897.1|2856811_2858653_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	2.4e-13
>prophage 214
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2871014	2872556	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL74907.1|2871014_2872556_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 215
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2878026	2879022	5416268		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWL74913.1|2878026_2879022_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.2	1.1e-09
>prophage 216
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2883399	2885330	5416268		Tupanvirus(50.0%)	2	NA	NA
AWL74918.1|2883399_2885019_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	25.2	1.2e-24
AWL74919.1|2885117_2885330_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 217
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2894863	2897603	5416268		Escherichia_phage(50.0%)	2	NA	NA
AWL74931.1|2894863_2897194_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.2	1.5e-68
AWL74932.1|2897162_2897603_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	2.3e-15
>prophage 218
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2907690	2913654	5416268		Planktothrix_phage(33.33%)	5	NA	NA
AWL74941.1|2907690_2908674_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	3.9e-15
AWL74942.1|2908670_2909684_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AWL74943.1|2910198_2910729_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AWL74944.1|2910719_2911523_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AWL74945.1|2911542_2913654_+	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 219
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2958654	2960697	5416268		Indivirus(100.0%)	1	NA	NA
AWL74973.1|2958654_2960697_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.2	4.6e-42
>prophage 220
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2972863	2977752	5416268		Bacillus_virus(66.67%)	6	NA	NA
AWL74984.1|2972863_2973817_-	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.5	5.6e-35
AWL77359.1|2974152_2974428_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL74985.1|2974462_2975476_-	magnesium transporter	NA	NA	NA	NA	NA
AWL74986.1|2975813_2976212_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AWL74987.1|2976199_2976991_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.6	1.8e-15
AWL74988.1|2976987_2977752_-	nickel import ATP-binding protein NikD	NA	G3M9Y6	Bacillus_virus	27.6	6.8e-07
>prophage 221
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	2983092	2987199	5416268		Tupanvirus(66.67%)	3	NA	NA
AWL74993.1|2983092_2984232_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.1	8.5e-30
AWL74994.1|2984233_2985217_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.7	5.6e-38
AWL74995.1|2985213_2987199_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 222
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3009486	3014232	5416268		Dickeya_phage(50.0%)	4	NA	NA
AWL75022.1|3009486_3010152_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.3	4.3e-58
AWL75023.1|3010358_3010604_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
AWL75024.1|3011316_3013527_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	4.9e-114
AWL75025.1|3013605_3014232_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
>prophage 223
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3017325	3023119	5416268		Staphylococcus_phage(25.0%)	5	NA	NA
AWL75030.1|3017325_3017994_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.0e-14
AWL75031.1|3017986_3019042_+	cell division protein FtsX	NA	NA	NA	NA	NA
AWL75032.1|3019311_3020166_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AWL75033.1|3020211_3021735_-	decarboxylase	NA	A0A1X9I5H2	Streptococcus_phage	26.1	1.1e-13
AWL75034.1|3021853_3023119_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
>prophage 224
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3032277	3033760	5416268		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AWL75042.1|3032277_3033045_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.6e-14
AWL75043.1|3033046_3033760_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
>prophage 225
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3037185	3038993	5416268		Planktothrix_phage(50.0%)	2	NA	NA
AWL75047.1|3037185_3038256_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
AWL75048.1|3038252_3038993_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.4	1.4e-09
>prophage 226
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3056852	3059300	5416268		Dickeya_phage(100.0%)	1	NA	NA
AWL75063.1|3056852_3059300_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 227
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3062374	3063133	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL75067.1|3062374_3063133_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 228
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3066478	3068869	5416268		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWL75069.1|3066478_3068869_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.4e-13
>prophage 229
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3081702	3085474	5416268		Bacillus_phage(66.67%)	3	NA	NA
AWL75081.1|3081702_3082422_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AWL75082.1|3082418_3083774_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
AWL75083.1|3083851_3085474_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.9	1.7e-140
>prophage 230
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3100296	3101124	5416268		Vibrio_phage(100.0%)	1	NA	NA
AWL75097.1|3100296_3101124_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.4	9.4e-71
>prophage 231
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3112527	3122163	5416268		Acinetobacter_phage(25.0%)	10	NA	NA
AWL75109.1|3112527_3113091_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.9	4.0e-57
AWL75110.1|3113180_3114401_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWL75111.1|3114390_3116469_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	3.1e-62
AWL75112.1|3116520_3117153_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWL77364.1|3117311_3117500_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75113.1|3117459_3117864_+	OsmC family protein	NA	NA	NA	NA	NA
AWL75114.1|3117919_3118789_-	phosphoribulokinase	NA	NA	NA	NA	NA
AWL75115.1|3118825_3119044_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AWL75116.1|3119040_3120063_-	hydrolase	NA	NA	NA	NA	NA
AWL75117.1|3120258_3122163_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	6.5e-75
>prophage 232
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3130014	3133383	5416268		Streptococcus_phage(50.0%)	2	NA	NA
AWL75130.1|3130014_3132129_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.4e-57
AWL75131.1|3132198_3133383_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 233
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3153284	3154756	5416268	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AWL75169.1|3153284_3154232_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.9e-07
AWL75170.1|3154246_3154756_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.1e-18
>prophage 234
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3182193	3183237	5416268		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL75193.1|3182193_3183237_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 235
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3200946	3202314	5416268	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWL75210.1|3200946_3202314_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 236
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3206261	3206756	5416268	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AWL75216.1|3206261_3206756_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 237
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3214203	3215139	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL75220.1|3214203_3215139_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.2	5.7e-16
>prophage 238
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3219078	3232009	5416268		Hokovirus(16.67%)	16	NA	NA
AWL75223.1|3219078_3221418_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	2.1e-38
AWL75224.1|3221651_3222305_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWL75225.1|3222301_3223027_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWL75226.1|3223090_3223363_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWL75227.1|3223359_3224214_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AWL75228.1|3224259_3224748_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWL75229.1|3224818_3225106_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AWL75230.1|3225128_3226562_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWL75231.1|3226609_3227335_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AWL75232.1|3227341_3227887_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWL75233.1|3227855_3228431_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWL75234.1|3228427_3228994_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	1.8e-57
AWL75235.1|3229008_3229995_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.9e-39
AWL75236.1|3230009_3230987_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWL75237.1|3231001_3231205_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75238.1|3231196_3232009_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 239
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3236057	3237499	5416268		Vibrio_phage(50.0%)	2	NA	NA
AWL75245.1|3236057_3236330_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	65.1	8.3e-16
AWL75246.1|3236527_3237499_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	7.8e-08
>prophage 240
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3244098	3246978	5416268	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AWL75255.1|3244098_3246033_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
AWL75256.1|3246129_3246978_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	7.8e-20
>prophage 241
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3251253	3257872	5416268		Dickeya_phage(50.0%)	4	NA	NA
AWL75261.1|3251253_3252597_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AWL75262.1|3253189_3253642_+	ribosome maturation factor	NA	NA	NA	NA	NA
AWL75263.1|3253669_3255157_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWL75264.1|3255181_3257872_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 242
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3263285	3265217	5416268		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWL75272.1|3263285_3265217_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 243
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3282088	3289963	5416268		Peridroma_alphabaculovirus(25.0%)	10	NA	NA
AWL77370.1|3282088_3282373_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	55.4	7.3e-15
AWL75292.1|3282428_3282872_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75293.1|3282833_3283370_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.2e-10
AWL75294.1|3283498_3284146_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75295.1|3284221_3285262_+	permease	NA	NA	NA	NA	NA
AWL75296.1|3285382_3285958_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWL75297.1|3285967_3286558_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AWL75298.1|3286583_3286970_-	YraN family protein	NA	NA	NA	NA	NA
AWL75299.1|3286927_3289036_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWL75300.1|3289099_3289963_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.0	2.4e-48
>prophage 244
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3312534	3313506	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL75325.1|3312534_3313506_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	2.0e-35
>prophage 245
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3323094	3324582	5416268		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL75334.1|3323094_3324582_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	27.8	1.7e-09
>prophage 246
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3328890	3330270	5416268		Klosneuvirus(100.0%)	1	NA	NA
AWL75340.1|3328890_3330270_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	4.2e-31
>prophage 247
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3348295	3354311	5416268		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AWL75357.1|3348295_3349099_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	4.9e-16
AWL75358.1|3349167_3349473_-	acid-resistance protein	NA	NA	NA	NA	NA
AWL75359.1|3349499_3350075_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AWL75360.1|3350345_3350978_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75361.1|3351068_3354311_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.2	1.7e-30
>prophage 248
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3359981	3434517	5416268	holin,tail,integrase,lysis,portal,plate,head,capsid,terminase,tRNA	Salmonella_phage(56.63%)	96	3359851:3359895	3428327:3428371
3359851:3359895	attL	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWL75366.1|3359981_3361019_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
AWL75367.1|3361025_3361610_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
AWL75368.1|3361729_3361951_+	regulator	NA	NA	NA	NA	NA
AWL75369.1|3361981_3362491_+	hypothetical protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
AWL75370.1|3362498_3362699_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
AWL75371.1|3362662_3363001_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
AWL75372.1|3363069_3363297_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
AWL75373.1|3363296_3363518_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	86.3	2.0e-28
AWL75374.1|3363518_3363800_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
AWL75375.1|3363792_3365799_+	replication protein	NA	A0A218M4H2	Erwinia_phage	90.5	0.0e+00
AWL75376.1|3367432_3368158_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75377.1|3368480_3369524_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	1.3e-165
AWL75378.1|3369523_3371293_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
AWL75379.1|3371458_3372313_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	2.1e-126
AWL75380.1|3372386_3373445_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	3.2e-164
AWL75381.1|3373448_3374192_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	80.3	5.1e-100
AWL75382.1|3374288_3374795_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	2.1e-60
AWL75383.1|3374794_3374998_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AWL75384.1|3375002_3375293_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
AWL75385.1|3375279_3375777_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	87.0	4.3e-79
AWL75386.1|3375773_3376205_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
AWL75387.1|3376300_3376768_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	1.4e-63
AWL75388.1|3376760_3377219_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	2.0e-46
AWL75389.1|3377243_3378497_-	HNH endonuclease	NA	NA	NA	NA	NA
AWL75390.1|3378696_3379338_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	2.6e-92
AWL75391.1|3379334_3379682_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	2.0e-43
AWL75392.1|3379686_3380595_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	2.4e-112
AWL75393.1|3380587_3381184_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	49.1	1.2e-46
AWL75394.1|3381233_3383273_+|tail	phage tail protein	tail	S4TP40	Salmonella_phage	41.5	2.5e-08
AWL75395.1|3383280_3383520_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75396.1|3383556_3384714_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.8	3.6e-44
AWL75397.1|3384824_3386006_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.4	1.8e-195
AWL75398.1|3386019_3386535_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AWL75399.1|3386595_3386871_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	2.4e-31
AWL75400.1|3386885_3387023_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AWL75401.1|3387015_3389454_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	69.9	4.6e-283
AWL75402.1|3389470_3389950_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
AWL75403.1|3389949_3391110_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
AWL75404.1|3391658_3391877_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	83.3	6.6e-32
AWL75405.1|3392223_3393696_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75406.1|3393698_3394712_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	60.5	1.8e-116
AWL75407.1|3394714_3394897_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	55.9	4.5e-10
AWL75408.1|3394938_3395553_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	44.6	1.6e-38
AWL75409.1|3395654_3395891_+	regulator	NA	NA	NA	NA	NA
AWL75410.1|3395997_3396261_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	1.0e-39
AWL75411.1|3396289_3396799_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	87.0	7.6e-79
AWL75412.1|3396806_3397031_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	74.3	3.6e-25
AWL75413.1|3397020_3397221_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	75.4	1.8e-23
AWL75414.1|3397290_3397524_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	59.7	1.4e-16
AWL75415.1|3397523_3397751_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	78.7	4.6e-28
AWL75416.1|3397747_3398605_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.5	4.8e-118
AWL75417.1|3398647_3400951_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.9	6.8e-268
AWL75418.1|3401102_3401798_+	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	73.7	3.3e-93
AWL75419.1|3401957_3402146_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
AWL75420.1|3402156_3402390_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
AWL75421.1|3402463_3402724_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	64.1	2.8e-21
AWL75422.1|3402988_3403963_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	8.0e-53
AWL75423.1|3403962_3404301_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AWL75424.1|3404346_3405378_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.9	1.5e-174
AWL75425.1|3405377_3407141_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.8	0.0e+00
AWL75426.1|3407281_3408115_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.2	5.2e-101
AWL75427.1|3408131_3409196_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	3.3e-185
AWL75428.1|3409199_3409850_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AWL75429.1|3409946_3410411_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	1.6e-75
AWL75430.1|3410410_3410614_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AWL75431.1|3410617_3410833_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	2.3e-29
AWL75432.1|3410813_3411323_+	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	84.0	2.8e-81
AWL75433.1|3411327_3411711_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	43.7	1.2e-17
AWL75434.1|3411707_3412136_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	78.7	9.6e-51
AWL75435.1|3412231_3412663_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	5.8e-64
AWL75436.1|3412655_3413102_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.1	3.3e-54
AWL75437.1|3413098_3413752_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75438.1|3413947_3414151_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.9	3.4e-22
AWL75439.1|3414113_3414545_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.8	6.4e-63
AWL75440.1|3415053_3415626_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.7e-77
AWL75441.1|3415622_3415985_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AWL75442.1|3415971_3416880_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	2.6e-106
AWL75443.1|3416872_3417469_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.8	1.3e-50
AWL75444.1|3417518_3419558_+|tail	phage tail protein	tail	S4TP40	Salmonella_phage	40.2	5.6e-08
AWL75445.1|3419565_3419805_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75446.1|3419841_3420999_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.4	2.3e-43
AWL75447.1|3421137_3422310_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
AWL75448.1|3422319_3422835_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWL75449.1|3422887_3423187_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AWL75450.1|3423201_3423321_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL75451.1|3423313_3425941_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	4.3e-117
AWL75452.1|3425937_3426423_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AWL75453.1|3426419_3427517_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
AWL75454.1|3427587_3427806_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	8.3e-27
AWL75455.1|3427812_3428199_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75456.1|3428526_3429033_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
3428327:3428371	attR	TGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWL75457.1|3429132_3430974_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWL75458.1|3431193_3432939_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	3.5e-75
AWL75459.1|3433050_3433266_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWL75460.1|3433264_3433495_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75461.1|3433503_3434517_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 249
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3443809	3445051	5416268		Sinorhizobium_phage(100.0%)	1	NA	NA
AWL75474.1|3443809_3445051_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.1	2.3e-89
>prophage 250
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3450162	3457042	5416268		uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AWL75477.1|3450162_3451596_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	30.0	5.1e-40
AWL75478.1|3451631_3451823_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75479.1|3451814_3452012_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AWL75480.1|3452046_3452319_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75481.1|3452696_3453350_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	6.3e-46
AWL75482.1|3453413_3454184_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AWL75483.1|3454370_3455162_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWL75484.1|3455204_3456365_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.4	1.8e-88
AWL75485.1|3456370_3457042_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
>prophage 251
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3461375	3463271	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL75491.1|3461375_3463271_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	8.5e-91
>prophage 252
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3466583	3475962	5416268		Stx_converting_phage(25.0%)	7	NA	NA
AWL75496.1|3466583_3466991_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	39.7	4.3e-16
AWL75497.1|3467068_3467938_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL75498.1|3468058_3470317_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.9	1.2e-83
AWL75499.1|3470508_3471246_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AWL75500.1|3471329_3472742_+	cell division protein FtsP	NA	NA	NA	NA	NA
AWL75501.1|3472864_3475048_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
AWL75502.1|3475134_3475962_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.0	1.8e-61
>prophage 253
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3492223	3493594	5416268		Lactococcus_phage(100.0%)	1	NA	NA
AWL77377.1|3492223_3493594_-	CBS domain-containing protein	NA	A0A1W6JIM2	Lactococcus_phage	37.3	5.1e-45
>prophage 254
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3499099	3500182	5416268		Geobacillus_virus(100.0%)	1	NA	NA
AWL75524.1|3499099_3500182_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 255
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3519456	3520611	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL75547.1|3519456_3520611_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
>prophage 256
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3537922	3539155	5416268		Catovirus(100.0%)	1	NA	NA
AWL75560.1|3537922_3539155_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	3.1e-102
>prophage 257
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3547038	3549912	5416268		Prochlorococcus_phage(100.0%)	1	NA	NA
AWL75569.1|3547038_3549912_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	9.7e-264
>prophage 258
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3554510	3555944	5416268		Pandoravirus(100.0%)	1	NA	NA
AWL75575.1|3554510_3555944_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.7e-33
>prophage 259
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3560646	3568516	5416268	tRNA	Brevibacillus_phage(20.0%)	7	NA	NA
AWL75583.1|3560646_3561543_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
AWL75584.1|3561565_3562279_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWL75585.1|3562284_3564018_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	1.1e-60
AWL75586.1|3564103_3565201_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AWL75587.1|3565211_3566729_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	2.9e-86
AWL75588.1|3566932_3567487_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWL75589.1|3567802_3568516_+	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 260
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3573793	3577926	5416268		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AWL75595.1|3573793_3574123_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	55.1	6.5e-23
AWL77382.1|3574174_3575467_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.3	8.7e-164
AWL75596.1|3575476_3575899_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	7.0e-46
AWL75597.1|3576372_3577926_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	2.5e-157
>prophage 261
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3591413	3593080	5416268	integrase	Escherichia_phage(100.0%)	2	3589923:3589935	3595532:3595544
3589923:3589935	attL	GGCAGCTGCTGGC	NA	NA	NA	NA
AWL75610.1|3591413_3592022_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	52.9	1.0e-50
AWL75611.1|3592474_3593080_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	9.4e-52
3595532:3595544	attR	GCCAGCAGCTGCC	NA	NA	NA	NA
>prophage 262
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3613878	3617350	5416268		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
AWL75632.1|3613878_3614640_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	2.2e-18
AWL75633.1|3614936_3616358_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	1.9e-23
AWL75634.1|3616354_3617350_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.6	4.0e-15
>prophage 263
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3623113	3624241	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL75638.1|3623113_3624241_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	6.1e-12
>prophage 264
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3629955	3630966	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL75647.1|3629955_3630966_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 265
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3636942	3648956	5416268		Staphylococcus_phage(25.0%)	12	NA	NA
AWL75653.1|3636942_3639102_+	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.4	4.9e-18
AWL75654.1|3639094_3640288_+	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AWL75655.1|3640486_3641527_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AWL75656.1|3641748_3641967_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AWL75657.1|3642090_3642804_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	2.0e-45
AWL75658.1|3642867_3643563_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AWL75659.1|3643579_3643792_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75660.1|3644023_3644206_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75661.1|3644245_3644776_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWL75662.1|3644788_3647035_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	7.3e-09
AWL75663.1|3647279_3648155_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWL75664.1|3648161_3648956_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	64.4	3.6e-120
>prophage 266
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3654473	3665753	5416268		Hokovirus(25.0%)	5	NA	NA
AWL75669.1|3654473_3657359_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.7	1.5e-43
AWL75670.1|3657355_3660892_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.5	5.7e-08
AWL75671.1|3660888_3662733_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	25.3	1.5e-20
AWL75672.1|3662941_3664273_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AWL75673.1|3664499_3665753_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 267
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3698648	3699464	5416268		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWL75712.1|3698648_3699464_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 268
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3704453	3707037	5416268	tRNA	Pandoravirus(50.0%)	3	NA	NA
AWL75717.1|3704453_3705263_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.5e-15
AWL75718.1|3705394_3705832_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWL75719.1|3705831_3707037_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	1.2e-69
>prophage 269
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3718575	3719331	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL75730.1|3718575_3719331_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.3e-10
>prophage 270
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3725735	3726758	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL75735.1|3725735_3726758_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	3.8e-13
>prophage 271
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3736988	3737834	5416268		Vibrio_phage(100.0%)	1	NA	NA
AWL75743.1|3736988_3737834_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	36.7	7.2e-42
>prophage 272
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3745249	3750786	5416268		Streptococcus_phage(33.33%)	3	NA	NA
AWL75751.1|3745249_3746389_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.1e-48
AWL75752.1|3746618_3749369_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.1	8.3e-47
AWL75753.1|3749481_3750786_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.6	8.0e-32
>prophage 273
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3754328	3759668	5416268		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
AWL75756.1|3754328_3755966_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.4e-153
AWL75757.1|3756047_3757346_+	enolase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AWL75758.1|3757409_3758519_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AWL75759.1|3758996_3759668_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	5.0e-14
>prophage 274
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3768430	3770463	5416268		Hokovirus(50.0%)	2	NA	NA
AWL75767.1|3768430_3769858_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	2.5e-34
AWL75768.1|3769857_3770463_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 275
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3773533	3779947	5416268		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AWL75774.1|3773533_3774295_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.2	1.0e-58
AWL75775.1|3774288_3774915_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.0	1.4e-34
AWL75776.1|3775040_3776171_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
AWL75777.1|3776329_3777322_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AWL75778.1|3777374_3777752_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AWL75779.1|3777748_3778951_-	MFS transporter	NA	NA	NA	NA	NA
AWL75780.1|3779059_3779947_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.8	1.8e-06
>prophage 276
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3783505	3788040	5416268		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AWL75786.1|3783505_3786067_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	5.0e-30
AWL75787.1|3787260_3788040_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.9	1.4e-12
>prophage 277
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3795989	3796811	5416268		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL75795.1|3795989_3796811_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.8e-14
>prophage 278
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3807180	3808581	5416268		Pandoravirus(100.0%)	1	NA	NA
AWL75805.1|3807180_3808581_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	28.3	1.5e-44
>prophage 279
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3836816	3837764	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL75832.1|3836816_3837764_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	34.7	2.7e-29
>prophage 280
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3842862	3843828	5416268		Tetraselmis_virus(100.0%)	1	NA	NA
AWL75837.1|3842862_3843828_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	1.4e-36
>prophage 281
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3849600	3857807	5416268	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
AWL75846.1|3849600_3850278_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.5e-07
AWL75847.1|3850274_3851138_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AWL77392.1|3851145_3852024_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL75848.1|3852162_3852660_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	3.7e-30
AWL75849.1|3852750_3853809_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
AWL75850.1|3853879_3854380_+	recombination regulator RecX	NA	NA	NA	NA	NA
AWL75851.1|3854630_3857258_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.7	3.5e-79
AWL75852.1|3857329_3857512_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75853.1|3857621_3857807_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 282
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3872689	3877988	5416268		Bacillus_virus(20.0%)	5	NA	NA
AWL75868.1|3872689_3873892_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
AWL75869.1|3874248_3875211_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.6	5.5e-131
AWL75870.1|3875221_3877363_-	ribonucleotide-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.8	8.1e-191
AWL75871.1|3877335_3877746_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A0N9RZU5	Staphylococcus_phage	29.8	2.3e-09
AWL75872.1|3877742_3877988_-	NrdH-redoxin	NA	A0A0K2QRD6	Ralstonia_phage	40.0	2.6e-05
>prophage 283
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3883158	3884061	5416268		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL75880.1|3883158_3884061_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.7	3.7e-36
>prophage 284
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3901958	3903479	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL75896.1|3901958_3903479_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	5.0e-17
>prophage 285
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3942739	3945098	5416268		Oenococcus_phage(50.0%)	2	NA	NA
AWL75930.1|3942739_3943993_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	30.5	4.6e-45
AWL75931.1|3944330_3945098_+	gluconate 5-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	28.6	3.2e-20
>prophage 286
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3950394	3960899	5416268	integrase	Enterobacteria_phage(71.43%)	10	3943363:3943377	3962928:3962942
3943363:3943377	attL	GCAGGTGGTCGAACA	NA	NA	NA	NA
AWL75936.1|3950394_3952728_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
AWL75937.1|3952742_3953063_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75938.1|3953059_3953287_-	hypothetical protein	NA	NA	NA	NA	NA
AWL75939.1|3953283_3953835_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	72.2	6.6e-36
AWL75940.1|3954638_3955376_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.7	9.9e-80
AWL75941.1|3955372_3955633_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	67.9	6.4e-26
AWL75942.1|3955632_3956196_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	60.7	8.4e-55
AWL75943.1|3956567_3958463_+	hypothetical protein	NA	NA	NA	NA	NA
AWL75944.1|3958534_3959725_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.1e-103
AWL75945.1|3960416_3960899_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3962928:3962942	attR	TGTTCGACCACCTGC	NA	NA	NA	NA
>prophage 287
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3976225	3977296	5416268		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWL75964.1|3976225_3977296_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.8e-91
>prophage 288
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3984086	3986660	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL75972.1|3984086_3986660_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
>prophage 289
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3992573	3993872	5416268		Burkholderia_virus(100.0%)	1	NA	NA
AWL75973.1|3992573_3993872_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	1.4e-44
>prophage 290
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	3999170	4003702	5416268	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
AWL75978.1|3999170_3999596_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AWL75979.1|3999799_4000885_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWL75980.1|4000940_4001630_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.5	1.1e-56
AWL75981.1|4001941_4002325_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AWL75982.1|4002370_4003702_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.6	5.3e-47
>prophage 291
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4009472	4031540	5416268	tRNA	Bacillus_phage(25.0%)	20	NA	NA
AWL75989.1|4009472_4011272_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
AWL75990.1|4011287_4012262_+	signal peptidase I	NA	NA	NA	NA	NA
AWL75991.1|4012511_4013192_+	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AWL75992.1|4013188_4014094_+	GTPase Era	NA	NA	NA	NA	NA
AWL75993.1|4014105_4014843_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWL75994.1|4014854_4015586_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWL75995.1|4015585_4015966_+	holo-ACP synthase	NA	NA	NA	NA	NA
AWL75996.1|4015978_4016239_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AWL75997.1|4016295_4017144_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWL75998.1|4017355_4017991_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AWL75999.1|4018020_4018563_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.0e-05
AWL76000.1|4018559_4020176_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AWL76001.1|4020351_4024239_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AWL76002.1|4024830_4026252_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	2.4e-13
AWL76003.1|4026260_4026968_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWL76004.1|4026954_4028292_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.2	8.8e-10
AWL76005.1|4028357_4028696_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AWL76006.1|4028770_4029961_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWL76007.1|4030001_4030268_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76008.1|4030286_4031540_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 292
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4044458	4050816	5416268		Faustovirus(20.0%)	8	NA	NA
AWL76023.1|4044458_4045673_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
AWL76024.1|4045699_4046086_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AWL76025.1|4046103_4046427_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AWL76026.1|4046501_4047017_+	co-chaperone HscB	NA	NA	NA	NA	NA
AWL76027.1|4047032_4048883_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.7	3.8e-104
AWL76028.1|4048884_4049220_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWL76029.1|4049221_4049422_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWL76030.1|4049529_4050816_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.5	4.9e-34
>prophage 293
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4062013	4062445	5416268		Powai_lake_megavirus(100.0%)	1	NA	NA
AWL76036.1|4062013_4062445_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 294
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4072695	4075712	5416268		Bodo_saltans_virus(50.0%)	2	NA	NA
AWL76046.1|4072695_4074087_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	36.2	1.1e-39
AWL76047.1|4074245_4075712_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
>prophage 295
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4079149	4082328	5416268		Powai_lake_megavirus(50.0%)	4	NA	NA
AWL77400.1|4079149_4079875_+	KR domain-containing protein	NA	A0A167REC2	Powai_lake_megavirus	35.1	3.5e-05
AWL76052.1|4079871_4081053_-	MFS transporter	NA	NA	NA	NA	NA
AWL76053.1|4081151_4082039_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL76054.1|4082136_4082328_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	81.0	8.6e-20
>prophage 296
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4088739	4090415	5416268		Prochlorococcus_phage(100.0%)	2	NA	NA
AWL76058.1|4088739_4089381_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AWL76059.1|4089377_4090415_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.8e-71
>prophage 297
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4093950	4096957	5416268	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AWL76064.1|4093950_4095237_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AWL76065.1|4095335_4096037_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWL76066.1|4096033_4096957_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.9	3.9e-73
>prophage 298
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4103615	4104329	5416268		Cyanophage(100.0%)	1	NA	NA
AWL76074.1|4103615_4104329_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 299
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4124144	4127721	5416268		Paenibacillus_phage(50.0%)	5	NA	NA
AWL76089.1|4124144_4125017_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	1.7e-17
AWL76090.1|4125228_4125654_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWL76091.1|4125640_4126090_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76092.1|4126151_4126727_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWL76093.1|4126821_4127721_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	33.1	1.7e-25
>prophage 300
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4131010	4133135	5416268		Bacillus_virus(50.0%)	2	NA	NA
AWL76097.1|4131010_4132105_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
AWL76098.1|4132223_4133135_+	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	39.9	3.1e-51
>prophage 301
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4136766	4146675	5416268		Hokovirus(25.0%)	9	NA	NA
AWL76104.1|4136766_4138494_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
AWL76105.1|4138538_4138796_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWL76106.1|4139176_4140148_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.6	8.8e-76
AWL76107.1|4140321_4141083_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWL77402.1|4141316_4142360_+	cell division protein ZipA	NA	NA	NA	NA	NA
AWL76108.1|4142429_4144445_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	4.0e-147
AWL76109.1|4144446_4144665_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76110.1|4144661_4145660_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AWL76111.1|4145748_4146675_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	5.3e-06
>prophage 302
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4161556	4164003	5416268		Clostridioides_phage(50.0%)	2	NA	NA
AWL77404.1|4161556_4162294_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	8.5e-15
AWL76121.1|4162305_4164003_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.7	2.3e-47
>prophage 303
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4167273	4173098	5416268		Pandoravirus(20.0%)	7	NA	NA
AWL76124.1|4167273_4167732_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	38.5	2.1e-11
AWL76125.1|4167864_4168773_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	3.5e-10
AWL76126.1|4168803_4169664_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	8.5e-06
AWL76127.1|4170031_4170514_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWL76128.1|4170785_4171052_-	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	42.9	6.6e-10
AWL76129.1|4171044_4171584_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76130.1|4172168_4173098_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	83.1	2.7e-135
>prophage 304
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4182208	4183294	5416268		Pandoravirus(100.0%)	1	NA	NA
AWL76139.1|4182208_4183294_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	2.2e-88
>prophage 305
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4191901	4193014	5416268		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL77408.1|4191901_4193014_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.9	2.7e-20
>prophage 306
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4199465	4200983	5416268		Mollivirus(100.0%)	1	NA	NA
AWL76153.1|4199465_4200983_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	7.7e-87
>prophage 307
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4205278	4206052	5416268		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL76159.1|4205278_4206052_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 308
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4218453	4219053	5416268		Salmonella_phage(100.0%)	1	NA	NA
AWL76172.1|4218453_4219053_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 309
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4252296	4253214	5416268	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWL76204.1|4252296_4253214_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.1	2.6e-69
>prophage 310
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4256338	4257544	5416268		Oenococcus_phage(100.0%)	1	NA	NA
AWL76208.1|4256338_4257544_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 311
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4265389	4277128	5416268		Pseudomonas_phage(33.33%)	8	NA	NA
AWL76215.1|4265389_4266460_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
AWL76216.1|4266531_4266786_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	4.1e-25
AWL76217.1|4266785_4267916_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AWL76218.1|4268017_4270303_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.4	6.2e-282
AWL76219.1|4270415_4270604_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76220.1|4270647_4271376_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AWL76221.1|4271522_4274156_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	6.0e-95
AWL76222.1|4274287_4277128_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	1.9e-41
>prophage 312
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4283617	4284682	5416268		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AWL76226.1|4283617_4284682_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.5	2.0e-17
>prophage 313
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4288601	4289750	5416268		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL77410.1|4288601_4289750_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	47.9	1.6e-76
>prophage 314
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4296120	4297128	5416268		Vibrio_phage(100.0%)	1	NA	NA
AWL76234.1|4296120_4297128_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 315
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4301364	4307450	5416268		Vibrio_phage(33.33%)	5	NA	NA
AWL76240.1|4301364_4303122_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.0	1.4e-100
AWL76241.1|4303269_4303989_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AWL76242.1|4303985_4305182_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.5	9.0e-22
AWL76243.1|4305512_4305857_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76244.1|4305860_4307450_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	1.1e-19
>prophage 316
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4313204	4317516	5416268		Clostridioides_phage(50.0%)	4	NA	NA
AWL76249.1|4313204_4313774_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	4.0e-12
AWL77412.1|4314200_4314908_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWL76250.1|4314951_4315929_-	GTP-binding protein	NA	NA	NA	NA	NA
AWL76251.1|4316049_4317516_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.5	1.7e-46
>prophage 317
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4327977	4328832	5416268		Catovirus(100.0%)	1	NA	NA
AWL76263.1|4327977_4328832_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	5.2e-24
>prophage 318
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4333035	4336929	5416268		Acinetobacter_phage(50.0%)	3	NA	NA
AWL76267.1|4333035_4335009_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	2.8e-12
AWL76268.1|4335066_4335900_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWL76269.1|4336260_4336929_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	4.5e-55
>prophage 319
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4340693	4342214	5416268		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL76273.1|4340693_4342214_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 320
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4359782	4360517	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL76289.1|4359782_4360517_-	SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	42.4	4.3e-51
>prophage 321
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4365431	4365986	5416268		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL76295.1|4365431_4365986_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 322
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4372520	4379568	5416268	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
AWL76300.1|4372520_4373468_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	5.8e-24
AWL76301.1|4373451_4374189_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWL76302.1|4374163_4374277_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76303.1|4374506_4376195_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.3	2.5e-259
AWL76304.1|4376188_4376908_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWL76305.1|4376955_4377426_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	73.1	2.3e-61
AWL76306.1|4377534_4379568_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	6.8e-54
>prophage 323
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4387404	4392262	5416268		Tetraselmis_virus(100.0%)	3	NA	NA
AWL76314.1|4387404_4389381_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	45.2	5.2e-160
AWL76315.1|4389582_4390218_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWL76316.1|4390285_4392262_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	2.4e-160
>prophage 324
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4406831	4411868	5416268		Bacillus_phage(50.0%)	4	NA	NA
AWL77417.1|4406831_4407725_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	7.9e-15
AWL76328.1|4407970_4409332_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.0	1.7e-205
AWL76329.1|4409652_4410375_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.3e-31
AWL76330.1|4410371_4411868_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.5e-29
>prophage 325
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4428993	4436003	5416268		Catovirus(25.0%)	5	NA	NA
AWL76340.1|4428993_4429635_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
AWL76341.1|4429725_4430307_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AWL76342.1|4430337_4432185_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWL76343.1|4432765_4434349_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	8.5e-36
AWL77420.1|4435112_4436003_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.3e-45
>prophage 326
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4451783	4468765	5416268		Hokovirus(22.22%)	13	NA	NA
AWL76356.1|4451783_4452485_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	37.1	1.9e-19
AWL76357.1|4452593_4454078_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWL76358.1|4455057_4456464_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AWL76359.1|4456689_4458105_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	4.0e-53
AWL76360.1|4458128_4459499_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
AWL76361.1|4459662_4460829_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
AWL76362.1|4461773_4462778_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.8e-31
AWL76363.1|4463013_4463202_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76364.1|4463289_4463574_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76365.1|4463854_4465270_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	4.0e-53
AWL76366.1|4465293_4466676_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.4	2.5e-31
AWL76367.1|4466681_4467467_+	O9 family O-antigen ABC transporter permease subunit Wzm	NA	NA	NA	NA	NA
AWL76368.1|4467469_4468765_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.4e-14
>prophage 327
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4481940	4482840	5416268		Cellulophaga_phage(100.0%)	1	NA	NA
AWL77421.1|4481940_4482840_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 328
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4496596	4498654	5416268		Faustovirus(50.0%)	2	NA	NA
AWL76392.1|4496596_4497799_-	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	28.4	4.6e-26
AWL76393.1|4497814_4498654_-	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.1	2.8e-22
>prophage 329
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4512022	4517244	5416268		Streptococcus_phage(50.0%)	3	NA	NA
AWL76404.1|4512022_4514125_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	1.4e-62
AWL76405.1|4514475_4515900_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AWL76406.1|4516074_4517244_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.2	8.4e-182
>prophage 330
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4532772	4533609	5416268		Mycobacterium_phage(100.0%)	1	NA	NA
AWL76426.1|4532772_4533609_+	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	29.2	2.8e-14
>prophage 331
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4540731	4544233	5416268		Vibrio_phage(50.0%)	4	NA	NA
AWL76433.1|4540731_4540953_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	3.2e-18
AWL77424.1|4540949_4541381_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76434.1|4541702_4542713_-	DUF4917 domain-containing protein	NA	NA	NA	NA	NA
AWL76435.1|4542997_4544233_+	DNA (cytosine-5-)-methyltransferase	NA	I6NLI4	Burkholderia_phage	46.6	1.1e-94
>prophage 332
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4548927	4555267	5416268		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWL76438.1|4548927_4554759_+	helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.6	5.6e-08
AWL76439.1|4554853_4555267_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	48.8	1.9e-32
>prophage 333
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4571107	4579550	5416268		Burkholderia_phage(40.0%)	8	NA	NA
AWL76452.1|4571107_4572244_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.3	2.3e-115
AWL76453.1|4572786_4573068_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76454.1|4573110_4573821_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.2	6.3e-07
AWL76455.1|4573864_4575298_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.5	6.8e-101
AWL76456.1|4575278_4575773_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	53.6	1.6e-33
AWL76457.1|4575747_4576659_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWL76458.1|4576842_4577754_+	hypothetical protein	NA	NA	NA	NA	NA
AWL76459.1|4577870_4579550_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	42.6	2.4e-20
>prophage 334
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4586158	4586911	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76468.1|4586158_4586911_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	1.3e-26
>prophage 335
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4604888	4606403	5416268		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL76487.1|4604888_4606403_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	6.9e-11
>prophage 336
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4613343	4629889	5416268	tRNA	Tupanvirus(25.0%)	18	NA	NA
AWL76494.1|4613343_4615077_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	8.8e-87
AWL76495.1|4615313_4615883_+	VOC family protein	NA	NA	NA	NA	NA
AWL76496.1|4615959_4616703_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWL76497.1|4616783_4617788_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWL76498.1|4617784_4618528_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	30.0	1.8e-25
AWL76499.1|4618567_4618963_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76500.1|4619015_4619834_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	85.0	6.1e-62
AWL76501.1|4619830_4620397_-	hydrolase	NA	NA	NA	NA	NA
AWL76502.1|4620664_4622452_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AWL76503.1|4622453_4622897_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWL76504.1|4622924_4623665_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWL76505.1|4623699_4624221_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	7.6e-10
AWL76506.1|4624300_4624912_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWL76507.1|4624920_4625931_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AWL76508.1|4625993_4626779_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWL77427.1|4626778_4627531_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.8	2.3e-15
AWL76509.1|4627609_4628554_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWL76510.1|4628569_4629889_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	6.9e-15
>prophage 337
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4634888	4640555	5416268		Dickeya_phage(50.0%)	6	NA	NA
AWL76515.1|4634888_4636223_+	malate permease	NA	A0A140XAH4	Dickeya_phage	53.5	3.4e-22
AWL76516.1|4636286_4637729_-	pyruvate kinase	NA	NA	NA	NA	NA
AWL76517.1|4637854_4638724_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
AWL76518.1|4638759_4638948_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76519.1|4638919_4639069_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AWL76520.1|4639079_4640555_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	4.1e-77
>prophage 338
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4648122	4649091	5416268		Pseudoalteromonas_phage(50.0%)	2	NA	NA
AWL76527.1|4648122_4648782_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.2	8.4e-14
AWL76528.1|4648860_4649091_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
>prophage 339
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4652817	4653471	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL76531.1|4652817_4653471_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.2	6.1e-57
>prophage 340
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4660981	4663030	5416268		Moraxella_phage(100.0%)	1	NA	NA
AWL76539.1|4660981_4663030_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
>prophage 341
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4668301	4668511	5416268		Morganella_phage(100.0%)	1	NA	NA
AWL76547.1|4668301_4668511_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 342
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4675952	4677512	5416268		Moraxella_phage(100.0%)	1	NA	NA
AWL76555.1|4675952_4677512_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.5e-40
>prophage 343
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4681403	4688772	5416268	tRNA	Pandoravirus(33.33%)	7	NA	NA
AWL76559.1|4681403_4682759_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	3.6e-43
AWL76560.1|4682847_4683033_+	YoaH family protein	NA	NA	NA	NA	NA
AWL76561.1|4683033_4683378_-	RidA family protein	NA	NA	NA	NA	NA
AWL76562.1|4683509_4685420_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.1e-90
AWL76563.1|4685565_4686261_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWL76564.1|4686299_4686881_+	hypothetical protein	NA	NA	NA	NA	NA
AWL77431.1|4687086_4688772_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	4.5e-35
>prophage 344
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4704396	4705008	5416268		Geobacillus_virus(100.0%)	1	NA	NA
AWL76581.1|4704396_4705008_+	murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 345
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4713643	4714729	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL76588.1|4713643_4714729_-	ABC transporter	NA	W8CYL7	Bacillus_phage	32.0	5.6e-15
>prophage 346
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4725649	4726738	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL76599.1|4725649_4726738_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.0e-24
>prophage 347
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4732139	4734434	5416268		Tetraselmis_virus(100.0%)	1	NA	NA
AWL76605.1|4732139_4734434_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	2.2e-157
>prophage 348
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4738296	4749083	5416268		Staphylococcus_phage(40.0%)	11	NA	NA
AWL76609.1|4738296_4739172_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
AWL76610.1|4739168_4739888_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.1e-11
AWL76611.1|4739893_4740787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL76612.1|4741070_4742714_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.2	2.2e-135
AWL76613.1|4742763_4743240_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL76614.1|4743339_4744272_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL77433.1|4744605_4745901_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.5	7.4e-62
AWL76615.1|4745915_4746722_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL76616.1|4746696_4747596_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL76617.1|4747710_4748193_-	cold-shock protein	NA	NA	NA	NA	NA
AWL76618.1|4748384_4749083_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.0	5.3e-06
>prophage 349
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4754843	4757543	5416268		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL76624.1|4754843_4757543_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	2.2e-15
>prophage 350
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4779936	4782814	5416268		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWL76643.1|4779936_4781616_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	1.0e-23
AWL77435.1|4781866_4782814_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 351
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4786027	4791742	5416268		Pseudomonas_phage(33.33%)	7	NA	NA
AWL76647.1|4786027_4787110_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
AWL76648.1|4787109_4787958_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWL76649.1|4787957_4788350_+	siroheme synthase	NA	NA	NA	NA	NA
AWL76650.1|4788353_4789166_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AWL76651.1|4789205_4790060_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AWL76652.1|4790147_4791248_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AWL76653.1|4791511_4791742_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	2.4e-08
>prophage 352
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4797096	4797885	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76660.1|4797096_4797885_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	3.5e-30
>prophage 353
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4814386	4815922	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL76667.1|4814386_4815922_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 354
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4819410	4825681	5416268		Synechococcus_phage(25.0%)	7	NA	NA
AWL76672.1|4819410_4820253_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	42.2	3.1e-13
AWL76673.1|4820295_4820766_-	hypothetical protein	NA	NA	NA	NA	NA
AWL76674.1|4820866_4821769_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AWL76675.1|4821858_4822872_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AWL76676.1|4823069_4823972_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	1.4e-59
AWL76677.1|4824094_4824502_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AWL76678.1|4825063_4825681_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	2.1e-54
>prophage 355
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4833947	4836844	5416268		Planktothrix_phage(33.33%)	3	NA	NA
AWL76685.1|4833947_4834961_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
AWL76686.1|4834957_4835962_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AWL76687.1|4836016_4836844_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 356
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4846292	4853461	5416268	tRNA	Tupanvirus(25.0%)	7	NA	NA
AWL76701.1|4846292_4848221_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	5.2e-128
AWL76702.1|4848224_4848767_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AWL76703.1|4848859_4849057_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWL76704.1|4849107_4849464_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWL76705.1|4849770_4850754_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AWL76706.1|4850769_4853157_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWL76707.1|4853161_4853461_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 357
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4860521	4868489	5416268		Brazilian_cedratvirus(25.0%)	7	NA	NA
AWL76715.1|4860521_4861271_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	1.4e-09
AWL76716.1|4861351_4861816_+	lipoprotein	NA	NA	NA	NA	NA
AWL76717.1|4861929_4863372_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	2.6e-55
AWL76718.1|4863401_4863629_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AWL77437.1|4863736_4864783_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	5.2e-82
AWL77438.1|4864937_4865771_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AWL76719.1|4866110_4868489_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	5.5e-172
>prophage 358
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4878477	4879239	5416268		Indivirus(100.0%)	1	NA	NA
AWL76728.1|4878477_4879239_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	1.8e-15
>prophage 359
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4894594	4895815	5416268		environmental_halophage(100.0%)	1	NA	NA
AWL76742.1|4894594_4895815_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.0	5.8e-93
>prophage 360
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4913923	4915887	5416268		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AWL76760.1|4913923_4914874_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	37.0	2.5e-35
AWL76761.1|4914870_4915887_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	4.8e-40
>prophage 361
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4926545	4927334	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76771.1|4926545_4927334_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-31
>prophage 362
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4930761	4931583	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL76773.1|4930761_4931583_+	cobalamin/Fe(3+)-siderophore ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-16
>prophage 363
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4949321	4950392	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76788.1|4949321_4950392_+	lipase	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 364
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4955249	4955873	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL76792.1|4955249_4955873_+	heme ABC transporter ATP-binding protein CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.2	9.4e-07
>prophage 365
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4980898	4982266	5416268		Ochrobactrum_phage(100.0%)	1	NA	NA
AWL76821.1|4980898_4982266_+	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.0	6.6e-29
>prophage 366
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	4986262	4987093	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76825.1|4986262_4987093_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.9e-26
>prophage 367
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5003803	5005752	5416268		Klosneuvirus(50.0%)	2	NA	NA
AWL76841.1|5003803_5004775_-	peptide ABC transporter substrate-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	3.2e-09
AWL76842.1|5004771_5005752_-	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	9.0e-12
>prophage 368
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5010936	5011707	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL76848.1|5010936_5011707_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	1.1e-12
>prophage 369
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5018086	5029630	5416268		Burkholderia_virus(20.0%)	11	NA	NA
AWL76856.1|5018086_5018971_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.9	9.6e-21
AWL76857.1|5018967_5019894_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL76858.1|5019992_5020745_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWL76859.1|5021358_5021937_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	34.8	7.6e-19
AWL76860.1|5022077_5022485_-	acid-shock protein	NA	NA	NA	NA	NA
AWL76861.1|5022662_5024036_-	multidrug transporter MdtK	NA	NA	NA	NA	NA
AWL76862.1|5024265_5024901_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AWL76863.1|5024937_5026086_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	8.5e-86
AWL76864.1|5026380_5027562_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWL76865.1|5027674_5028586_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL76866.1|5028604_5029630_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	30.6	7.7e-30
>prophage 370
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5032914	5033787	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL76871.1|5032914_5033787_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 371
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5037973	5039461	5416268		Indivirus(50.0%)	2	NA	NA
AWL76878.1|5037973_5038870_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	8.0e-07
AWL76879.1|5038939_5039461_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	8.1e-52
>prophage 372
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5043268	5044630	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL76884.1|5043268_5044630_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.8	1.8e-18
>prophage 373
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5047969	5049244	5416268	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWL76889.1|5047969_5049244_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.4e-86
>prophage 374
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5060697	5062068	5416268		Pandoravirus(100.0%)	1	NA	NA
AWL76901.1|5060697_5062068_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.3	5.8e-65
>prophage 375
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5065618	5067669	5416268		Escherichia_phage(50.0%)	3	NA	NA
AWL76907.1|5065618_5066146_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	46.8	3.5e-18
AWL76908.1|5066250_5066526_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AWL76909.1|5066550_5067669_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	5.2e-32
>prophage 376
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5074470	5075976	5416268		Megavirus(100.0%)	1	NA	NA
AWL76915.1|5074470_5075976_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	37.5	3.0e-30
>prophage 377
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5086288	5088250	5416268	protease	Phage_TP(100.0%)	1	NA	NA
AWL76926.1|5086288_5088250_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 378
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5095160	5096174	5416268		Mycoplasma_phage(100.0%)	1	NA	NA
AWL76934.1|5095160_5096174_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	1.3e-24
>prophage 379
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5101154	5101904	5416268		Mycobacterium_phage(100.0%)	1	NA	NA
AWL76941.1|5101154_5101904_+	alpha/beta hydrolase	NA	G1JV20	Mycobacterium_phage	31.9	1.5e-06
>prophage 380
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5109932	5112023	5416268		Salmonella_phage(100.0%)	1	NA	NA
AWL77451.1|5109932_5112023_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	68.8	2.2e-140
>prophage 381
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5123306	5124086	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76961.1|5123306_5124086_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G3M9Y6	Bacillus_virus	30.0	6.0e-19
>prophage 382
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5132984	5133686	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL76970.1|5132984_5133686_+	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	9.6e-32
>prophage 383
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5139800	5141345	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL76976.1|5139800_5141345_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 384
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5147448	5148948	5416268		Mycobacterium_phage(100.0%)	1	NA	NA
AWL76979.1|5147448_5148948_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	6.0e-31
>prophage 385
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5155432	5156206	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL76986.1|5155432_5156206_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	47.1	6.4e-05
>prophage 386
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5167498	5169115	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL76999.1|5167498_5169115_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.6e-18
>prophage 387
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5172705	5179060	5416268		Tupanvirus(66.67%)	5	NA	NA
AWL77003.1|5172705_5173716_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
AWL77004.1|5173969_5174569_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	1.4e-20
AWL77005.1|5174971_5175802_-	hypothetical protein	NA	NA	NA	NA	NA
AWL77006.1|5176358_5177312_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWL77007.1|5177347_5179060_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	24.2	1.4e-31
>prophage 388
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5184143	5186461	5416268		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
AWL77455.1|5184143_5185016_-	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	57.9	3.3e-82
AWL77012.1|5185713_5185899_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWL77013.1|5186245_5186461_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	7.2e-07
>prophage 389
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5191262	5191667	5416268		Stx_converting_phage(100.0%)	1	NA	NA
AWL77019.1|5191262_5191667_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	39.3	1.3e-09
>prophage 390
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5202022	5202703	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL77028.1|5202022_5202703_+	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 391
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5218080	5220161	5416268		Bacillus_phage(100.0%)	2	NA	NA
AWL77041.1|5218080_5218821_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	1.1e-30
AWL77042.1|5218817_5220161_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	2.1e-11
>prophage 392
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5224636	5228754	5416268		Klosneuvirus(50.0%)	4	NA	NA
AWL77046.1|5224636_5226022_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	4.4e-28
AWL77047.1|5226328_5227264_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AWL77048.1|5227288_5228029_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL77049.1|5228025_5228754_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.2	1.7e-15
>prophage 393
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5236866	5238123	5416268		Bacillus_phage(100.0%)	1	NA	NA
AWL77057.1|5236866_5238123_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	3.7e-18
>prophage 394
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5247861	5249865	5416268	holin	Vibrio_phage(100.0%)	1	NA	NA
AWL77067.1|5247861_5249865_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	7.5e-21
>prophage 395
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5258053	5259517	5416268		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWL77460.1|5258053_5259517_+	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	26.4	2.3e-35
>prophage 396
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5273115	5273853	5416268		Planktothrix_phage(100.0%)	1	NA	NA
AWL77089.1|5273115_5273853_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 397
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5292817	5294406	5416268		Bacillus_virus(50.0%)	2	NA	NA
AWL77107.1|5292817_5293633_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	1.6e-06
AWL77108.1|5293629_5294406_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	51.6	1.3e-18
>prophage 398
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5303052	5304105	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL77463.1|5303052_5304105_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.7	2.1e-14
>prophage 399
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5328902	5329685	5416268		Staphylococcus_phage(100.0%)	1	NA	NA
AWL77137.1|5328902_5329685_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 400
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5348634	5349408	5416268		Escherichia_phage(100.0%)	1	NA	NA
AWL77152.1|5348634_5349408_-	alkaline phosphatase	NA	A0A077SK06	Escherichia_phage	29.6	1.2e-22
>prophage 401
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5356705	5358262	5416268		Catovirus(100.0%)	1	NA	NA
AWL77160.1|5356705_5358262_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	24.8	8.7e-17
>prophage 402
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5365624	5366800	5416268		Streptococcus_phage(100.0%)	1	NA	NA
AWL77167.1|5365624_5366800_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	1.1e-40
>prophage 403
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5392604	5393984	5416268		Enterobacteria_phage(100.0%)	1	NA	NA
AWL77193.1|5392604_5393984_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	1.8e-18
>prophage 404
CP029437	Klebsiella quasipneumoniae strain CAV2013 chromosome, complete genome	5416268	5404478	5405270	5416268		Bacillus_virus(100.0%)	1	NA	NA
AWL77205.1|5404478_5405270_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.5	2.5e-20
>prophage 1
CP029435	Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence	155523	61001	110269	155523	transposase	Escherichia_phage(25.0%)	56	NA	NA
AWL71742.1|61001_62370_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.2	1.9e-76
AWL71743.1|62564_62993_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71744.1|63165_64308_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWL71745.1|64317_64587_-	metal resistance protein	NA	NA	NA	NA	NA
AWL71746.1|64690_65989_-	MFS transporter	NA	NA	NA	NA	NA
AWL71747.1|66223_66982_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
AWL71748.1|67035_67956_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71749.1|68019_68391_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71750.1|68531_69221_-	transmembrane anchor protein	NA	NA	NA	NA	NA
AWL71751.1|69234_69972_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
AWL71752.1|70016_70382_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71753.1|70621_70888_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWL71754.1|70875_71361_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL71755.1|71654_72734_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWL71756.1|72803_72965_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AWL71757.1|73660_73933_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71758.1|73929_74280_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71759.1|74916_75273_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AWL71760.1|75333_75546_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71761.1|75556_75781_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71762.1|75861_76182_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AWL71763.1|76171_76450_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AWL71764.1|76450_76864_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL71765.1|77377_77596_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71766.1|77693_78521_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AWL71767.1|78547_78877_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71768.1|78909_79395_-	lytic transglycosylase	NA	NA	NA	NA	NA
AWL71769.1|80421_80664_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71770.1|81538_82090_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71771.1|82082_82370_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71772.1|83243_84248_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL71773.1|87369_87660_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWL71774.1|87656_88058_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWL71775.1|88203_88908_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL71776.1|89598_89886_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71777.1|89869_90715_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL71778.1|90744_91263_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL71779.1|91993_92368_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AWL71780.1|92903_93149_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71781.1|93228_93495_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71782.1|93664_93946_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
AWL71783.1|94013_94286_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
AWL71784.1|94739_95486_-	oxidoreductase	NA	NA	NA	NA	NA
AWL71785.1|95478_96081_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
AWL71786.1|96548_97019_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AWL71787.1|97150_97348_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71788.1|97344_97638_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AWL71789.1|97696_98128_-	heme-binding protein	NA	NA	NA	NA	NA
AWL71790.1|98200_99214_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWL71791.1|99661_100630_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AWL71792.1|100626_101331_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWL71793.1|101471_102011_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWL71794.1|102012_102456_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWL71795.1|104774_106043_-|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AWL71796.1|106360_106732_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71797.1|107371_110269_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
CP029434	Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-61, complete sequence	61215	21189	50431	61215	transposase	Escherichia_phage(25.0%)	33	NA	NA
AWL71648.1|21189_21894_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL71649.1|22138_22639_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AWL71650.1|22791_22917_+	ABC transporter	NA	NA	NA	NA	NA
AWL71651.1|22955_23936_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
AWL71652.1|24213_24495_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AWL71653.1|24732_25701_-	AAA family ATPase	NA	NA	NA	NA	NA
AWL71654.1|25690_27352_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWL71655.1|27335_27896_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.8	1.9e-30
AWL71656.1|28234_28711_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71657.1|28803_29070_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL71690.1|29210_29831_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWL71658.1|30031_32929_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL71659.1|33023_33629_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL71660.1|33786_34053_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL71661.1|34149_34707_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWL71662.1|34919_35180_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL71663.1|35210_35717_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL71664.1|35951_36413_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWL71665.1|36402_36897_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWL71666.1|37571_37850_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AWL71667.1|37837_38149_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWL71668.1|38280_41289_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
AWL71669.1|41452_42025_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AWL71670.1|42033_42438_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL71671.1|42468_42894_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AWL71672.1|42906_44196_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	3.3e-171
AWL71673.1|44243_45995_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL71674.1|46012_46375_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL71675.1|46422_46776_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWL71676.1|47589_47817_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71677.1|47817_48567_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.9	2.0e-19
AWL71678.1|48754_49123_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71679.1|49408_50431_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP029436	Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence	447095	73563	129856	447095	transposase,protease	uncultured_Caudovirales_phage(30.0%)	48	NA	NA
AWL71937.1|73563_76572_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AWL71938.1|76735_77308_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AWL71939.1|77316_77721_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL71940.1|77751_78177_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AWL71941.1|78189_79479_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.6e-170
AWL71942.1|79527_81279_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL71943.1|81296_81659_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL71944.1|81706_82060_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWL71945.1|83270_83612_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	3.6e-24
AWL71946.1|83739_84696_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL71947.1|84692_85664_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL71948.1|85656_87156_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.6e-12
AWL71949.1|87188_88175_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWL71950.1|88300_88489_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71951.1|88600_89398_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71952.1|89536_90436_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	6.3e-12
AWL71953.1|90398_93776_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	4.6e-39
AWL71954.1|93976_95215_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL71955.1|95268_96195_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
AWL71956.1|96208_97381_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AWL71957.1|97364_98114_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-16
AWL71958.1|98124_98814_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.1e-19
AWL71959.1|98846_99857_+	formamidase	NA	NA	NA	NA	NA
AWL71960.1|99957_101001_+	aliphatic amidase	NA	NA	NA	NA	NA
AWL72323.1|101046_102099_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	31.0	3.8e-32
AWL71961.1|102070_102367_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72324.1|102889_105001_+	hypothetical protein	NA	A0A2L1IV38	Escherichia_phage	45.6	6.9e-17
AWL71962.1|105005_107903_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL71963.1|107997_108603_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL71964.1|110051_110288_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71965.1|110548_110767_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71966.1|111049_111373_+	hypothetical protein	NA	NA	NA	NA	NA
AWL71967.1|111408_112332_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71968.1|112512_112740_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71969.1|113058_113457_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71970.1|113478_113796_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71971.1|113883_114369_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71972.1|114779_115646_-	repA protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
AWL71973.1|116218_116467_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72325.1|117428_118511_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
AWL71974.1|118565_118835_-	hypothetical protein	NA	NA	NA	NA	NA
AWL71975.1|119951_120956_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL71976.1|121034_124019_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
AWL71977.1|124073_124697_-	serine recombinase	NA	NA	NA	NA	NA
AWL71978.1|125122_126601_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
AWL71979.1|126619_127447_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AWL71980.1|127507_128503_+	glycosyl transferase	NA	NA	NA	NA	NA
AWL71981.1|128851_129856_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP029436	Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence	447095	329797	364829	447095	transposase	Escherichia_phage(44.44%)	29	NA	NA
AWL72205.1|329797_330820_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL72206.1|330816_333882_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.1e-295
AWL72207.1|334049_334691_+	resolvase	NA	NA	NA	NA	NA
AWL72208.1|334954_336613_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWL72209.1|336774_337125_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL72210.1|337429_337906_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AWL72211.1|338020_338458_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AWL72212.1|338618_339080_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AWL72213.1|339054_339375_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AWL72214.1|339668_339896_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72215.1|340074_341055_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
AWL72345.1|341093_341210_-	ABC transporter	NA	NA	NA	NA	NA
AWL72346.1|341733_341877_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	78.3	1.2e-13
AWL72216.1|343669_344899_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AWL72217.1|345008_346907_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.0	8.7e-11
AWL72218.1|348754_349630_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL72219.1|349730_350021_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL72220.1|350607_351312_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL72221.1|351457_352060_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72222.1|352319_353051_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWL72223.1|353283_354042_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72224.1|354107_354497_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72225.1|354562_355267_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWL72226.1|356534_357539_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWL72227.1|357568_358969_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.0	6.2e-14
AWL72228.1|358968_360339_-	PTS sucrose EIIBC component	NA	NA	NA	NA	NA
AWL72229.1|360474_361992_-	carbohydrate porin	NA	NA	NA	NA	NA
AWL72230.1|362157_363081_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AWL72231.1|364124_364829_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
CP029436	Klebsiella quasipneumoniae strain CAV2013 plasmid pKPC_CAV2013, complete sequence	447095	376103	421982	447095	integrase,transposase	Escherichia_phage(27.78%)	42	386193:386252	417062:417263
AWL72249.1|376103_379070_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AWL72250.1|379148_380153_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL72348.1|381268_381913_-	resolvase	NA	NA	NA	NA	NA
AWL72251.1|382211_382571_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72252.1|382554_382860_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72253.1|382892_383114_-	resolvase	NA	NA	NA	NA	NA
AWL72254.1|383155_383920_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL72255.1|384062_384329_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWL72256.1|384549_385023_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWL72257.1|385178_386192_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL72258.1|386130_386445_+|transposase	transposase	transposase	NA	NA	NA	NA
386193:386252	attL	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCA	NA	NA	NA	NA
AWL72259.1|386584_387154_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWL72260.1|387505_388168_-	hypothetical protein	NA	NA	NA	NA	NA
AWL72261.1|391582_392902_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL72262.1|393151_394033_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWL72263.1|394419_395199_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL72264.1|395195_396221_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWL72265.1|396327_399357_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AWL72266.1|399466_401182_+|integrase	integrase	integrase	NA	NA	NA	NA
AWL72267.1|402534_403239_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL72349.1|403274_403580_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AWL72268.1|403615_403927_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72350.1|404135_404624_+	restriction endonuclease	NA	NA	NA	NA	NA
AWL72269.1|404628_404835_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72270.1|405216_406650_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWL72271.1|406683_407892_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWL72272.1|407904_408117_-	resolvase	NA	NA	NA	NA	NA
AWL72273.1|408158_408923_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL72274.1|409010_409124_+	NTP-binding protein	NA	NA	NA	NA	NA
AWL72275.1|409429_409930_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL72276.1|409948_410128_+	hypothetical protein	NA	NA	NA	NA	NA
AWL72277.1|410057_410897_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL72278.1|411096_411753_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AWL72279.1|412085_413627_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWL72280.1|414031_414871_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL72281.1|414864_415212_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL72351.1|415368_415902_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AWL72282.1|416047_417061_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL72283.1|417005_417329_+|transposase	transposase	transposase	NA	NA	NA	NA
417062:417263	attR	GGCAGCGCAAGTCAATCCTGGCGGATTCACTACCCCTGCGCGAAGGCCATCGGTGCCGCATCGAACGGCCGGTTGCGGAAAGTCCTCCCTGCGTCCGCTGATGGCCGGCAGCAGCCCGTCGTTGCCTGATGGATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACA	NA	NA	NA	NA
AWL72284.1|417366_417924_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWL72285.1|417926_420899_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AWL72286.1|420977_421982_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
