The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029432	Klebsiella quasipneumoniae strain CAV2018 chromosome, complete genome	5417030	259670	270554	5417030		Escherichia_phage(87.5%)	9	NA	NA
AWL61293.1|259670_260291_-	aldolase	NA	A0A077SK32	Escherichia_phage	94.2	2.2e-109
AWL61294.1|260283_261549_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	91.7	1.9e-216
AWL61295.1|261560_262463_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.7	1.6e-156
AWL61296.1|262724_263486_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AWL61297.1|263506_264367_-	OKP family class A broad-spectrum beta-lactamase	NA	A0A077SL40	Escherichia_phage	88.1	4.9e-139
AWL65935.1|264663_264924_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWL61298.1|265008_266097_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	97.0	1.0e-205
AWL65936.1|266126_267392_-	MFS transporter	NA	NA	NA	NA	NA
AWL61299.1|267446_270554_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 2
CP029432	Klebsiella quasipneumoniae strain CAV2018 chromosome, complete genome	5417030	1760131	1769462	5417030	integrase	Enterobacteria_phage(83.33%)	9	1754879:1754893	1769828:1769842
1754879:1754893	attL	TTTCATTTAACGCAA	NA	NA	NA	NA
AWL62604.1|1760131_1761322_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	2.1e-103
AWL62605.1|1761393_1763289_-	hypothetical protein	NA	NA	NA	NA	NA
AWL62606.1|1763660_1764224_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	60.7	8.4e-55
AWL62607.1|1764223_1764484_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	67.9	6.4e-26
AWL62608.1|1764480_1765218_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.7	9.9e-80
AWL62609.1|1766021_1766573_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	72.2	6.6e-36
AWL62610.1|1766569_1766797_+	hypothetical protein	NA	NA	NA	NA	NA
AWL62611.1|1766793_1767114_+	hypothetical protein	NA	NA	NA	NA	NA
AWL62612.1|1767128_1769462_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
1769828:1769842	attR	TTTCATTTAACGCAA	NA	NA	NA	NA
>prophage 3
CP029432	Klebsiella quasipneumoniae strain CAV2018 chromosome, complete genome	5417030	2285339	2359875	5417030	tail,lysis,integrase,terminase,tRNA,holin,head,plate,portal,capsid	Salmonella_phage(56.63%)	96	2291486:2291530	2359962:2360006
AWL63089.1|2285339_2286353_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AWL63090.1|2286361_2286592_-	hypothetical protein	NA	NA	NA	NA	NA
AWL63091.1|2286590_2286806_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWL63092.1|2286917_2288663_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	3.5e-75
AWL63093.1|2288882_2290724_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWL63094.1|2290823_2291330_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
2291486:2291530	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCA	NA	NA	NA	NA
AWL63095.1|2291657_2292044_+	hypothetical protein	NA	NA	NA	NA	NA
AWL63096.1|2292050_2292269_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	8.3e-27
AWL63097.1|2292339_2293437_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
AWL63098.1|2293433_2293919_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
AWL63099.1|2293915_2296543_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	4.3e-117
AWL63100.1|2296535_2296655_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL63101.1|2296669_2296969_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AWL63102.1|2297021_2297537_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWL63103.1|2297546_2298719_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
AWL63104.1|2298857_2300015_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.4	2.3e-43
AWL63105.1|2300051_2300291_-	hypothetical protein	NA	NA	NA	NA	NA
AWL63106.1|2300298_2302410_-|tail	phage tail protein	tail	S4TP40	Salmonella_phage	40.2	5.8e-08
AWL63107.1|2302387_2302984_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.8	1.3e-50
AWL63108.1|2302976_2303885_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	2.6e-106
AWL63109.1|2303871_2304234_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AWL63110.1|2304230_2304803_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.7e-77
AWL63111.1|2305311_2305743_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.8	6.4e-63
AWL63112.1|2305705_2305909_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.9	3.4e-22
AWL63113.1|2306104_2306758_+	hypothetical protein	NA	NA	NA	NA	NA
AWL63114.1|2306754_2307201_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.1	3.3e-54
AWL63115.1|2307193_2307625_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	5.8e-64
AWL63116.1|2307720_2308149_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	78.7	9.6e-51
AWL63117.1|2308145_2308529_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	43.7	1.2e-17
AWL63118.1|2308533_2309043_-	glycoside hydrolase	NA	E5G6N1	Salmonella_phage	84.0	2.8e-81
AWL63119.1|2309023_2309239_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	2.3e-29
AWL63120.1|2309242_2309446_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AWL63121.1|2309445_2309910_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	1.6e-75
AWL63122.1|2310006_2310657_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AWL63123.1|2310660_2311725_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	3.3e-185
AWL63124.1|2311741_2312575_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.2	5.2e-101
AWL63125.1|2312715_2314479_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.8	0.0e+00
AWL63126.1|2314478_2315510_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.9	1.5e-174
AWL63127.1|2315555_2315894_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AWL63128.1|2315893_2316868_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	8.0e-53
AWL63129.1|2317132_2317393_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	64.1	2.8e-21
AWL63130.1|2317466_2317700_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	5.4e-32
AWL63131.1|2317710_2317899_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
AWL63132.1|2318058_2318754_-	DNA methylase	NA	A0A0M4S5U3	Salmonella_phage	73.7	3.3e-93
AWL63133.1|2318905_2321209_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.9	6.8e-268
AWL63134.1|2321251_2322109_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.5	4.8e-118
AWL63135.1|2322105_2322333_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	78.7	4.6e-28
AWL63136.1|2322332_2322566_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	59.7	1.4e-16
AWL63137.1|2322635_2322836_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	75.4	1.8e-23
AWL63138.1|2322825_2323050_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	74.3	3.6e-25
AWL63139.1|2323057_2323567_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	87.0	7.6e-79
AWL63140.1|2323595_2323859_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	1.0e-39
AWL63141.1|2323965_2324202_-	regulator	NA	NA	NA	NA	NA
AWL63142.1|2324303_2324918_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	44.6	1.6e-38
AWL63143.1|2324959_2325142_+	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	55.9	4.5e-10
AWL63144.1|2325144_2326158_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	60.5	1.8e-116
AWL63145.1|2326160_2327633_+	hypothetical protein	NA	NA	NA	NA	NA
AWL63146.1|2327979_2328198_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	83.3	6.6e-32
AWL63147.1|2328746_2329907_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
AWL63148.1|2329906_2330386_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
AWL63149.1|2330402_2332841_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	69.9	4.6e-283
AWL63150.1|2332833_2332971_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	91.1	2.2e-17
AWL63151.1|2332985_2333261_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	2.4e-31
AWL63152.1|2333321_2333837_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
AWL63153.1|2333850_2335032_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	86.4	1.8e-195
AWL63154.1|2335142_2336300_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.8	3.6e-44
AWL63155.1|2336336_2336576_-	hypothetical protein	NA	NA	NA	NA	NA
AWL63156.1|2336583_2338695_-|tail	phage tail protein	tail	S4TP40	Salmonella_phage	41.5	2.6e-08
AWL63157.1|2338672_2339269_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	49.1	1.2e-46
AWL63158.1|2339261_2340170_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	2.4e-112
AWL63159.1|2340174_2340522_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	74.8	2.0e-43
AWL63160.1|2340518_2341160_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.9	2.6e-92
AWL63161.1|2341359_2342613_+	HNH endonuclease	NA	NA	NA	NA	NA
AWL63162.1|2342637_2343096_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	2.0e-46
AWL63163.1|2343088_2343556_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	1.4e-63
AWL63164.1|2343651_2344083_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
AWL63165.1|2344079_2344577_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	87.0	4.3e-79
AWL63166.1|2344563_2344854_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
AWL63167.1|2344858_2345062_-|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
AWL63168.1|2345061_2345568_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	2.1e-60
AWL63169.1|2345664_2346408_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	80.3	5.1e-100
AWL63170.1|2346411_2347470_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	3.2e-164
AWL63171.1|2347543_2348398_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	2.1e-126
AWL63172.1|2348563_2350333_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
AWL63173.1|2350332_2351376_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	1.3e-165
AWL63174.1|2351698_2352424_-	hypothetical protein	NA	NA	NA	NA	NA
AWL63175.1|2354057_2356064_-	replication protein	NA	A0A218M4H2	Erwinia_phage	90.5	0.0e+00
AWL63176.1|2356056_2356338_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
AWL63177.1|2356338_2356560_-	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	86.3	2.0e-28
AWL63178.1|2356559_2356787_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
AWL63179.1|2356855_2357194_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
AWL63180.1|2357157_2357358_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
AWL63181.1|2357365_2357875_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
AWL63182.1|2357905_2358127_-	regulator	NA	NA	NA	NA	NA
AWL63183.1|2358246_2358831_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
AWL63184.1|2358837_2359875_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
2359962:2360006	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCA	NA	NA	NA	NA
>prophage 4
CP029432	Klebsiella quasipneumoniae strain CAV2018 chromosome, complete genome	5417030	4811737	4821197	5417030	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
AWL65362.1|4811737_4812853_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWL65363.1|4812849_4814790_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AWL65364.1|4814866_4815088_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWL65365.1|4815413_4815731_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWL65366.1|4815761_4818041_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	6.2e-165
AWL65367.1|4818162_4818381_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWL65368.1|4818734_4819436_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWL65369.1|4819475_4821197_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	33.0	6.4e-13
>prophage 5
CP029432	Klebsiella quasipneumoniae strain CAV2018 chromosome, complete genome	5417030	5058660	5255127	5417030	tail,transposase,integrase,terminase,tRNA,portal,head,capsid,plate,holin,protease	Klebsiella_phage(23.7%)	220	5208043:5208060	5245310:5245327
AWL66153.1|5058660_5059767_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWL65574.1|5059823_5060282_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWL65575.1|5060298_5060949_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWL65576.1|5061189_5062440_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWL65577.1|5062552_5063695_-|integrase	integrase	integrase	Q77Z02	Phage_21	81.4	1.1e-170
AWL65578.1|5063684_5063921_-	excisionase	NA	NA	NA	NA	NA
AWL65579.1|5063949_5064225_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
AWL65580.1|5064327_5064597_-	antitoxin	NA	NA	NA	NA	NA
AWL65581.1|5064593_5065058_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.1	1.0e-10
AWL65582.1|5065185_5065971_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
AWL65583.1|5065963_5066164_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65584.1|5066163_5066691_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	1.8e-62
AWL65585.1|5066826_5067657_-	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	82.1	5.5e-127
AWL65586.1|5067709_5068081_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.0	2.7e-49
AWL65587.1|5068778_5069006_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65588.1|5069002_5069092_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65589.1|5069278_5069923_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.2	1.7e-38
AWL65590.1|5070017_5070332_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65591.1|5070238_5071777_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
AWL65592.1|5071826_5072174_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AWL65593.1|5072170_5072548_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AWL65594.1|5072916_5073387_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65595.1|5073466_5074015_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.5	2.7e-66
AWL65596.1|5074187_5074367_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AWL65597.1|5074356_5075268_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	9.8e-53
AWL65598.1|5075264_5075723_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWL65599.1|5075710_5077093_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	1.5e-105
AWL65600.1|5077085_5078936_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.3	6.3e-200
AWL65601.1|5078932_5079409_+|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	56.3	9.4e-15
AWL65602.1|5079405_5079804_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
AWL65603.1|5079893_5080715_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AWL66154.1|5080796_5081783_+	hypothetical protein	NA	Q8SBE5	Shigella_phage	48.0	8.3e-90
AWL65604.1|5081800_5082184_+	DUF1133 domain-containing protein	NA	U5P0A5	Shigella_phage	80.8	3.8e-51
AWL65605.1|5082278_5083328_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65606.1|5084022_5084214_+	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	82.5	1.9e-22
AWL65607.1|5084363_5085413_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	77.6	6.2e-168
AWL65608.1|5085554_5085815_+	hypothetical protein	NA	NA	NA	NA	NA
AWL66155.1|5085817_5086075_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	9.2e-25
AWL66156.1|5086346_5087114_+	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	74.7	2.9e-106
AWL65609.1|5087827_5088151_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	80.4	8.0e-42
AWL65610.1|5088134_5088614_+	lysozyme	NA	A5VW81	Enterobacteria_phage	83.6	1.2e-70
AWL65611.1|5088629_5088815_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65612.1|5088827_5089010_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65613.1|5089566_5089842_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	42.7	6.8e-10
AWL65614.1|5089792_5089990_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.3	5.6e-22
AWL65615.1|5090060_5090549_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65616.1|5090633_5091023_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	48.4	6.7e-27
AWL65617.1|5091089_5091335_+	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	64.2	1.9e-19
AWL65618.1|5091390_5091732_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
AWL65619.1|5091914_5092379_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	4.8e-48
AWL65620.1|5092332_5094069_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AWL65621.1|5094075_5095395_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	7.6e-139
AWL65622.1|5095370_5096078_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AWL65623.1|5096087_5097308_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	3.7e-140
AWL65624.1|5097353_5097608_+	hypothetical protein	NA	NA	NA	NA	NA
AWL66157.1|5097613_5097946_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	30.7	3.4e-11
AWL65625.1|5097958_5098297_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	66.1	3.6e-37
AWL65626.1|5098293_5098743_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.9	1.1e-62
AWL65627.1|5098739_5099087_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
AWL65628.1|5099143_5099848_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	1.0e-78
AWL65629.1|5099878_5100283_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	53.1	1.5e-29
AWL65630.1|5100285_5100591_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
AWL65631.1|5100965_5104559_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.3	2.3e-222
AWL65632.1|5104579_5105053_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.1	1.0e-53
AWL65633.1|5105039_5105525_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AWL65634.1|5105534_5105915_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
AWL65635.1|5105911_5108995_+	kinase	NA	A0A286S259	Klebsiella_phage	70.7	0.0e+00
AWL66158.1|5111235_5111433_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65636.1|5111480_5111684_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65637.1|5111694_5113671_-	hypothetical protein	NA	A0A1I9SEI8	Klebsiella_phage	26.8	3.0e-46
AWL65638.1|5113749_5114328_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	92.9	1.4e-89
AWL65639.1|5114378_5114801_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
AWL65640.1|5115461_5115881_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	6.5e-36
AWL65641.1|5115882_5117148_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.6	1.1e-208
AWL65642.1|5120359_5120887_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.7	1.7e-65
AWL65643.1|5121076_5122054_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65644.1|5122806_5123391_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65645.1|5123582_5123735_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWL65646.1|5123852_5124980_-|integrase	integrase	integrase	O21925	Phage_21	58.4	3.3e-119
AWL65647.1|5124960_5125206_-	excisionase	NA	NA	NA	NA	NA
AWL65648.1|5125258_5127397_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.5	5.6e-99
AWL65649.1|5127538_5127883_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL65650.1|5127925_5128120_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWL65651.1|5128129_5128348_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65652.1|5128962_5129352_-	transcriptional regulator	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
AWL65653.1|5129453_5129669_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
AWL65654.1|5129671_5130226_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65655.1|5130277_5131261_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	55.2	6.9e-44
AWL65656.1|5131253_5131718_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	3.1e-63
AWL65657.1|5131731_5132172_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWL65658.1|5132485_5134249_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AWL65659.1|5134860_5136711_+	abortive phage infection protein	NA	NA	NA	NA	NA
AWL65660.1|5137116_5137350_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
AWL65661.1|5137801_5138035_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	2.2e-25
AWL65662.1|5138046_5138337_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	6.1e-17
AWL65663.1|5138377_5138770_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
AWL65664.1|5138766_5138970_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65665.1|5138969_5140001_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.9	5.6e-97
AWL65666.1|5140017_5140620_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.4e-76
AWL65667.1|5142146_5142362_+|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWL65668.1|5142361_5142859_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	6.2e-78
AWL65669.1|5142855_5143206_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWL66159.1|5144281_5144479_-	hypothetical protein	NA	H6WRV6	Salmonella_phage	73.8	1.1e-20
AWL65670.1|5144806_5145169_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWL65671.1|5145120_5145438_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65672.1|5145434_5145866_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AWL65673.1|5146115_5146550_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWL65674.1|5146549_5148271_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
AWL65675.1|5148264_5148444_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
AWL65676.1|5148443_5149703_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
AWL65677.1|5149739_5150660_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.1e-148
AWL65678.1|5150737_5152024_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
AWL65679.1|5152082_5152343_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWL65680.1|5152323_5152641_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWL65681.1|5152637_5152976_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AWL65682.1|5152956_5153346_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWL65683.1|5153342_5153744_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	1.1e-61
AWL65684.1|5153775_5154237_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWL65685.1|5154294_5154660_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWL65686.1|5154680_5154893_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	88.9	3.7e-32
AWL65687.1|5154892_5158228_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.5	0.0e+00
AWL65688.1|5158227_5158566_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
AWL65689.1|5158562_5159318_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
AWL65690.1|5159319_5160030_+	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
AWL66160.1|5160065_5160401_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	44.1	2.1e-21
AWL65691.1|5160452_5161058_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	71.8	2.9e-77
AWL65692.1|5161120_5173708_+	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	49.9	0.0e+00
AWL65693.1|5173769_5175179_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.9	1.5e-84
AWL65694.1|5175601_5176660_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	30.3	7.0e-10
AWL65695.1|5177777_5177975_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65696.1|5178307_5178460_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	1.4e-17
AWL65697.1|5178733_5179447_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL65698.1|5179415_5179835_-	amino acid-binding protein	NA	NA	NA	NA	NA
AWL65699.1|5179827_5180151_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL65700.1|5180287_5180761_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWL65701.1|5180918_5181560_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL65702.1|5181850_5182396_+	cysteine hydrolase	NA	NA	NA	NA	NA
AWL65703.1|5182450_5182678_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AWL65704.1|5182789_5183983_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWL65705.1|5184593_5184779_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWL65706.1|5184869_5185364_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWL65707.1|5185390_5185897_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65708.1|5185912_5186800_+	manganese catalase family protein	NA	NA	NA	NA	NA
AWL65709.1|5186855_5188262_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWL65710.1|5188258_5189269_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWL65711.1|5189262_5190183_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL65712.1|5190179_5190392_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AWL65713.1|5190384_5192442_-	FUSC family protein	NA	NA	NA	NA	NA
AWL65714.1|5192519_5193314_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL65715.1|5193373_5193571_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65716.1|5194139_5194772_+	DNA-binding protein	NA	NA	NA	NA	NA
AWL65717.1|5195401_5196088_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWL65718.1|5196223_5196634_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65719.1|5196718_5198221_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AWL65720.1|5198340_5199240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL65721.1|5199236_5201021_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	5.8e-17
AWL65722.1|5201093_5202302_-	HD domain-containing protein	NA	NA	NA	NA	NA
AWL65723.1|5202605_5203649_+	type II asparaginase	NA	NA	NA	NA	NA
AWL65724.1|5204324_5205239_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	49.6	1.2e-71
AWL65725.1|5205328_5205967_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AWL65726.1|5206097_5206361_+	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWL65727.1|5206420_5206546_-	hypothetical protein	NA	NA	NA	NA	NA
AWL66161.1|5206664_5206781_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65728.1|5206738_5206840_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65729.1|5206897_5207911_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	5.5e-12
5208043:5208060	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AWL65730.1|5208145_5209159_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	3.8e-154
AWL65731.1|5209274_5209574_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.7e-36
AWL65732.1|5209694_5209973_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWL65733.1|5209993_5210212_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWL66162.1|5210227_5210605_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65734.1|5210620_5210884_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65735.1|5210961_5211186_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65736.1|5211182_5211749_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.7	7.2e-14
AWL66163.1|5211757_5211985_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AWL65737.1|5211981_5212917_+	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	53.8	3.2e-83
AWL65738.1|5212954_5215528_+	endonuclease	NA	A0A1S6L028	Salmonella_phage	59.7	6.2e-246
AWL65739.1|5215655_5216795_+	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	27.8	1.4e-16
AWL65740.1|5216806_5219029_+	peptidase S8 and S53, subtilisin, kexin, sedolisin	NA	NA	NA	NA	NA
AWL65741.1|5219192_5219408_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65742.1|5219594_5220656_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	4.8e-144
AWL65743.1|5220649_5222377_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	4.1e-233
AWL65744.1|5222533_5223373_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	5.6e-95
AWL65745.1|5223382_5224417_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	48.5	1.7e-93
AWL65746.1|5224466_5225324_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	4.9e-70
AWL65747.1|5225436_5225952_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	6.3e-41
AWL65748.1|5225951_5226152_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWL65749.1|5226142_5226427_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWL65750.1|5226423_5226969_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	1.1e-30
AWL66164.1|5226980_5227310_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWL65751.1|5227299_5227491_+	peptidase	NA	NA	NA	NA	NA
AWL65752.1|5227491_5227959_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	1.6e-46
AWL65753.1|5227955_5228591_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	7.8e-57
AWL65754.1|5228587_5229175_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	9.1e-60
AWL65755.1|5229171_5229522_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AWL65756.1|5229523_5230447_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.9	3.4e-53
AWL65757.1|5230436_5233463_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AWL65758.1|5233459_5233672_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65759.1|5233671_5234769_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	73.3	1.4e-08
AWL65760.1|5235002_5235641_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65761.1|5235637_5237623_-	DNA helicase	NA	NA	NA	NA	NA
AWL65762.1|5237981_5238440_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.4	4.0e-55
AWL65763.1|5238454_5241430_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	47.1	1.3e-223
AWL66165.1|5241416_5241575_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWL65764.1|5241574_5241892_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWL65765.1|5241937_5242453_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWL65766.1|5242452_5243625_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	2.9e-158
AWL65767.1|5243779_5244919_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
AWL66166.1|5244962_5245214_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWL65768.1|5245479_5245719_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
5245310:5245327	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AWL66167.1|5245708_5246065_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWL65769.1|5246051_5246561_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWL65770.1|5246706_5247399_+	hypothetical protein	NA	NA	NA	NA	NA
AWL65771.1|5247430_5248615_-	MFS transporter	NA	NA	NA	NA	NA
AWL66168.1|5248716_5249508_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL65772.1|5249491_5249938_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWL65773.1|5250055_5250556_-	hypothetical protein	NA	NA	NA	NA	NA
AWL65774.1|5250799_5251939_+	glycosyl transferase	NA	NA	NA	NA	NA
AWL65775.1|5252100_5252343_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	73.4	1.1e-27
AWL65776.1|5252953_5253259_-	DUF596 domain-containing protein	NA	NA	NA	NA	NA
AWL65777.1|5254218_5255127_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.6	1.7e-17
>prophage 1
CP029430	Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence	177029	42392	91660	177029	transposase	Escherichia_phage(25.0%)	56	NA	NA
AWL60424.1|42392_43761_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.2	1.9e-76
AWL60425.1|43955_44384_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60426.1|44556_45699_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWL60427.1|45708_45978_-	metal resistance protein	NA	NA	NA	NA	NA
AWL60428.1|46081_47380_-	MFS transporter	NA	NA	NA	NA	NA
AWL60429.1|47614_48373_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
AWL60430.1|48426_49347_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60431.1|49410_49782_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60432.1|49922_50612_-	transmembrane anchor protein	NA	NA	NA	NA	NA
AWL60433.1|50625_51363_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
AWL60434.1|51407_51773_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60435.1|52012_52279_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWL60436.1|52266_52752_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL60437.1|53045_54125_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AWL60438.1|54194_54356_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AWL60439.1|55051_55324_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60440.1|55320_55671_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60441.1|56307_56664_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AWL60442.1|56724_56937_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60443.1|56947_57172_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60444.1|57252_57573_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AWL60445.1|57562_57841_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AWL60446.1|57841_58255_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL60447.1|58768_58987_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60448.1|59084_59912_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AWL60449.1|59938_60268_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60450.1|60300_60786_-	lytic transglycosylase	NA	NA	NA	NA	NA
AWL60451.1|61812_62055_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60452.1|62929_63481_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60453.1|63473_63761_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60454.1|64634_65639_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWL60455.1|68760_69051_+	nucleotidyltransferase	NA	NA	NA	NA	NA
AWL60456.1|69047_69449_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWL60457.1|69594_70299_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60458.1|70989_71277_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60459.1|71260_72106_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL60460.1|72135_72654_-	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AWL60461.1|73384_73759_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
AWL60462.1|74294_74540_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60463.1|74619_74886_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60464.1|75055_75337_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
AWL60465.1|75404_75677_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	7.5e-09
AWL60466.1|76130_76877_-	oxidoreductase	NA	NA	NA	NA	NA
AWL60467.1|76869_77472_-	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
AWL60468.1|77939_78410_+	thiol-disulfide isomerase	NA	NA	NA	NA	NA
AWL60469.1|78541_78739_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60470.1|78735_79029_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
AWL60471.1|79087_79519_-	heme-binding protein	NA	NA	NA	NA	NA
AWL60472.1|79591_80605_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWL60473.1|81052_82021_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AWL60474.1|82017_82722_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWL60475.1|82862_83402_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AWL60476.1|83403_83847_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AWL60477.1|86165_87434_-|transposase	IS4 family transposase ISApu1	transposase	NA	NA	NA	NA
AWL60478.1|87751_88123_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60479.1|88762_91660_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 2
CP029430	Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence	177029	107120	167383	177029	transposase	Bacillus_phage(31.82%)	55	NA	NA
AWL60497.1|107120_107825_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60498.1|109164_109527_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL60499.1|109574_109928_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	2.8e-24
AWL60500.1|110182_110617_-	copper-binding protein	NA	NA	NA	NA	NA
AWL60501.1|110823_112224_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	6.4e-19
AWL60502.1|112220_112901_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-30
AWL60503.1|112941_113871_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AWL60504.1|113875_114256_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWL60505.1|114295_115192_-	copper resistance protein B	NA	NA	NA	NA	NA
AWL60506.1|115191_117009_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWL60507.1|117242_117692_+	copper resistance protein	NA	NA	NA	NA	NA
AWL60508.1|117980_118718_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AWL60509.1|118751_118949_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWL60510.1|118989_121437_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AWL60511.1|121563_122004_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60512.1|122090_125237_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.7	3.6e-62
AWL60513.1|125247_126540_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL60514.1|126653_127007_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL60515.1|127035_128421_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60516.1|128610_129291_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AWL60517.1|129283_130759_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWL60518.1|131004_131436_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWL60519.1|134304_135327_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL60520.1|136025_136355_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AWL60521.1|136335_136617_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AWL60522.1|136894_137875_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWL60523.1|137913_138039_-	ABC transporter	NA	NA	NA	NA	NA
AWL60524.1|138191_138692_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
AWL60525.1|139018_139723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWL60526.1|139713_139920_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60527.1|139946_140549_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60528.1|140808_141540_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWL60562.1|141772_142531_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60529.1|142596_142986_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60530.1|143051_143756_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWL60531.1|144484_145165_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWL60532.1|145219_146149_-	copper resistance protein D	NA	NA	NA	NA	NA
AWL60533.1|146153_146534_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWL60534.1|146573_147470_-	copper resistance protein B	NA	NA	NA	NA	NA
AWL60535.1|147469_149287_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWL60536.1|149520_149970_+	copper resistance protein	NA	NA	NA	NA	NA
AWL60537.1|150258_150996_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AWL60538.1|151029_151227_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWL60539.1|151267_153715_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AWL60540.1|153841_154282_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60541.1|154368_157515_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	6.1e-62
AWL60542.1|157525_158818_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL60543.1|158931_159285_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL60544.1|159313_160699_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60545.1|160888_161569_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWL60546.1|161561_163037_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	7.9e-28
AWL60547.1|163287_163719_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWL60548.1|163862_164213_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	1.2e-19
AWL60563.1|164600_165509_-	HNH endonuclease	NA	NA	NA	NA	NA
AWL60549.1|166221_167383_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.8	6.8e-51
>prophage 1
CP029431	Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence	435125	15327	95542	435125	transposase,integrase	Escherichia_phage(30.0%)	79	55755:55814	80682:81839
AWL60586.1|15327_16350_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL60587.1|16346_19412_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	5.1e-295
AWL60588.1|19579_20221_+	resolvase	NA	NA	NA	NA	NA
AWL60589.1|20484_22143_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWL60590.1|22304_22655_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL60591.1|22959_23436_-	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AWL60592.1|23550_23988_-	PaaI family thioesterase	NA	NA	NA	NA	NA
AWL60593.1|24148_24610_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AWL60594.1|24584_24905_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AWL60595.1|25198_25426_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60596.1|25604_26585_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
AWL61031.1|26623_26740_-	ABC transporter	NA	NA	NA	NA	NA
AWL61032.1|27263_27407_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	78.3	1.2e-13
AWL60597.1|29199_30429_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
AWL60598.1|30538_32437_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.0	8.7e-11
AWL60599.1|34284_35160_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL60600.1|35260_35551_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL60601.1|36137_36842_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60602.1|36932_37637_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60603.1|37676_38222_+	resolvase/recombinase	NA	Q1MVP4	Enterobacteria_phage	81.4	3.1e-70
AWL60604.1|38249_38957_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60605.1|38997_39612_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60606.1|39780_40548_+	DUF1883 domain-containing protein	NA	S6BFN8	Thermus_phage	46.4	9.8e-30
AWL60607.1|41309_41843_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AWL60608.1|42015_42330_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60609.1|42584_42941_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWL60610.1|43344_43635_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWL60611.1|43999_44455_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWL60612.1|44526_44877_+	mercuric transporter	NA	NA	NA	NA	NA
AWL60613.1|44892_45168_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWL60614.1|45195_45603_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWL60615.1|45641_47324_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
AWL60616.1|47341_47707_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWL60617.1|47703_47940_+	mercury resistance protein	NA	NA	NA	NA	NA
AWL61033.1|47923_48043_-	mercury resistance protein	NA	NA	NA	NA	NA
AWL60618.1|48005_48218_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWL60619.1|48348_48909_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
AWL60620.1|48911_51878_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
AWL60621.1|51956_52961_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL61034.1|54076_54721_-	resolvase	NA	NA	NA	NA	NA
AWL60622.1|55019_55379_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60623.1|55362_55668_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60624.1|55700_55922_-	resolvase	NA	NA	NA	NA	NA
55755:55814	attL	CAGTGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGC	NA	NA	NA	NA
AWL60625.1|55963_56728_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL60626.1|56870_57137_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWL60627.1|57357_57831_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AWL60628.1|57986_59000_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL60629.1|58938_59253_+|transposase	transposase	transposase	NA	NA	NA	NA
AWL60630.1|59392_59962_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWL60631.1|60383_61088_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60632.1|64314_65634_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL60633.1|65883_66765_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWL60634.1|67151_67931_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL60635.1|67927_68953_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWL60636.1|69059_72089_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AWL60637.1|72198_73914_+|integrase	integrase	integrase	NA	NA	NA	NA
AWL60638.1|75266_75971_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL61035.1|76006_76312_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AWL60639.1|76347_76659_+	hypothetical protein	NA	NA	NA	NA	NA
AWL61036.1|76867_77356_+	restriction endonuclease	NA	NA	NA	NA	NA
AWL60640.1|77360_77567_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60641.1|77948_79382_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWL60642.1|79415_80624_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWL60643.1|80636_80849_-	resolvase	NA	NA	NA	NA	NA
AWL60644.1|80890_81655_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWL60645.1|81742_81856_+	NTP-binding protein	NA	NA	NA	NA	NA
80682:81839	attR	CAGTGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAGCTCCTGACAGTTCAATATCAGAAGTGATCTGCACCAATCTCGACTATGCTCAATACTCGTGTGCACCAAAGCGAGGTGAGCATGGCGACGGAGGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGGCGGCTGCTGCGAAATGGTGGTTGAGCATGCCCATGGCCTCCGTCAGCGCCGAGGGCCCAATGCCAAAAGCTCTCTCCACAAGGCGCACCTCGCCCCTGATGCCGGGCTGCAGGCACCAGGGGCGAGCCTGTCCTTTGCGCAGGGCTCGCATGACTTCGAATCCCTTGATCGTGGCATAGGCCGTGGGGATCGATTTGAAACCGCGCACCGGCTTGATCAGTATCTTGAGCTTTCCGTGATCGGCCTCGATCACGTTATTGAGATACTTCACCTGCCGGTGGGCCGTCTCCCGGTCCAGCTTTCCTTCGCGCTTCAATTCGGTGATCGCTGCACCATAGCTCGGCGCTTTGTCGGTATTGAGCGTGGCAGGCTTTTCCCAGTGCTTCAGGCCTCGCAGGGCCTTGCCCAGGAACCGCTTCGCTGCCTTGGCGCTGCGGGTCGGCGACAGGTAGAAATCGATCGTGTCGCCCCGCTTGTCGACTGCCCGGTACAGGTAGGTCCACTTGCCCCGCACCTTGACGTAGGTTTCATCCAGGCGCCAGCTCGGATCAAAGCCACGCCGCCAGAACCAGCGCAGCCGCTTCTCCATCTCCGGGGCGTAGCACTGGACCCAGCGATAGATCGTCGTATGGTCGACCGAAATGCCGCGTTCCGCCAGCATTTCCTCAAGGTCGCGATAGCTGATCGGATAGCGACAATACCAGCGCACCGCCCACAGGATCACATCACCCTGGAAATGGCGCCACTTGAAATCCGTCATCGTTCCGTCCGTCCAATCTCCGCCAAGCATGCTCAAGCTTCACGATTTTTGCAACAGAGCCCACACGAGTATTGAGCATAGTCGAGATTGGTGCAGATCACTTCTGATATTGAACTGTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACA	NA	NA	NA	NA
AWL60646.1|82161_82662_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL60647.1|82680_82860_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60648.1|82789_83629_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL60649.1|83828_84485_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
AWL60650.1|84817_86359_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWL60651.1|86763_87603_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL60652.1|87596_87944_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL61037.1|88100_88634_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AWL60653.1|89379_90084_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60654.1|90565_90889_+|transposase	transposase	transposase	NA	NA	NA	NA
AWL60655.1|90926_91484_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWL60656.1|91486_94459_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AWL60657.1|94537_95542_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
>prophage 2
CP029431	Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-435, complete sequence	435125	194218	250511	435125	protease,transposase	uncultured_Caudovirales_phage(30.0%)	48	NA	NA
AWL60781.1|194218_197227_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AWL60782.1|197390_197963_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
AWL60783.1|197971_198376_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL60784.1|198406_198832_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
AWL60785.1|198844_200134_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.6e-170
AWL60786.1|200182_201934_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL60787.1|201951_202314_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL60788.1|202361_202715_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
AWL60789.1|203925_204267_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	3.6e-24
AWL60790.1|204394_205351_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL60791.1|205347_206319_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL60792.1|206311_207811_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.6e-12
AWL60793.1|207843_208830_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AWL60794.1|208955_209144_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60795.1|209255_210053_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60796.1|210191_211091_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.9	6.3e-12
AWL60797.1|211053_214431_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	30.2	4.6e-39
AWL60798.1|214631_215870_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL60799.1|215923_216850_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
AWL60800.1|216863_218036_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
AWL60801.1|218019_218769_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-16
AWL60802.1|218779_219469_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.1e-19
AWL60803.1|219501_220512_+	formamidase	NA	NA	NA	NA	NA
AWL60804.1|220612_221656_+	aliphatic amidase	NA	NA	NA	NA	NA
AWL61045.1|221701_222754_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	31.0	3.8e-32
AWL60805.1|222725_223022_-	hypothetical protein	NA	NA	NA	NA	NA
AWL61046.1|223544_225656_+	hypothetical protein	NA	A0A2L1IV38	Escherichia_phage	45.6	6.9e-17
AWL60806.1|225660_228558_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWL60807.1|228652_229258_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWL60808.1|230706_230943_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60809.1|231203_231422_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60810.1|231704_232028_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60811.1|232063_232987_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60812.1|233167_233395_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60813.1|233713_234112_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60814.1|234133_234451_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60815.1|234538_235024_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60816.1|235434_236301_-	repA protein	NA	J9Q7H0	Salmonella_phage	37.2	8.4e-46
AWL60817.1|236873_237122_-	hypothetical protein	NA	NA	NA	NA	NA
AWL61047.1|238083_239166_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
AWL60818.1|239220_239490_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60819.1|240606_241611_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWL60820.1|241959_242955_-	glycosyl transferase	NA	NA	NA	NA	NA
AWL60821.1|243015_243843_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.0e-53
AWL60822.1|243861_245340_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.6	8.6e-200
AWL60823.1|245765_246389_+	serine recombinase	NA	NA	NA	NA	NA
AWL60824.1|246443_249428_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
AWL60825.1|249506_250511_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP029429	Klebsiella quasipneumoniae strain CAV2018 plasmid pKPC_CAV2018-63, complete sequence	63235	14480	41686	63235	transposase,integrase,tRNA	Escherichia_phage(28.57%)	28	15178:15194	47863:47879
AWL60331.1|14480_14750_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
15178:15194	attL	TAGTTACAACATTCAAC	NA	NA	NA	NA
AWL60332.1|15262_15532_-|transposase	transposase	transposase	NA	NA	NA	NA
AWL60333.1|15470_16484_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL60334.1|17076_17550_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
AWL60335.1|17658_17949_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AWL60336.1|18053_18401_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWL60337.1|18394_19234_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWL60338.1|19163_19343_-	hypothetical protein	NA	NA	NA	NA	NA
AWL60339.1|19361_19862_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL60340.1|20167_20281_-	NTP-binding protein	NA	NA	NA	NA	NA
AWL60341.1|20677_21997_+|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWL60342.1|22246_23128_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWL60343.1|23514_24294_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWL60344.1|24290_25316_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AWL60345.1|25422_28452_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AWL60346.1|28748_29258_-	DNA invertase	NA	A0A0F7LA37	Escherichia_phage	50.6	1.1e-32
AWL60347.1|29875_30172_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AWL60348.1|30344_31724_+	replication protein	NA	D2XQ07	Bacillus_virus	23.0	3.5e-09
AWL60349.1|31894_32236_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60350.1|32219_32498_+	hypothetical protein	NA	NA	NA	NA	NA
AWL60351.1|32608_33034_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	38.1	3.6e-18
AWL60352.1|33362_33659_+	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AWL60353.1|33663_34731_+	TraN	NA	A0A0R6PHM5	Moraxella_phage	35.7	1.4e-34
AWL60354.1|35063_36338_+|transposase	IS4-like element ISApu2 family transposase	transposase	NA	NA	NA	NA
AWL60355.1|36644_37349_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL60356.1|37432_38317_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWL60357.1|38372_39848_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWL60358.1|40508_41686_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	67.2	5.8e-122
47863:47879	attR	GTTGAATGTTGTAACTA	NA	NA	NA	NA
