The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029336	Salmonella enterica subsp. enterica serovar Montevideo strain CFSAN051296 chromosome, complete genome	4694373	1141328	1207052	4694373	lysis,plate,capsid,tRNA,tail,portal,integrase,head	Salmonella_phage(89.58%)	67	1142773:1142819	1178065:1178111
AWK63824.1|1141328_1142570_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
1142773:1142819	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWK63825.1|1142935_1144159_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	38.9	3.2e-75
AWK63826.1|1144163_1145183_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.6e-190
AWK63827.1|1145184_1145817_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	95.2	1.2e-110
AWK63828.1|1146212_1146722_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
AWK67127.1|1146729_1146930_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
AWK63829.1|1146893_1147235_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AWK63830.1|1147302_1147536_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
AWK63831.1|1147535_1147763_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	90.7	9.6e-34
AWK63832.1|1147759_1148614_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	76.4	3.0e-120
AWK63833.1|1148610_1149441_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	76.4	9.3e-127
AWK63834.1|1149437_1151813_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	92.3	0.0e+00
AWK63835.1|1151966_1152155_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AWK63836.1|1152093_1152399_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWK63837.1|1152458_1153190_+	hypothetical protein	NA	NA	NA	NA	NA
AWK63838.1|1153564_1155331_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	34.3	1.5e-78
AWK63839.1|1155372_1156410_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.4	9.7e-182
AWK63840.1|1156409_1158176_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.0	0.0e+00
AWK63841.1|1158318_1159152_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.1	5.0e-120
AWK63842.1|1159168_1160236_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	4.8e-192
AWK63843.1|1160239_1160890_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	97.2	1.7e-112
AWK63844.1|1160985_1161450_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AWK63845.1|1161449_1161653_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWK63846.1|1161656_1161872_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AWK63847.1|1161852_1162362_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	1.1e-93
AWK63848.1|1162366_1162744_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.8	1.7e-59
AWK63849.1|1162743_1163169_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	5.5e-67
AWK63850.1|1163098_1163302_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	94.0	4.8e-29
AWK63851.1|1163264_1163696_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.7	1.7e-71
AWK63852.1|1163688_1164135_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	2.4e-65
AWK63853.1|1164203_1164782_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	3.9e-108
AWK63854.1|1164778_1165138_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	96.6	1.8e-58
AWK63855.1|1165124_1166033_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.7	1.6e-159
AWK63856.1|1166025_1166631_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	8.3e-117
AWK63857.1|1167918_1168536_+|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	97.9	1.2e-110
AWK63858.1|1168539_1169079_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.8	2.1e-95
AWK63859.1|1169081_1169915_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	97.8	1.3e-157
AWK67128.1|1169850_1170405_-	shikimate transporter	NA	A0A1S6KZZ0	Salmonella_phage	93.3	1.7e-87
AWK63860.1|1170434_1170992_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	97.8	7.2e-99
AWK63861.1|1171094_1172267_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
AWK63862.1|1172276_1172792_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	2.3e-91
AWK63863.1|1172846_1173149_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AWK63864.1|1173163_1173283_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AWK63865.1|1173275_1176083_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.6	0.0e+00
AWK63866.1|1176079_1176565_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AWK63867.1|1176561_1177662_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.5	3.5e-190
AWK63868.1|1177730_1177949_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
AWK67129.1|1178500_1179664_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1178065:1178111	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWK63869.1|1179671_1181852_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AWK63870.1|1181848_1183258_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AWK63871.1|1183322_1194797_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AWK67130.1|1195411_1195894_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AWK63872.1|1196043_1196520_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWK63873.1|1196509_1196800_+	RnfH family protein	NA	NA	NA	NA	NA
AWK63874.1|1196961_1197300_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWK63875.1|1197448_1199110_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWK63876.1|1199195_1200074_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWK67131.1|1200005_1200200_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWK63877.1|1200196_1200787_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWK63878.1|1200821_1201427_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWK63879.1|1201547_1202789_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWK63880.1|1202853_1203645_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWK63881.1|1203590_1203887_-	hypothetical protein	NA	NA	NA	NA	NA
AWK63882.1|1203810_1205172_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWK63883.1|1205424_1205673_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWK67132.1|1205691_1206240_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWK63884.1|1206284_1207052_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP029336	Salmonella enterica subsp. enterica serovar Montevideo strain CFSAN051296 chromosome, complete genome	4694373	1468325	1547007	4694373	holin,lysis,terminase,tRNA,protease,tail,head	Salmonella_phage(62.67%)	104	NA	NA
AWK64102.1|1468325_1469264_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AWK64103.1|1469627_1469948_+	helicase	NA	NA	NA	NA	NA
AWK64104.1|1470860_1471667_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWK64105.1|1471677_1472694_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWK64106.1|1474096_1474300_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
AWK64107.1|1474396_1474747_-	hypothetical protein	NA	I6R980	Salmonella_phage	99.1	5.4e-60
AWK64108.1|1474803_1475604_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	97.4	4.1e-156
AWK64109.1|1475646_1475931_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	98.9	7.0e-50
AWK64110.1|1475923_1476844_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	82.9	1.9e-80
AWK64111.1|1477135_1477804_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	73.0	3.1e-40
AWK64112.1|1477800_1478316_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	98.8	1.1e-96
AWK64113.1|1478425_1479007_-	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	72.0	2.8e-69
AWK64114.1|1479003_1479174_-	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AWK64115.1|1479184_1479478_-	DUF2856 domain-containing protein	NA	E7C9P8	Salmonella_phage	97.9	2.1e-49
AWK64116.1|1479524_1479809_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AWK64117.1|1479808_1480516_-	recombinase	NA	I6R0N0	Salmonella_phage	87.6	5.2e-118
AWK64118.1|1480645_1480834_-	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AWK67142.1|1480814_1480988_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AWK64119.1|1481057_1481372_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
AWK64120.1|1481543_1482158_-	pentapeptide repeat-containing protein	NA	A0A220NQW1	Salmonella_phage	70.6	3.2e-47
AWK64121.1|1482241_1482487_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	62.3	2.5e-19
AWK64122.1|1482494_1482827_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	96.4	4.6e-53
AWK64123.1|1483177_1483840_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
AWK64124.1|1483958_1484174_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AWK64125.1|1484284_1484566_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AWK64126.1|1484600_1484747_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AWK64127.1|1484739_1485573_+	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.2	2.3e-149
AWK64128.1|1485569_1486946_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	98.9	4.1e-252
AWK64129.1|1487018_1487225_+	hypothetical protein	NA	I6RSI5	Salmonella_phage	98.5	5.3e-31
AWK64130.1|1487403_1487670_+	hypothetical protein	NA	Q716C8	Shigella_phage	61.2	3.1e-23
AWK64131.1|1487672_1487861_+	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	90.3	3.7e-23
AWK64132.1|1487817_1488264_+	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	98.6	2.3e-79
AWK64133.1|1488260_1488434_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AWK64134.1|1488400_1488577_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	2.3e-27
AWK64135.1|1488579_1488981_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
AWK64136.1|1488973_1489150_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	3.1e-24
AWK64137.1|1489142_1489361_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
AWK64138.1|1489361_1489652_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
AWK64139.1|1489648_1490044_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	96.9	2.2e-70
AWK64140.1|1490040_1490244_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AWK64141.1|1490313_1490937_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AWK67143.1|1491361_1491700_+	Fis family transcriptional regulator	NA	A0A1W6DXT8	Salmonella_phage	50.0	1.1e-22
AWK64142.1|1491893_1492073_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67144.1|1492079_1492286_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	76.8	6.2e-16
AWK64143.1|1492397_1492724_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AWK64144.1|1492707_1493145_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	96.6	2.6e-72
AWK64145.1|1493141_1493603_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	79.3	4.5e-54
AWK64146.1|1493821_1494343_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	98.8	5.5e-93
AWK64147.1|1494807_1495239_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
AWK64148.1|1495222_1496542_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	99.1	4.6e-261
AWK64149.1|1496603_1496870_+	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	100.0	8.3e-45
AWK64150.1|1497110_1498460_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	98.9	9.1e-257
AWK64151.1|1498419_1499346_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	97.7	2.2e-169
AWK64152.1|1499348_1500614_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	97.1	2.0e-229
AWK64153.1|1500626_1501076_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
AWK64154.1|1501093_1502170_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.7	9.0e-207
AWK64155.1|1502179_1502359_+	glycoprotein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
AWK64156.1|1502410_1502812_+	hypothetical protein	NA	I6S619	Salmonella_phage	97.7	7.8e-71
AWK64157.1|1502811_1503000_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	100.0	1.4e-30
AWK64158.1|1502983_1503346_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	99.2	1.2e-67
AWK64159.1|1503353_1503749_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	99.2	5.5e-69
AWK64160.1|1503745_1504132_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	97.7	3.8e-67
AWK64161.1|1504147_1504885_+	hypothetical protein	NA	Q5G8X3	Enterobacteria_phage	98.0	2.3e-129
AWK64162.1|1504930_1505584_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.2	3.3e-119
AWK64163.1|1505805_1506534_+	DNA-binding protein	NA	I6S1R0	Salmonella_phage	98.8	3.4e-141
AWK64164.1|1506575_1506953_-	Arc family DNA-binding protein	NA	I6RSL2	Salmonella_phage	100.0	1.3e-64
AWK64165.1|1507068_1507239_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	100.0	5.7e-23
AWK64166.1|1507231_1508206_+	phage antirepressor Ant	NA	I6S627	Salmonella_phage	99.7	3.8e-188
AWK64167.1|1509023_1512218_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	58.1	1.1e-255
AWK64168.1|1512245_1512467_+	hypothetical protein	NA	NA	NA	NA	NA
AWK64169.1|1512523_1512871_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	97.4	2.2e-61
AWK64170.1|1512867_1513155_+	hypothetical protein	NA	NA	NA	NA	NA
AWK64171.1|1513197_1513902_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	1.6e-135
AWK64172.1|1513901_1514621_+|tail	phage tail protein	tail	I6S1R8	Salmonella_phage	92.1	7.3e-136
AWK64173.1|1514563_1515091_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	93.8	6.4e-65
AWK64174.1|1515100_1518280_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	96.0	0.0e+00
AWK64175.1|1518288_1519248_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
AWK64176.1|1519258_1520557_+|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.5	4.5e-245
AWK64177.1|1520628_1521798_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	99.2	2.7e-228
AWK64178.1|1522111_1523053_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.1e-147
AWK64179.1|1523341_1524097_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWK64180.1|1524157_1525465_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AWK64181.1|1525835_1526120_+	DUF406 family protein	NA	NA	NA	NA	NA
AWK64182.1|1526297_1527608_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWK64183.1|1527607_1529755_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWK64184.1|1529963_1530449_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AWK64185.1|1530548_1531100_-	endonuclease SmrB	NA	NA	NA	NA	NA
AWK64186.1|1531265_1532198_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWK64187.1|1532233_1533319_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AWK64188.1|1533322_1534147_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWK64189.1|1534146_1534956_+	hypothetical protein	NA	NA	NA	NA	NA
AWK64190.1|1534955_1535504_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWK64191.1|1535536_1535812_+	YfcL family protein	NA	NA	NA	NA	NA
AWK64192.1|1535863_1537924_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWK64193.1|1538023_1539238_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWK64194.1|1539335_1539992_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWK64195.1|1540058_1540577_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWK64196.1|1540788_1540971_-	DNA-binding protein	NA	NA	NA	NA	NA
AWK64197.1|1541143_1541518_+	hypothetical protein	NA	NA	NA	NA	NA
AWK64198.1|1541697_1542876_+	MFS transporter	NA	NA	NA	NA	NA
AWK64199.1|1542872_1543874_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AWK64200.1|1543977_1545114_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
AWK64201.1|1545181_1546195_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWK64202.1|1546194_1547007_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP029336	Salmonella enterica subsp. enterica serovar Montevideo strain CFSAN051296 chromosome, complete genome	4694373	1746584	1755758	4694373	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AWK64393.1|1746584_1747532_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AWK64394.1|1747515_1748247_+	ABC transporter permease	NA	NA	NA	NA	NA
AWK64395.1|1748227_1748335_-	hypothetical protein	NA	NA	NA	NA	NA
AWK64396.1|1748394_1749126_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AWK67150.1|1749351_1751037_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.9	3.4e-277
AWK64397.1|1751033_1751753_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWK64398.1|1751799_1752267_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AWK64399.1|1752323_1752854_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AWK64400.1|1753025_1753484_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AWK64401.1|1753724_1755758_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP029336	Salmonella enterica subsp. enterica serovar Montevideo strain CFSAN051296 chromosome, complete genome	4694373	1912932	1920199	4694373		Morganella_phage(33.33%)	8	NA	NA
AWK64546.1|1912932_1913352_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AWK64547.1|1913354_1914623_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AWK64548.1|1915077_1915290_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AWK67157.1|1915300_1915489_+	cold-shock protein	NA	NA	NA	NA	NA
AWK64549.1|1915747_1916959_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
AWK64550.1|1917608_1917908_+	hypothetical protein	NA	NA	NA	NA	NA
AWK64551.1|1917999_1918695_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
AWK64552.1|1918768_1920199_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
CP029336	Salmonella enterica subsp. enterica serovar Montevideo strain CFSAN051296 chromosome, complete genome	4694373	2718391	2722811	4694373		Escherichia_phage(50.0%)	6	NA	NA
AWK65330.1|2718391_2718631_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
AWK67190.1|2719510_2720320_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AWK65331.1|2720392_2720770_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AWK65332.1|2720917_2721460_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
AWK65333.1|2721652_2722381_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AWK65334.1|2722397_2722811_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
