The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	1210111	1223654	4258077	capsid,terminase,tail,head,tRNA,portal,protease,integrase	Clostridium_phage(33.33%)	17	1211881:1211904	1225311:1225334
AWK50470.1|1210111_1210846_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWK50471.1|1211004_1211439_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWK50472.1|1211465_1211858_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
1211881:1211904	attL	ACAAACTTATTGTTTGTGGGTTTT	NA	NA	NA	NA
AWK50473.1|1212185_1213385_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	27.6	2.5e-24
AWK50474.1|1213385_1213895_-	hypothetical protein	NA	NA	NA	NA	NA
AWK50475.1|1214096_1214285_+	DNA-binding protein	NA	NA	NA	NA	NA
AWK50476.1|1214299_1216444_+	DNA primase	NA	A0A173H0P8	Pseudoalteromonas_phage	32.7	9.5e-06
AWK53038.1|1216563_1216839_+	hypothetical protein	NA	NA	NA	NA	NA
AWK50477.1|1217084_1217312_+	hypothetical protein	NA	NA	NA	NA	NA
AWK50478.1|1217520_1218714_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	38.3	7.2e-64
AWK50479.1|1218785_1219343_+|head,protease	HK97 family phage prohead protease	head,protease	D7PQ42	Enterococcus_phage	31.9	2.1e-18
AWK50480.1|1219346_1220600_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
AWK50481.1|1220658_1220922_+	DNA packaging protein	NA	A0A0A7RWM0	Clostridium_phage	48.4	1.1e-09
AWK50482.1|1220926_1221232_+	HNH endonuclease	NA	A0A0C5AEM7	Paenibacillus_phage	44.2	5.8e-10
AWK50483.1|1221340_1221673_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.4	1.4e-17
AWK50484.1|1221669_1223313_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.5	5.5e-163
AWK50485.1|1223327_1223654_+|head,tail	head-tail adaptor protein	head,tail	A6M954	Geobacillus_virus	42.9	4.3e-11
1225311:1225334	attR	ACAAACTTATTGTTTGTGGGTTTT	NA	NA	NA	NA
>prophage 2
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	1397589	1431802	4258077	coat,protease,transposase,tRNA	Bacillus_virus(50.0%)	24	NA	NA
AWK50617.1|1397589_1398141_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWK50618.1|1398189_1398861_-	manganese catalase	NA	NA	NA	NA	NA
AWK50619.1|1399070_1400516_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWK50620.1|1400742_1400949_+	acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	43.5	2.4e-07
AWK50621.1|1401861_1402068_+	acid-soluble spore protein	NA	G3MAF8	Bacillus_virus	45.9	1.4e-07
AWK50622.1|1402576_1404637_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	32.1	2.0e-77
AWK50623.1|1410239_1411172_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AWK50624.1|1411656_1413039_+	peptidase C69	NA	NA	NA	NA	NA
AWK50625.1|1413042_1414386_+	TldD/PmbA family protein	NA	NA	NA	NA	NA
AWK50626.1|1414693_1416559_-	LTA synthase family protein	NA	NA	NA	NA	NA
AWK50627.1|1416909_1417482_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
AWK50628.1|1417530_1418493_+	pyridine nucleotide-disulfide oxidoreductase	NA	G3MA85	Bacillus_virus	24.5	1.3e-07
AWK50629.1|1418554_1419118_-	GDSL family lipase	NA	NA	NA	NA	NA
AWK50630.1|1419136_1419835_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
AWK50631.1|1420471_1421491_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.9	2.8e-64
AWK50632.1|1421499_1422501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWK50633.1|1422870_1424349_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWK50634.1|1424507_1425731_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.0	1.2e-18
AWK50635.1|1426083_1426398_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWK50636.1|1426403_1427546_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK50637.1|1427569_1428700_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWK50638.1|1428865_1429882_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
AWK53039.1|1429868_1430699_+|coat	spore coat protein	coat	NA	NA	NA	NA
AWK50639.1|1430764_1431802_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
>prophage 3
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	1885467	1894720	4258077	integrase	Clostridium_phage(28.57%)	11	1877867:1877882	1901782:1901797
1877867:1877882	attL	TTTAATAATTGAAATT	NA	NA	NA	NA
AWK51015.1|1885467_1886628_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	38.2	3.9e-62
AWK51016.1|1886975_1887350_-	XRE family transcriptional regulator	NA	A0A090D830	Clostridium_phage	34.7	4.9e-11
AWK51017.1|1887604_1887829_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK51018.1|1887994_1888216_+	transcriptional regulator	NA	A0A2I7SCU5	Paenibacillus_phage	52.4	7.2e-10
AWK51019.1|1888298_1888490_+	hypothetical protein	NA	NA	NA	NA	NA
AWK51020.1|1888631_1889876_+	phage replisome organizer	NA	V9QKF6	Oenococcus_phage	55.5	7.9e-29
AWK53051.1|1889925_1890552_+	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	36.6	1.7e-27
AWK51021.1|1890602_1890845_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	50.0	1.2e-13
AWK51022.1|1891703_1891922_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWK51023.1|1891965_1892190_-	hypothetical protein	NA	NA	NA	NA	NA
AWK51024.1|1892986_1894720_+	carboxylesterase	NA	A0A0M4JT58	Mollivirus	30.2	1.0e-21
1901782:1901797	attR	AATTTCAATTATTAAA	NA	NA	NA	NA
>prophage 4
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	2112417	2124065	4258077		Cyanophage(25.0%)	9	NA	NA
AWK51202.1|2112417_2113101_+	polar amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.3e-28
AWK51203.1|2113322_2113490_+	cytochrome C551	NA	NA	NA	NA	NA
AWK51204.1|2114115_2117862_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	28.0	2.5e-30
AWK51205.1|2118102_2118582_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.7	9.1e-26
AWK51206.1|2118581_2119289_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	43.3	1.1e-46
AWK51207.1|2119323_2120742_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	4.3e-55
AWK51208.1|2120780_2121782_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.7	5.9e-67
AWK51209.1|2121769_2122378_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	35.3	1.6e-22
AWK51210.1|2122556_2124065_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	S4VT61	Pandoravirus	36.6	1.7e-46
>prophage 5
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	3223228	3290117	4258077	coat,protease,transposase	uncultured_Caudovirales_phage(50.0%)	53	NA	NA
AWK53096.1|3223228_3223471_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWK52100.1|3223489_3223918_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWK52101.1|3224111_3224291_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AWK52102.1|3224624_3226019_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52103.1|3226091_3226892_-	protein-L-IsoD	NA	NA	NA	NA	NA
AWK52104.1|3227214_3228789_-	ABC transporter permease	NA	NA	NA	NA	NA
AWK52105.1|3228790_3229918_-	proline/glycine betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.5	1.7e-30
AWK52106.1|3230161_3230788_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWK52107.1|3231330_3231510_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52108.1|3231674_3232085_-	universal stress protein	NA	NA	NA	NA	NA
AWK52109.1|3232688_3234263_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52110.1|3234587_3235328_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AWK52111.1|3235552_3236629_+	DNA helicase UvrC	NA	NA	NA	NA	NA
AWK52112.1|3236995_3237418_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52113.1|3237552_3237819_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52114.1|3237849_3239547_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	7.3e-09
AWK52115.1|3240828_3242523_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AWK52116.1|3243509_3245030_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
AWK52117.1|3248111_3248405_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AWK52118.1|3248420_3249452_-	subtype I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AWK52119.1|3249448_3250123_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AWK52120.1|3250119_3250989_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
AWK52121.1|3250991_3252704_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
AWK52122.1|3252700_3253357_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AWK52123.1|3253513_3254992_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWK52124.1|3255204_3257379_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
AWK52125.1|3259389_3259590_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52126.1|3259711_3260410_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52127.1|3260578_3262891_-	histidine kinase	NA	W8CYF6	Bacillus_phage	30.2	2.4e-23
AWK52128.1|3263240_3264965_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.0	1.2e-14
AWK52129.1|3265360_3265678_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52130.1|3265789_3265972_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52131.1|3266366_3266585_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWK52132.1|3266762_3267356_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52133.1|3267582_3268878_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52134.1|3269801_3270224_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52135.1|3270406_3270994_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AWK52136.1|3271289_3271847_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	74.6	2.1e-53
AWK52137.1|3272788_3273877_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52138.1|3273972_3274350_-	hypothetical protein	NA	NA	NA	NA	NA
AWK53097.1|3274660_3274978_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52139.1|3275449_3275767_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52140.1|3275979_3276588_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AWK52141.1|3276743_3278330_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
AWK52142.1|3278609_3279473_-	putative beta-lysine N-acetyltransferase	NA	NA	NA	NA	NA
AWK52143.1|3279459_3280731_-	lysine 2,3-aminomutase	NA	NA	NA	NA	NA
AWK52144.1|3280760_3281609_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWK52145.1|3281865_3282108_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52146.1|3283216_3283834_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWK52147.1|3283888_3285085_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	44.9	6.3e-68
AWK52148.1|3285993_3287166_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AWK52149.1|3287173_3288862_-	histidine kinase	NA	NA	NA	NA	NA
AWK52150.1|3289169_3290117_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	3347156	3374340	4258077	capsid,terminase,tail,head,portal,integrase	Bacteriophage(21.74%)	39	3355592:3355607	3368855:3368870
AWK52202.1|3347156_3347816_-|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	32.6	8.1e-25
AWK52203.1|3347815_3348967_-	hypothetical protein	NA	A0A059WFM2	Vibrio_phage	35.3	5.5e-61
AWK52204.1|3348959_3349283_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52205.1|3349285_3349825_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52206.1|3349829_3350030_-	hypothetical protein	NA	NA	NA	NA	NA
AWK53102.1|3350029_3350878_-	hypothetical protein	NA	A0A2K9V2R4	Faecalibacterium_phage	29.6	7.5e-31
AWK52207.1|3350953_3351184_-	hypothetical protein	NA	A0A2K9V2S8	Faecalibacterium_phage	47.8	2.3e-11
AWK52208.1|3351158_3353231_-	hypothetical protein	NA	A0A1U9WQS5	Geobacillus_phage	34.4	2.1e-42
AWK53103.1|3353396_3353714_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52209.1|3353817_3354330_-|tail	phage tail protein	tail	A0A0C5AJ56	Bacteriophage	35.1	5.2e-19
AWK52210.1|3354329_3355754_-	hypothetical protein	NA	A0A2K9V2R6	Faecalibacterium_phage	33.7	1.7e-72
3355592:3355607	attL	TTTCAGCTTCTTGCAG	NA	NA	NA	NA
AWK52211.1|3355769_3356294_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52212.1|3356295_3356919_-	hypothetical protein	NA	H7BW77	unidentified_phage	26.3	1.4e-05
AWK52213.1|3356920_3357232_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52214.1|3357221_3357500_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52215.1|3357475_3358498_-|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	42.8	8.1e-72
AWK52216.1|3358513_3358876_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	45.0	1.1e-18
AWK52217.1|3358875_3359952_-	hypothetical protein	NA	A0A1L2BY92	Clostridium_phage	47.3	6.8e-53
AWK52218.1|3359938_3361486_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	61.9	1.1e-170
AWK52219.1|3361513_3361750_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	55.8	8.7e-14
AWK52220.1|3361760_3363584_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	53.2	3.9e-178
AWK52221.1|3363558_3364155_-	hypothetical protein	NA	A0A2K9V441	Faecalibacterium_phage	29.5	1.5e-14
AWK52222.1|3364490_3364853_-	hypothetical protein	NA	A0A1V0E034	Clostridioides_phage	35.8	7.6e-09
AWK52223.1|3365004_3365619_-|integrase	site-specific integrase	integrase	Q8SBK8	Clostridium_phage	45.1	3.3e-36
AWK52224.1|3365615_3365843_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52225.1|3366039_3366432_-	nitroreductase	NA	NA	NA	NA	NA
AWK52226.1|3366546_3366747_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52227.1|3366785_3367016_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52228.1|3367047_3367257_-	hypothetical protein	NA	NA	NA	NA	NA
AWK53104.1|3367453_3368101_-	hypothetical protein	NA	A0A2H4J8I2	uncultured_Caudovirales_phage	41.2	3.5e-36
AWK52229.1|3368428_3368659_-	hypothetical protein	NA	NA	NA	NA	NA
AWK53105.1|3368675_3368831_-	MarR family transcriptional regulator	NA	A0A1L2BY84	Clostridium_phage	51.0	6.1e-08
AWK52230.1|3368996_3370316_-	replicative DNA helicase	NA	O80281	Escherichia_phage	43.5	1.5e-86
3368855:3368870	attR	TTTCAGCTTCTTGCAG	NA	NA	NA	NA
AWK52231.1|3370317_3371166_-	hypothetical protein	NA	G4W992	Tetrasphaera_phage	45.5	3.1e-16
AWK52232.1|3371183_3372071_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AWK52233.1|3372055_3372808_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.5	7.8e-32
AWK52234.1|3373012_3373507_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52235.1|3373641_3373890_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK52236.1|3373905_3374340_-	transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	54.9	1.8e-36
>prophage 7
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	3689719	3750409	4258077	transposase,integrase	Leptospira_phage(14.29%)	56	3701881:3701900	3715438:3715457
AWK52516.1|3689719_3691330_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.9	3.8e-68
AWK52517.1|3691429_3691780_-	IS66 family insertion sequence hypothetical protein	NA	S5VXZ8	Leptospira_phage	44.8	9.6e-17
AWK52518.1|3691772_3692096_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52519.1|3692425_3692959_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52520.1|3693073_3693598_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52521.1|3693751_3694282_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52522.1|3694614_3695769_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52523.1|3697648_3698914_-	MFS transporter	NA	NA	NA	NA	NA
AWK52524.1|3698979_3701625_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	31.2	2.3e-49
AWK52525.1|3701686_3702301_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
3701881:3701900	attL	CAAAAGCTATTTTATTTCTA	NA	NA	NA	NA
AWK52526.1|3702739_3702925_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52527.1|3703064_3703289_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52528.1|3703428_3703647_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWK52529.1|3704682_3704934_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	46.8	1.3e-12
AWK53116.1|3704985_3705612_-	AAA family ATPase	NA	A0A0K2CPA5	Brevibacillus_phage	37.1	7.5e-28
AWK52530.1|3705661_3706816_-	phage replisome organizer	NA	V5UQV4	Oenococcus_phage	35.6	8.7e-22
AWK52531.1|3707027_3707234_-	excisionase	NA	NA	NA	NA	NA
AWK52532.1|3707369_3707570_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWK52533.1|3707721_3708303_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWK52534.1|3708375_3709554_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	27.5	2.0e-21
AWK52535.1|3709715_3709916_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52536.1|3709917_3710415_-	sortase	NA	A0A0H3UZB3	Geobacillus_virus	28.4	9.8e-07
AWK52537.1|3710411_3710648_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK52538.1|3711280_3711517_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52539.1|3711494_3712004_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52540.1|3711990_3712215_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52541.1|3712522_3714922_+	restriction endonuclease subunit R	NA	W8W1P4	Invertebrate_iridescent_virus	29.7	6.0e-25
AWK52542.1|3715033_3715489_-	hypothetical protein	NA	NA	NA	NA	NA
3715438:3715457	attR	CAAAAGCTATTTTATTTCTA	NA	NA	NA	NA
AWK52543.1|3716147_3716321_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52544.1|3717520_3718621_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AWK52545.1|3720044_3720713_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
AWK52546.1|3721292_3722324_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AWK52547.1|3722475_3723369_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWK52548.1|3726434_3726752_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	4.5e-13
AWK52549.1|3726911_3728612_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AWK52550.1|3728663_3728984_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWK52551.1|3729036_3729723_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWK52552.1|3729864_3730521_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
AWK53117.1|3730702_3731221_-	chromate transporter	NA	NA	NA	NA	NA
AWK52553.1|3731210_3731759_-	chromate transporter	NA	NA	NA	NA	NA
AWK52554.1|3731755_3732526_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWK52555.1|3732544_3733678_-	sugar kinase	NA	NA	NA	NA	NA
AWK53118.1|3733898_3734294_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52556.1|3734293_3736099_-	two-component sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	28.2	4.8e-19
AWK52557.1|3736091_3736784_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.7	1.2e-39
AWK52558.1|3736948_3737467_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52559.1|3737603_3738365_-	nitroreductase	NA	NA	NA	NA	NA
AWK52560.1|3739008_3739653_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52561.1|3740198_3741812_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	33.7	5.2e-65
AWK52562.1|3742154_3743393_-	cell wall-binding repeat 2 family protein	NA	NA	NA	NA	NA
AWK52563.1|3743725_3743932_-	heavy metal transport/detoxification protein	NA	NA	NA	NA	NA
AWK52564.1|3744047_3746477_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	1.7e-112
AWK52565.1|3746529_3746709_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AWK52566.1|3746766_3747033_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK52567.1|3747205_3748900_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AWK52568.1|3749308_3750409_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP029329	Clostridium beijerinckii isolate WB53 chromosome, complete genome	4258077	4017964	4028410	4258077	tail,head	Geobacillus_phage(28.57%)	19	NA	NA
AWK52786.1|4017964_4018153_-	hypothetical protein	NA	Q0H231	Geobacillus_phage	56.0	2.6e-08
AWK52787.1|4018167_4018509_-	hypothetical protein	NA	Q0H232	Geobacillus_phage	71.3	3.5e-40
AWK52788.1|4018521_4019085_-|tail	phage tail protein	tail	A0A2H4J534	uncultured_Caudovirales_phage	61.5	3.0e-60
AWK52789.1|4019086_4019416_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	59.6	2.1e-29
AWK52790.1|4019412_4019769_-	hypothetical protein	NA	A0A290FZT5	Caldibacillus_phage	53.4	4.7e-27
AWK52791.1|4019770_4020067_-|head,tail	phage head-tail adapter protein	head,tail	A6XMK0	Bacillus_virus	55.1	3.3e-26
AWK52792.1|4020063_4020339_-	hypothetical protein	NA	Q0H259	Geobacillus_phage	68.1	5.4e-31
AWK52793.1|4020536_4020719_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52794.1|4020904_4021129_+	hypothetical protein	NA	NA	NA	NA	NA
AWK52795.1|4021178_4021397_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
AWK52796.1|4022386_4022662_-	hypothetical protein	NA	NA	NA	NA	NA
AWK52797.1|4022772_4023015_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	50.0	5.8e-13
AWK53129.1|4023083_4023710_-	AAA family ATPase	NA	Q0H276	Geobacillus_phage	40.8	7.2e-31
AWK52798.1|4023759_4025022_-	phage replisome organizer	NA	V5UQV4	Oenococcus_phage	57.0	4.5e-32
AWK52799.1|4025171_4025771_-	hypothetical protein	NA	A0A0A7RWR9	Clostridium_phage	40.3	2.5e-33
AWK52800.1|4025970_4026237_-	excisionase	NA	NA	NA	NA	NA
AWK52801.1|4026325_4026523_-	DUF739 domain-containing protein	NA	A0A0A7RTP5	Clostridium_phage	61.7	2.2e-10
AWK52802.1|4026692_4027025_+	XRE family transcriptional regulator	NA	B6SBW8	Clostridium_virus	40.8	7.2e-14
AWK52803.1|4027243_4028410_+	recombinase XerC	NA	A0A1B0T6A8	Bacillus_phage	33.7	2.7e-39
