The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	17246	89009	2824008	integrase,transposase	Enterobacteria_phage(21.74%)	61	34426:34446	97969:97989
AWK13251.1|17246_18281_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13252.1|18344_18605_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13253.1|18673_19078_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13254.1|19333_22021_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13255.1|22030_25036_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13256.1|25072_26887_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13257.1|27351_28836_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13258.1|29467_29914_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
AWK13259.1|29926_30604_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
AWK15270.1|32462_32957_+	NADH-quinone oxidoreductase subunit E	NA	NA	NA	NA	NA
AWK13260.1|32953_34339_+	NADH-quinone oxidoreductase subunit F	NA	NA	NA	NA	NA
34426:34446	attL	TACATGAGGATTGCGAGCACC	NA	NA	NA	NA
AWK15271.1|37246_38224_+	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
AWK13261.1|38238_38781_+	NADH-quinone oxidoreductase subunit I	NA	NA	NA	NA	NA
AWK13262.1|38794_39292_+	NADH:ubiquinone oxidoreductase subunit J	NA	NA	NA	NA	NA
AWK13263.1|39288_39591_+	NADH-quinone oxidoreductase subunit K	NA	NA	NA	NA	NA
AWK13264.1|39587_41444_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
AWK13265.1|43074_44529_+	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
AWK13266.1|44623_45385_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.1	9.4e-41
AWK13267.1|45598_46525_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13268.1|46813_47278_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	54.5	1.9e-44
AWK13269.1|47286_48006_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWK13270.1|48044_48800_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWK13271.1|48880_50134_+	murein transglycosylase D	NA	NA	NA	NA	NA
AWK13272.1|50249_51032_+	EEP domain-containing protein	NA	NA	NA	NA	NA
AWK15272.1|52352_53360_-|transposase	IS110 family transposase	transposase	A0A1B1P7S0	Bacillus_phage	36.2	2.1e-08
AWK13273.1|53503_53752_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15273.1|53755_53890_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13274.1|54352_54556_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15274.1|54598_54967_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK13275.1|55438_55678_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13276.1|63116_64409_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
AWK13277.1|64958_67454_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AWK15275.1|67545_68343_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A2H4IAS4	Erwinia_phage	31.3	7.5e-25
AWK13278.1|69323_69587_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13279.1|69645_70182_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWK13280.1|70349_71423_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	4.2e-87
AWK13281.1|71594_72608_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWK13282.1|72608_72899_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13283.1|73102_74161_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	50.8	1.2e-97
AWK13284.1|74135_74366_-	excisionase	NA	NA	NA	NA	NA
AWK13285.1|74875_75559_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK13286.1|75912_76176_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	57.1	2.3e-15
AWK13287.1|76338_77103_-	phage antirepressor protein	NA	Q8W644	Enterobacteria_phage	37.5	6.5e-34
AWK13288.1|77144_77477_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	52.1	6.5e-15
AWK13289.1|77539_78127_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	45.6	5.7e-38
AWK13290.1|78419_78662_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13291.1|78665_78863_+	hypothetical protein	NA	A0A0M4RCZ9	Salmonella_phage	69.2	8.0e-21
AWK13292.1|78945_79749_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	48.0	4.7e-59
AWK13293.1|79996_80956_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	34.8	1.7e-34
AWK13294.1|81065_81686_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	52.7	4.8e-51
AWK13295.1|81730_82177_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	53.8	2.8e-29
AWK13296.1|82245_82812_-	recombinase	NA	A0A088CQ15	Enterobacteria_phage	66.7	7.4e-59
AWK13297.1|82780_83086_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13298.1|83381_83705_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13299.1|84023_84692_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	68.8	2.1e-89
AWK13300.1|84778_85027_+	transcriptional regulator	NA	U5P445	Shigella_phage	65.1	1.7e-15
AWK13301.1|85666_86371_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	55.0	1.5e-64
AWK13302.1|86381_87260_+	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	62.4	3.1e-27
AWK15276.1|87264_88137_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.8	4.9e-78
AWK13303.1|88173_88536_+	hypothetical protein	NA	E5AGG1	Erwinia_phage	55.2	8.4e-32
AWK13304.1|88532_89009_+	antiterminator	NA	H6WZJ5	Escherichia_phage	59.5	1.7e-48
97969:97989	attR	GGTGCTCGCAATCCTCATGTA	NA	NA	NA	NA
>prophage 2
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	242270	492611	2824008	capsid,tail,plate,lysis,protease,tRNA,terminase,portal,transposase	Salmonella_phage(12.7%)	173	NA	NA
AWK13422.1|242270_243089_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	26.7	3.7e-11
AWK13423.1|243346_243553_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
AWK13424.1|244059_244887_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.0	3.1e-13
AWK13425.1|244927_246463_+	glycerol kinase	NA	NA	NA	NA	NA
AWK13426.1|246512_247691_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	26.1	1.6e-10
AWK13427.1|247777_248050_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	88.9	3.6e-11
AWK13428.1|248138_249068_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	56.1	2.9e-84
AWK13429.1|249937_250744_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK13430.1|250857_252486_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	49.5	5.0e-132
AWK13431.1|252597_253245_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWK13432.1|253429_254065_-	ribonuclease PH	NA	NA	NA	NA	NA
AWK13433.1|254206_255592_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.8	2.6e-49
AWK13434.1|255802_256273_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
AWK13435.1|256312_256543_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
AWK13436.1|256547_256868_-	primosomal replication protein N	NA	NA	NA	NA	NA
AWK13437.1|256873_257266_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AWK13438.1|257411_258335_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWK13439.1|259839_260082_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13440.1|260231_260609_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13441.1|260703_262068_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
AWK13442.1|262156_263254_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	47.3	1.2e-07
AWK13443.1|263259_264060_-	sugar/pyridoxal phosphate phosphatase YigL	NA	NA	NA	NA	NA
AWK13444.1|264151_265990_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.2	1.2e-86
AWK13445.1|266044_266995_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
AWK13446.1|267024_269187_-	DNA helicase II	NA	G3MA40	Bacillus_virus	33.9	1.0e-79
AWK13447.1|269196_270099_-	tyrosine recombinase XerC	NA	A0A1B3B212	Gordonia_phage	32.5	8.3e-12
AWK13448.1|270092_270809_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
AWK13449.1|270822_271647_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AWK13450.1|272050_272887_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
AWK13451.1|273952_275395_+|protease	serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.2	2.8e-30
AWK13452.1|275475_276573_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AWK13453.1|277249_278191_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWK13454.1|280174_280804_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AWK13455.1|280804_281170_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AWK13456.1|281180_282071_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AWK13457.1|283486_286216_-	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	40.5	1.1e-80
AWK13458.1|286411_287689_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AWK13459.1|287784_289524_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWK13460.1|289750_290566_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AWK13461.1|290789_291443_-	DL-methionine transporter permease subunit	NA	NA	NA	NA	NA
AWK13462.1|291435_292467_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	6.3e-32
AWK13463.1|292657_293224_+	HAD family hydrolase	NA	NA	NA	NA	NA
AWK13464.1|299326_299932_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AWK13465.1|303400_304282_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AWK13466.1|304402_305446_-	ribosome biogenesis GTPase RsgA	NA	NA	NA	NA	NA
AWK15286.1|305613_306156_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.3	7.6e-29
AWK13467.1|306540_307575_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13468.1|308396_309431_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK15287.1|310171_310540_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13469.1|310568_310886_-	hypothetical protein	NA	F1BUK2	Cronobacter_phage	63.8	5.7e-08
AWK13470.1|310889_312419_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	61.5	2.3e-83
AWK13471.1|312415_313024_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.9	4.8e-80
AWK13472.1|313975_314323_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	55.9	1.4e-28
AWK13473.1|314466_315015_-|plate	phage baseplate protein	plate	F1BUP5	Erwinia_phage	62.0	6.7e-49
AWK13474.1|315172_315406_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWK15288.1|315860_316307_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	50.3	4.3e-30
AWK13475.1|316303_316771_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	5.7e-41
AWK13476.1|316777_317248_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13477.1|317240_317759_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	67.3	1.6e-63
AWK13478.1|317742_317994_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13479.1|318012_318216_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	62.7	1.7e-18
AWK13480.1|318314_318794_-	hypothetical protein	NA	K4NZV5	Burkholderia_phage	47.6	3.3e-28
AWK13481.1|318891_319545_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	48.3	2.2e-46
AWK13482.1|319551_320607_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	64.5	9.1e-127
AWK13483.1|320608_321424_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.7	2.4e-58
AWK13484.1|321589_323383_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	62.0	1.1e-217
AWK13485.1|323382_324387_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	66.0	6.8e-132
AWK13486.1|324815_325097_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.1e-18
AWK13487.1|325086_325338_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWK13488.1|325544_327632_-	hypothetical protein	NA	E5G6L9	Salmonella_phage	51.4	7.2e-184
AWK13489.1|328113_328461_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13490.1|328880_329096_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13491.1|329323_329680_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13492.1|329676_330027_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13493.1|330088_330313_+	transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	55.6	1.8e-13
AWK13494.1|330591_330807_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	52.2	1.0e-13
AWK15289.1|332962_333445_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	3.0e-29
AWK13495.1|333593_334031_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWK13496.1|334023_334314_+	RnfH family protein	NA	NA	NA	NA	NA
AWK13497.1|334462_336667_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13498.1|336612_337872_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13499.1|337958_342629_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13500.1|342726_347916_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13501.1|347963_350729_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13502.1|350880_351294_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13503.1|351651_351834_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWK13504.1|353265_353697_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13505.1|353708_354095_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13506.1|354131_354572_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13507.1|354883_362893_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13508.1|364221_364416_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13509.1|364504_364903_+	hypothetical protein	NA	R9TNM0	Vibrio_phage	42.6	9.3e-08
AWK13510.1|365317_365578_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13511.1|365689_366121_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13512.1|366713_366893_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13513.1|367207_367714_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK13514.1|367682_368015_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13515.1|368052_369087_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13516.1|369093_369285_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK13517.1|370122_370524_-	hypothetical protein	NA	Q37962	Escherichia_phage	41.2	8.8e-06
AWK13518.1|370758_373749_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13519.1|373745_378434_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13520.1|378509_378719_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13521.1|380066_380903_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13522.1|381035_381368_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13523.1|382592_382958_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13524.1|383239_383653_-	molecular chaperone Tir	NA	NA	NA	NA	NA
AWK13525.1|383806_384460_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13526.1|385138_385600_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13527.1|386017_389989_-	hypothetical protein	NA	F1C571	Cronobacter_phage	50.9	0.0e+00
AWK13528.1|390050_390629_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.5	3.2e-57
AWK13529.1|390815_391253_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13530.1|391866_392067_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.9	8.7e-15
AWK13531.1|392501_393209_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	71.2	9.4e-104
AWK13532.1|393211_393964_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	62.0	4.0e-92
AWK13533.1|393979_394321_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.7	6.5e-26
AWK13534.1|394342_394564_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15290.1|396118_397423_+	DNA-binding protein	NA	G8C7P4	Escherichia_phage	65.4	4.4e-163
AWK13535.1|397517_398612_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.1	2.7e-110
AWK13536.1|398813_399560_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	57.6	1.3e-71
AWK13537.1|399504_399954_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	75.5	5.2e-39
AWK13538.1|399987_400263_+	hypothetical protein	NA	B6SD57	Bacteriophage	41.0	8.9e-10
AWK13539.1|401115_401841_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13540.1|403196_403565_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK13541.1|403636_403897_-	hypothetical protein	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.3e-07
AWK13542.1|404184_404382_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	80.3	2.5e-22
AWK13543.1|404378_404897_+	lysozyme	NA	S5MQK2	Escherichia_phage	66.7	9.1e-64
AWK13544.1|405028_405349_+	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	37.9	5.2e-09
AWK13545.1|405521_405734_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13546.1|405751_406237_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	59.6	8.6e-40
AWK13547.1|406273_407764_+|terminase	terminase	terminase	I6PBN3	Cronobacter_phage	74.4	2.0e-220
AWK13548.1|409276_410341_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	8.1e-107
AWK13549.1|410647_411325_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13550.1|411803_412553_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	57.6	1.3e-71
AWK13551.1|414549_420126_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13552.1|420681_421740_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWK13553.1|421838_422276_-	antitermination protein Q	NA	B6SCY2	Bacteriophage	55.6	1.6e-32
AWK15291.1|422466_422796_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	45.4	2.5e-14
AWK15292.1|422800_423388_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	34.5	7.3e-09
AWK13554.1|423407_424043_-	lytic murein transglycosylase	NA	J9SHG5	Pseudomonas_phage	53.5	8.0e-54
AWK13555.1|424046_424376_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.7	2.5e-22
AWK13556.1|424563_427437_-	hypothetical protein	NA	S5W9C6	Leptospira_phage	32.3	9.7e-06
AWK13557.1|427433_430745_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13558.1|430642_431494_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13559.1|431429_437501_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13560.1|437612_444401_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13561.1|444775_445537_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13562.1|445724_446927_+	MFS transporter	NA	NA	NA	NA	NA
AWK13563.1|447222_448914_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13564.1|448847_450608_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13565.1|450718_451075_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13566.1|451071_452619_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13567.1|452648_453746_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13568.1|453754_455851_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13569.1|455907_458748_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13570.1|459920_460916_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13571.1|461033_462887_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13572.1|463440_464547_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13573.1|464874_465180_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13574.1|465700_466060_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13575.1|466094_466697_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13576.1|467642_468194_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13577.1|470700_470898_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13578.1|470931_471966_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13579.1|476904_479061_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13580.1|481403_482672_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13581.1|482698_482959_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13582.1|483189_483621_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWK13583.1|485051_485984_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13584.1|486889_488386_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13585.1|489101_490136_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13586.1|490197_491232_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13587.1|491645_492611_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	34.4	3.7e-34
>prophage 3
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	495838	563525	2824008	tail,integrase,transposase	Sodalis_phage(26.92%)	56	518303:518362	545586:546359
AWK13591.1|495838_496897_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	50.3	3.0e-98
AWK13592.1|497011_498418_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15294.1|498671_499151_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15295.1|499741_500482_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	37.4	5.0e-07
AWK13593.1|502755_503826_+	hemin-degrading factor	NA	NA	NA	NA	NA
AWK13594.1|503822_504656_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK13595.1|504652_505636_+	iron ABC transporter	NA	NA	NA	NA	NA
AWK13596.1|506550_506958_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15296.1|507108_507729_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	50.7	8.1e-51
AWK13597.1|509517_510462_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.3	1.1e-78
AWK13598.1|511754_512018_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.4	6.1e-16
AWK13599.1|513315_513513_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13600.1|513774_514005_+	excisionase	NA	NA	NA	NA	NA
AWK13601.1|513979_515038_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	51.4	1.7e-101
AWK13602.1|515177_515921_-	16S rRNA (guanine(1516)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AWK13603.1|516092_518156_-	oligopeptidase A	NA	NA	NA	NA	NA
518303:518362	attL	GTAGAGTAGGTCTCTGGTTTGACATCATCTCCCCAGCGACCTCTCGTCAAACCGTGCTTG	NA	NA	NA	NA
AWK13604.1|518407_519094_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13605.1|520716_520911_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13606.1|520895_521714_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15297.1|521864_522485_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	51.2	1.1e-50
AWK13607.1|522641_523520_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	8.2e-73
AWK13608.1|524899_525166_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.8	2.1e-16
AWK13609.1|526514_526748_+	hypothetical protein	NA	H9C153	Pectobacterium_phage	46.4	5.2e-11
AWK13610.1|526747_527758_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	69.0	9.0e-132
AWK13611.1|528819_529335_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13612.1|529337_529685_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13613.1|530243_530534_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13614.1|530668_531877_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AWK13615.1|531880_533059_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
AWK13616.1|533062_535261_-	hypothetical protein	NA	A0A249XZQ2	Enterococcus_phage	35.5	8.7e-31
AWK13617.1|536605_536992_-	DNA-binding protein	NA	NA	NA	NA	NA
AWK13618.1|537197_537395_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15298.1|537653_538337_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK13619.1|538491_538758_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	60.0	8.6e-18
AWK13620.1|539959_540166_-	hypothetical protein	NA	F1C5A3	Cronobacter_phage	57.7	1.1e-09
AWK13621.1|542233_542920_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13622.1|544542_544737_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13623.1|544721_545540_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15299.1|545690_546311_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	51.2	6.2e-51
AWK13624.1|546422_547343_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.4	1.1e-75
545586:546359	attR	CAAGCACGGTTTGACGAGAGGTCGCTGGGGAGATGATGTCAAACCAGAGACCTACTCTACGAGGGGTTCTCCGTTTTGATGACAAGACAATTTATCGAGGTAAAAATGGAACAACGAACAGAAGCCTGGTTTGCTGCAAGAAGCGGCAAAGTGACGGCCAGCAAATTGGCAGAGGTGATGGCAAAAGTCAAAACCGGCGATGCCGCAACGCGAAAAAAATACAGGGCCGAGCTGATTTGCCAACGCCTGACGGGGAAACGGGAAGACACCTTTGTCACGCTCGATATGAAGCACGGGACGGCACTGGAACCCGTCGCCCGTGAGGCTTACATCTTGCGTGAATTTGCAGTAGAGGTCACGGAGGTGGGTCTCGTCGACCACCCTACCATCGAGGGGTTTGCGGCCAGTCCCGACGGACTGGTTAACGACGATGGCCTGATCGAGATTAAATGCCCCAAAACCTGGACGCATCTGAAAACGATAAGAACAGGTGAACCAGAAAAAAAATACCGCCTGCAAATGCACGCACAAATGCTGTGTACGGGGCGTCGATGGTGTGACTTTGTCAGTTATGACAATCGACTGCCTGACACATTAGCCTACTTCAAAAAGCGCATTCACTTTGATGAAGCGCTGGGCAAGGAAATTGAAACCGAAGTGCGAAAATTTCTGCAGGAACTTGAAGATGAAATCGAACAGATTAAAACGTATGGAAAAGTGGCATGAAGATAACGCCACTGAAAAAAAGTGATCGTTTAGCGGATGAAATACGCG	NA	NA	NA	NA
AWK13625.1|547709_548474_+	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	41.5	1.8e-44
AWK13626.1|548642_548909_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	60.0	8.6e-18
AWK15300.1|549063_549747_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK13627.1|549758_549938_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13628.1|550350_550926_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13629.1|550956_551199_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13630.1|554059_554263_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	54.5	5.6e-09
AWK13631.1|554593_554683_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13632.1|556533_556851_-	hypothetical protein	NA	I6PCW3	Cronobacter_phage	40.4	2.5e-11
AWK13633.1|556847_557162_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	54.2	2.6e-13
AWK13634.1|557158_557470_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	61.2	9.4e-32
AWK13635.1|557481_558144_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	43.8	2.5e-42
AWK13636.1|559229_559580_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	51.3	6.9e-23
AWK13637.1|559584_560064_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	51.2	6.5e-40
AWK13638.1|560410_561361_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13639.1|562772_563525_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.4	3.4e-83
>prophage 4
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	567023	663122	2824008	integrase,transposase,tRNA	uncultured_Mediterranean_phage(21.43%)	58	567719:567743	674131:674155
AWK15301.1|567023_567392_-|transposase	transposase	transposase	NA	NA	NA	NA
567719:567743	attL	TCAACGATTATTTCCGTCTCCGAAA	NA	NA	NA	NA
AWK13643.1|568029_568254_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13644.1|569480_569792_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	47.8	8.5e-17
AWK13645.1|570279_571215_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13646.1|571217_571748_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15302.1|572474_574553_+	ATP-dependent helicase	NA	A0A160DHD3	Gordonia_phage	29.9	3.9e-49
AWK13647.1|574590_575478_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13648.1|575489_576383_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWK13649.1|576503_579323_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13650.1|579725_580751_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	2.0e-46
AWK13651.1|582647_582980_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	5.7e-11
AWK13652.1|583092_584214_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.8	7.0e-93
AWK13653.1|584416_585571_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AWK13654.1|585701_586040_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13655.1|586207_586807_+	peroxiredoxin	NA	NA	NA	NA	NA
AWK13656.1|586926_588303_-	proline-specific permease ProY	NA	NA	NA	NA	NA
AWK13657.1|588358_588565_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13658.1|588548_589868_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWK13659.1|594774_595371_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.8	3.0e-50
AWK13660.1|595933_596665_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.0e-23
AWK13661.1|598273_598468_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15303.1|599420_600041_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	50.7	5.3e-50
AWK13662.1|600158_600890_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13663.1|600994_601426_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWK13664.1|601442_602141_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13665.1|603981_604917_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.4	1.1e-75
AWK13666.1|606310_606577_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.8	2.1e-16
AWK15304.1|606731_607415_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK13667.1|607672_607870_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13668.1|608156_608387_+	excisionase	NA	NA	NA	NA	NA
AWK13669.1|608361_609426_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	50.0	7.6e-97
AWK13670.1|610408_611836_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AWK13671.1|614502_615258_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13672.1|622974_623283_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13673.1|623379_623772_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13674.1|623791_624937_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13675.1|624933_630846_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13676.1|632777_633812_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13677.1|634376_634688_-	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	56.6	2.1e-15
AWK13678.1|634702_636211_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13679.1|636554_637001_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13680.1|636984_637182_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15305.1|637966_638059_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13681.1|640161_642357_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWK13682.1|642374_643718_-	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AWK13683.1|643714_645463_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AWK13684.1|646387_648157_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
AWK13685.1|648286_649510_+	MFS transporter	NA	NA	NA	NA	NA
AWK15306.1|650516_651299_+	iron-hydroxamate transporter ATP-binding subunit	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.6e-11
AWK13686.1|651298_652213_+	iron-hydroxamate transporter substrate-binding subunit	NA	NA	NA	NA	NA
AWK13687.1|652209_654195_+	Fe3+-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AWK13688.1|654790_655582_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWK13689.1|655623_656409_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWK13690.1|657491_658817_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	30.6	3.6e-48
AWK13691.1|659049_659295_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13692.1|659685_659805_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13693.1|661866_662085_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13694.1|662087_663122_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
674131:674155	attR	TTTCGGAGACGGAAATAATCGTTGA	NA	NA	NA	NA
>prophage 5
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	669035	731421	2824008	tail,lysis,terminase,integrase,transposase	Enterobacteria_phage(26.92%)	57	698866:698925	738196:738316
AWK13697.1|669035_670130_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.1	2.7e-110
AWK13698.1|671641_673132_-|terminase	terminase	terminase	I6PBN3	Cronobacter_phage	74.4	2.0e-220
AWK13699.1|673094_673655_-	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	55.9	4.8e-42
AWK13700.1|673672_673885_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13701.1|674057_674378_-	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	37.9	5.2e-09
AWK13702.1|674509_675028_-	lysozyme	NA	S5MQK2	Escherichia_phage	66.7	9.1e-64
AWK13703.1|675024_675228_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	82.0	1.2e-22
AWK13704.1|675777_677034_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13705.1|677340_677829_-	antiterminator	NA	H6WZJ5	Escherichia_phage	59.9	1.2e-49
AWK13706.1|677825_678188_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	55.2	8.4e-32
AWK13707.1|678224_679097_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.8	4.9e-78
AWK13708.1|679101_679980_-	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	62.4	3.1e-27
AWK15307.1|680638_681007_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13709.1|681593_681884_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK13710.1|681886_682198_-	toxin HigB-2	NA	NA	NA	NA	NA
AWK15308.1|683329_683698_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13711.1|683699_684074_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13712.1|684091_685126_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13713.1|685373_685589_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13714.1|686058_686271_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13715.1|688648_689329_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13716.1|689525_690620_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWK13717.1|690721_693445_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13718.1|693423_695787_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13719.1|695759_696308_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15309.1|696685_696922_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13720.1|697491_697758_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13721.1|697768_698782_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
698866:698925	attL	TATAGCAGGCGCCGTATCAGTTGATTATGAAAATCAGAAATAACATATTGATATTAATTA	NA	NA	NA	NA
AWK13722.1|699378_700101_+	oxidoreductase	NA	NA	NA	NA	NA
AWK15310.1|700248_701541_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.0	2.6e-35
AWK13723.1|701582_702767_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	28.2	1.6e-26
AWK13724.1|702849_703344_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AWK13725.1|703894_704929_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13726.1|704911_705304_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13727.1|705547_706354_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13728.1|706524_707103_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.5	2.9e-58
AWK13729.1|707187_707643_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13730.1|708257_709241_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13731.1|709313_710033_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	73.0	1.1e-104
AWK13732.1|710035_710788_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	61.2	1.4e-89
AWK13733.1|711384_711801_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13734.1|711947_712505_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13735.1|712674_714354_+	DNA recombinase	NA	A0A1B2LRQ3	Wolbachia_phage	40.9	4.0e-100
AWK13736.1|714301_714988_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13737.1|715139_715760_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	51.7	1.1e-50
AWK13738.1|715871_716828_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.5	1.1e-78
AWK13739.1|717290_718055_+	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	41.5	1.8e-44
AWK13740.1|718222_718489_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.8	2.1e-16
AWK13741.1|719837_720071_+	hypothetical protein	NA	H9C153	Pectobacterium_phage	46.4	5.2e-11
AWK13742.1|720070_721081_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	69.0	9.0e-132
AWK13743.1|721607_722009_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13744.1|722005_723067_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13745.1|727915_728353_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13746.1|728966_729167_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.9	8.7e-15
AWK13747.1|729601_730309_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	71.2	9.4e-104
AWK13748.1|730311_731064_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	62.0	4.0e-92
AWK13749.1|731079_731421_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.7	6.5e-26
738196:738316	attR	TAATTAATATCAATATGTTATTTCTGATTTTCATAATCAACTGATACGGCGCCTGCTATAGCATTCATGTAGGAATGTTGTTAAAAATCTCCTGAACAAGGAGCCCCCATGAAATATGAAC	NA	NA	NA	NA
>prophage 6
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	807519	883742	2824008	integrase,transposase,tRNA	Sodalis_phage(19.05%)	60	862254:862273	884447:884466
AWK13806.1|807519_808275_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWK13807.1|809573_810797_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	7.2e-51
AWK13808.1|812448_812697_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWK13809.1|812882_813353_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	47.7	1.2e-33
AWK13810.1|814870_816757_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13811.1|817140_817320_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13812.1|817396_818062_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	50.7	1.6e-49
AWK13813.1|819939_820548_+	DNA transformation protein tfoX	NA	NA	NA	NA	NA
AWK13814.1|821699_822425_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.2e-30
AWK13815.1|822783_822996_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	82.1	2.2e-24
AWK15316.1|823387_823579_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13816.1|823730_825962_+	GTP diphosphokinase	NA	NA	NA	NA	NA
AWK13817.1|827917_828895_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWK13818.1|829088_829775_+	ribonuclease III	NA	M1H375	Paramecium_bursaria_Chlorella_virus	32.1	5.3e-19
AWK13819.1|829767_830679_+	GTPase Era	NA	NA	NA	NA	NA
AWK13820.1|830682_831387_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AWK15317.1|831453_832200_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
AWK13821.1|832222_833239_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWK13822.1|833427_834054_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13823.1|834125_835082_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13824.1|835262_837605_-	Paraquat-inducible protein B	NA	NA	NA	NA	NA
AWK13825.1|837573_838821_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AWK13826.1|838834_840415_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWK13827.1|840432_841986_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	36.7	6.3e-84
AWK15318.1|842123_843251_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.0	1.3e-17
AWK13828.1|843262_844057_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWK13829.1|844997_845903_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AWK13830.1|845895_847176_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AWK13831.1|847252_847762_+	sporulation protein	NA	NA	NA	NA	NA
AWK13832.1|847748_848237_+	colicin V production protein	NA	NA	NA	NA	NA
AWK13833.1|848289_849807_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.7	2.1e-84
AWK13834.1|850060_850636_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AWK13835.1|850632_850941_+	Trp operon repressor	NA	NA	NA	NA	NA
AWK13836.1|851019_851658_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AWK13837.1|851670_852387_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
AWK13838.1|852891_855360_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
AWK13839.1|855362_856292_+	homoserine kinase	NA	NA	NA	NA	NA
AWK13840.1|856295_857612_+	threonine synthase	NA	NA	NA	NA	NA
AWK13841.1|857796_858228_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK13842.1|859708_860548_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AWK13843.1|860939_861974_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK13844.1|862046_863060_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
862254:862273	attL	AAGCCTGAAAATGGCGGCTC	NA	NA	NA	NA
AWK13845.1|863297_865862_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.2	3.0e-22
AWK13846.1|867732_868791_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	51.4	5.6e-100
AWK13847.1|868765_868996_-	excisionase	NA	NA	NA	NA	NA
AWK13848.1|869256_869454_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13849.1|870752_871016_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.4	6.1e-16
AWK13850.1|871146_871863_-	hypothetical protein	NA	A0A2I7RX10	Vibrio_phage	39.3	2.9e-36
AWK13851.1|872219_873179_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	50.6	4.2e-70
AWK15319.1|873289_873910_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	53.4	8.1e-51
AWK15320.1|874060_874879_-	hypothetical protein	NA	NA	NA	NA	NA
AWK13852.1|875054_876734_+	DNA recombinase	NA	A0A1B2LRQ3	Wolbachia_phage	40.9	4.0e-100
AWK13853.1|876681_877368_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15321.1|877518_878139_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	53.4	8.1e-51
AWK13854.1|878249_879221_+	hypothetical protein	NA	Q2A0A7	Sodalis_phage	50.6	4.2e-70
AWK13855.1|879576_880293_+	hypothetical protein	NA	A0A2I7RX10	Vibrio_phage	39.3	2.9e-36
AWK13856.1|880423_880687_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.4	6.1e-16
AWK13857.1|881985_882183_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13858.1|882469_882700_+	excisionase	NA	NA	NA	NA	NA
AWK13859.1|882674_883742_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	47.6	1.0e-93
884447:884466	attR	GAGCCGCCATTTTCAGGCTT	NA	NA	NA	NA
>prophage 7
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	986455	995041	2824008	transposase	Pseudomonas_phage(22.22%)	12	NA	NA
AWK13927.1|986455_987175_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	29.9	4.9e-23
AWK13928.1|987290_987485_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13929.1|987481_989161_+	DNA recombinase	NA	A0A1B2LRQ3	Wolbachia_phage	40.9	4.0e-100
AWK13930.1|989108_989795_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15329.1|989945_990566_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	51.2	5.3e-50
AWK13931.1|990673_991663_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	34.4	5.0e-34
AWK13932.1|991776_992010_+	hypothetical protein	NA	NA	NA	NA	NA
AWK13933.1|992093_992477_+	hypothetical protein	NA	Q71TC0	Escherichia_phage	47.9	3.6e-17
AWK13934.1|992807_993407_+	hypothetical protein	NA	Q8HA97	Salmonella_phage	44.1	1.5e-33
AWK13935.1|993469_993823_+	hypothetical protein	NA	F1C5A3	Cronobacter_phage	52.0	2.0e-14
AWK13936.1|993845_994610_+	phage antirepressor protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	35.9	2.5e-33
AWK13937.1|994774_995041_+	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.8	9.5e-17
>prophage 8
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1080435	1168273	2824008	lysis,protease,tRNA,integrase,transposase	Enterobacteria_phage(19.23%)	82	1104862:1104921	1167443:1167717
AWK14008.1|1080435_1080867_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWK14009.1|1080975_1081764_+	S-adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AWK14010.1|1081819_1082053_-	cold-shock protein	NA	NA	NA	NA	NA
AWK14011.1|1082243_1082453_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.9	4.8e-16
AWK14012.1|1082817_1083696_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AWK14013.1|1083695_1084862_-	succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
AWK14014.1|1086188_1088999_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AWK14015.1|1089317_1090034_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AWK14016.1|1090134_1091901_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AWK14017.1|1091901_1092249_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
AWK14018.1|1092242_1092620_-	succinate dehydrogenase cytochrome b556 large subunit	NA	NA	NA	NA	NA
AWK14019.1|1093134_1094373_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AWK14020.1|1094498_1095527_-	16S rRNA (guanine(1207)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AWK14021.1|1095669_1096107_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
AWK14022.1|1096051_1096495_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AWK14023.1|1096547_1097105_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14024.1|1097246_1098626_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	34.3	8.9e-66
AWK14025.1|1098746_1099949_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AWK15337.1|1100456_1101953_-	lysine transporter	NA	NA	NA	NA	NA
AWK14026.1|1102336_1102780_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14027.1|1102805_1103171_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14028.1|1103824_1104190_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14029.1|1104215_1104647_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14030.1|1104852_1105617_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	60.6	7.3e-86
1104862:1104921	attL	AAGACGGTATCTGACCTGGAAAATATCAAGAAACGCCTTTCTGCCTTGGAAGCCAAAGTA	NA	NA	NA	NA
AWK14031.1|1106304_1106649_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWK14032.1|1107134_1108127_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AWK14033.1|1108244_1108511_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14034.1|1108482_1108902_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14035.1|1108932_1109646_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	3.1e-38
AWK14036.1|1109719_1110805_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AWK14037.1|1110815_1111739_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AWK14038.1|1112239_1112683_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AWK15338.1|1112815_1113352_-	flavodoxin	NA	NA	NA	NA	NA
AWK14039.1|1113408_1115286_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AWK14040.1|1115319_1116222_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AWK15339.1|1116331_1116634_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AWK14041.1|1116692_1117463_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AWK14042.1|1119375_1121397_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	NA	NA	NA	NA
AWK14043.1|1121680_1122481_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AWK14044.1|1122499_1123639_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AWK15340.1|1123658_1124879_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK14045.1|1124942_1126652_+	asparagine synthase B	NA	I3UL62	Ostreococcus_lucimarinus_virus	38.9	7.2e-81
AWK15341.1|1127618_1128521_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	9.7e-29
AWK14046.1|1128588_1129320_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWK14047.1|1129514_1129889_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14048.1|1129975_1132435_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14049.1|1132388_1134536_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14050.1|1134528_1134846_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14051.1|1134796_1137109_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14052.1|1137588_1138929_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AWK14053.1|1139075_1139621_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
AWK14054.1|1139796_1141233_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A0K0KVL9	Prochlorococcus_phage	37.0	9.4e-18
AWK14055.1|1141403_1142468_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	50.0	7.6e-97
AWK14056.1|1142442_1142673_-	excisionase	NA	NA	NA	NA	NA
AWK14057.1|1142959_1143157_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15342.1|1143414_1144098_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK14058.1|1144252_1144519_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.8	2.1e-16
AWK14059.1|1144687_1145452_-	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	41.5	1.8e-44
AWK14060.1|1145818_1146787_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	57.8	1.1e-78
AWK15343.1|1148576_1149197_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	51.2	2.1e-51
AWK14061.1|1149981_1151661_-	DNA recombinase	NA	A0A1B2LRQ3	Wolbachia_phage	40.9	4.0e-100
AWK14062.1|1151657_1151852_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14063.1|1151967_1152687_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.3e-23
AWK14064.1|1153887_1154571_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	63.0	1.3e-81
AWK14065.1|1154592_1154928_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14066.1|1155223_1155547_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14067.1|1156098_1156791_-	hypothetical protein	NA	A0A2H4FNG6	Salmonella_phage	36.4	1.5e-29
AWK14068.1|1156898_1157126_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	69.3	8.4e-22
AWK14069.1|1157690_1158395_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	55.0	8.6e-65
AWK14070.1|1158405_1158846_+	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	62.4	1.5e-27
AWK14071.1|1159079_1159283_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15344.1|1159287_1160160_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.8	4.9e-78
AWK14072.1|1160196_1160559_+	hypothetical protein	NA	E5AGG1	Erwinia_phage	55.2	8.4e-32
AWK14073.1|1160555_1161044_+	antiterminator	NA	H6WZJ5	Escherichia_phage	59.9	1.2e-49
AWK14074.1|1161350_1162607_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14075.1|1163156_1163360_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	82.0	1.2e-22
AWK14076.1|1163356_1163875_+	lysozyme	NA	S5MQK2	Escherichia_phage	66.7	9.1e-64
AWK14077.1|1164006_1164327_+	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	37.9	5.2e-09
AWK14078.1|1164499_1164712_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14079.1|1164729_1165290_+	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	55.9	4.8e-42
AWK14080.1|1166462_1167437_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWK14081.1|1167841_1168273_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
1167443:1167717	attR	AAGACGGTATCTGACCTGGAAAATATCAAGAAACGCCTTTCTGCCTTGGAAGCCAAAGTAGCGCAGGAGGGGTACTTACTGACGGAAGCCCAACTGCAAGCATTAGAAAAAGTGCAGGATAAACGAGAAGCTCATGGACAAATTGAAACGCAACATCCGGGCTATCTCGGCTCTCAGGATACTTACTACGTGGGGCACATTAAAGGTGTGGGTAAAATGTATCAGCAGAGCTTTGTTGATACCTATTCCAGAGTCGCTTTTGCCAAGGTCTATAC	NA	NA	NA	NA
>prophage 9
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1177928	1237236	2824008	lysis,protease,transposase,tRNA	Enterobacteria_phage(35.48%)	65	NA	NA
AWK14086.1|1177928_1178987_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWK14087.1|1179280_1179979_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AWK15345.1|1179992_1180739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AWK14088.1|1180735_1181692_+	glutathione synthase	NA	NA	NA	NA	NA
AWK14089.1|1181697_1182120_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AWK15346.1|1182167_1182752_+	antibiotic transporter	NA	NA	NA	NA	NA
AWK14090.1|1183123_1184167_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.7	6.0e-06
AWK14091.1|1184298_1185411_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWK14092.1|1185407_1185896_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWK14093.1|1185962_1187459_+	ribonuclease E/G	NA	NA	NA	NA	NA
AWK14094.1|1187699_1189145_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWK14095.1|1189876_1191283_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AWK14096.1|1191999_1192290_+	hypothetical protein	NA	A0A0R6PGM3	Moraxella_phage	46.6	3.6e-09
AWK14097.1|1192791_1193133_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14098.1|1194345_1195044_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15347.1|1195529_1196897_+	carnitine dehydratase	NA	NA	NA	NA	NA
AWK14099.1|1196891_1197866_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWK14100.1|1198065_1198347_-	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	58.1	1.8e-18
AWK14101.1|1198364_1198577_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14102.1|1199626_1199947_-	hypothetical protein	NA	M9NYX9	Enterobacteria_phage	38.8	2.7e-10
AWK14103.1|1200078_1200597_-	lysozyme	NA	S5MQK2	Escherichia_phage	67.3	8.3e-65
AWK14104.1|1201229_1201487_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14105.1|1201613_1201808_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14106.1|1201989_1202196_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14107.1|1202280_1202526_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15348.1|1203968_1204691_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWK14108.1|1205025_1205280_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AWK14109.1|1205272_1205527_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AWK15349.1|1206822_1207311_-	antiterminator	NA	I6S672	Salmonella_phage	59.9	2.9e-51
AWK14110.1|1207403_1207997_-	phosphohydrolase	NA	Q3HQZ7	Burkholderia_phage	42.6	2.4e-36
AWK14111.1|1207996_1208959_-	hypothetical protein	NA	K7PL20	Enterobacteria_phage	47.3	2.4e-33
AWK14112.1|1209071_1209518_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	40.0	1.7e-26
AWK14113.1|1209583_1209814_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	49.3	5.0e-14
AWK14114.1|1209945_1210638_+	phage repressor protein	NA	NA	NA	NA	NA
AWK14115.1|1211108_1211432_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14116.1|1211487_1212888_+	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	2.8e-06
AWK14117.1|1213191_1213497_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14118.1|1213486_1214101_+	recombinase	NA	A0A088CQ15	Enterobacteria_phage	62.4	1.5e-60
AWK14119.1|1214100_1214541_+	hypothetical protein	NA	K7P704	Enterobacteria_phage	51.6	2.8e-29
AWK14120.1|1215103_1215823_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.3e-23
AWK14121.1|1215938_1216133_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14122.1|1217743_1218475_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.0e-23
AWK14123.1|1219037_1219478_-	hypothetical protein	NA	K7P704	Enterobacteria_phage	51.6	2.8e-29
AWK14124.1|1219477_1220092_-	recombinase	NA	A0A088CQ15	Enterobacteria_phage	62.4	1.5e-60
AWK14125.1|1220081_1220387_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14126.1|1220551_1220875_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14127.1|1221400_1222012_-	transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	55.6	2.1e-14
AWK14128.1|1222117_1222351_+	transcriptional regulator	NA	A0A0N7C1T6	Escherichia_phage	54.1	3.5e-15
AWK14129.1|1222418_1222862_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	40.0	5.1e-23
AWK14130.1|1222913_1223477_+	hypothetical protein	NA	K7P6K2	Enterobacteria_phage	55.4	4.6e-45
AWK14131.1|1223533_1223872_-	hypothetical protein	NA	K7PM52	Enterobacteria_phage	69.4	7.3e-38
AWK14132.1|1223868_1224072_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	80.3	3.4e-22
AWK14133.1|1224627_1225044_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14134.1|1225068_1226238_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14135.1|1226568_1227603_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14136.1|1227706_1228195_-	antiterminator	NA	H6WZJ5	Escherichia_phage	59.3	1.6e-49
AWK14137.1|1230563_1230926_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	55.2	8.4e-32
AWK14138.1|1230962_1231835_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.8	4.9e-78
AWK14139.1|1231839_1232718_-	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	62.4	3.1e-27
AWK14140.1|1232728_1233433_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	55.0	8.6e-65
AWK14141.1|1233997_1234225_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	69.3	8.4e-22
AWK14142.1|1234332_1235025_+	hypothetical protein	NA	A0A2H4FNG6	Salmonella_phage	36.4	1.5e-29
AWK14143.1|1235576_1235900_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14144.1|1236195_1236531_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14145.1|1236552_1237236_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	63.0	1.3e-81
>prophage 10
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1253749	1280575	2824008	integrase,transposase	Enterobacteria_phage(23.08%)	34	1267637:1267651	1287156:1287170
AWK14159.1|1253749_1254481_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.4	1.0e-23
AWK14160.1|1255043_1255484_-	hypothetical protein	NA	K7P704	Enterobacteria_phage	51.6	2.8e-29
AWK14161.1|1255483_1256098_-	recombinase	NA	A0A088CQ15	Enterobacteria_phage	62.4	1.5e-60
AWK14162.1|1256087_1256393_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14163.1|1256503_1256722_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14164.1|1256696_1258097_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	2.8e-06
AWK14165.1|1258152_1258476_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14166.1|1258867_1259335_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14167.1|1259384_1259621_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	43.7	1.1e-13
AWK14168.1|1259672_1260119_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	38.6	1.3e-26
AWK14169.1|1260189_1261059_+	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	66.0	1.4e-29
AWK15351.1|1261063_1261936_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.8	1.9e-77
AWK14170.1|1261954_1262146_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14171.1|1262339_1262657_-	hypothetical protein	NA	H6WRU6	Salmonella_phage	80.9	7.6e-13
AWK14172.1|1262811_1263090_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14173.1|1263180_1263381_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14174.1|1263735_1263927_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14175.1|1263933_1264968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14176.1|1264905_1265322_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14177.1|1266546_1266879_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14178.1|1267011_1267848_-	hypothetical protein	NA	NA	NA	NA	NA
1267637:1267651	attL	AGATAATGGCTATTT	NA	NA	NA	NA
AWK14179.1|1268230_1268416_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14180.1|1268781_1269924_-|integrase	integrase	integrase	G8C7S0	Escherichia_phage	73.9	1.0e-171
AWK14181.1|1269800_1270139_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14182.1|1270482_1270680_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14183.1|1271976_1272240_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	58.4	6.1e-16
AWK14184.1|1273519_1273951_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWK14185.1|1274148_1274742_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	44.2	2.9e-29
AWK14186.1|1274965_1276000_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14187.1|1276052_1276331_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14188.1|1277602_1277968_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14189.1|1278324_1279818_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	37.7	2.5e-74
AWK14190.1|1279818_1280046_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14191.1|1280209_1280575_-|transposase	transposase	transposase	NA	NA	NA	NA
1287156:1287170	attR	AGATAATGGCTATTT	NA	NA	NA	NA
>prophage 11
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1297568	1360678	2824008	tail,integrase,transposase,coat	Escherichia_phage(27.27%)	52	1321149:1321208	1358597:1358814
AWK14200.1|1297568_1297934_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK15353.1|1298251_1298620_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14201.1|1299077_1299977_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	62.1	3.0e-94
AWK14202.1|1300038_1300791_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.4	4.4e-83
AWK15354.1|1303532_1303901_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14203.1|1304856_1305951_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.6	2.5e-111
AWK14204.1|1306068_1306272_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14205.1|1306508_1306970_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14206.1|1307221_1307974_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.2	3.8e-79
AWK14207.1|1309253_1310288_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14208.1|1310317_1310548_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14209.1|1310925_1311405_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	49.4	2.7e-38
AWK14210.1|1311409_1311748_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	44.2	1.4e-17
AWK14211.1|1311904_1312360_+	hypothetical protein	NA	A0A1B2AQ31	Escherichia_phage	33.3	5.4e-20
AWK14212.1|1312906_1313161_+	antitoxin ChpS	NA	NA	NA	NA	NA
AWK14213.1|1313154_1313508_+	toxin ChpB	NA	NA	NA	NA	NA
AWK14214.1|1314287_1314599_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	60.2	1.6e-31
AWK14215.1|1314595_1314811_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	66.7	5.0e-08
AWK15355.1|1315269_1315638_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14216.1|1315793_1318367_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	29.5	1.8e-80
AWK14217.1|1318538_1319279_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	59.8	6.0e-85
AWK14218.1|1320039_1321104_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14219.1|1321041_1321323_+	hypothetical protein	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	57.1	1.0e-08
1321149:1321208	attL	TATAGAACAAGCGGTGGTGAATATGGCTTACGACTATCCTGCTTATGGTCAGCACCGTGT	NA	NA	NA	NA
AWK14220.1|1321582_1322557_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWK14221.1|1322553_1323318_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	60.6	5.6e-86
AWK14222.1|1323921_1325610_-	DNA recombinase	NA	A0A1B2LRQ3	Wolbachia_phage	40.9	4.0e-100
AWK14223.1|1325606_1325801_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14224.1|1329451_1329637_+	hypothetical protein	NA	A0A088CD40	Shigella_phage	50.0	4.4e-05
AWK14225.1|1329668_1329866_-	dipicolinate synthase	NA	B7SYF9	Stenotrophomonas_phage	50.0	9.2e-09
AWK14226.1|1330093_1330801_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14227.1|1330917_1332207_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.1	1.1e-73
AWK14228.1|1332557_1333628_-	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AWK14229.1|1333627_1334734_-	lipopolysaccharide ABC transporter permease LptF	NA	NA	NA	NA	NA
AWK15356.1|1335103_1336627_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.2	1.8e-46
AWK14230.1|1337348_1339124_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWK14231.1|1339318_1339633_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14232.1|1340187_1340736_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14233.1|1340802_1341432_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.8	1.5e-20
AWK14234.1|1341628_1342732_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AWK14235.1|1342822_1343668_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.5	4.7e-41
AWK14236.1|1344416_1345235_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AWK14237.1|1345282_1345474_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14238.1|1345470_1346490_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWK14239.1|1349213_1350005_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AWK14240.1|1350025_1350613_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14241.1|1351046_1351382_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AWK14242.1|1351479_1355031_+	exodeoxyribonuclease V subunit beta	NA	NA	NA	NA	NA
AWK14243.1|1355027_1357055_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	25.6	2.8e-23
AWK14244.1|1357089_1357656_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15357.1|1357747_1358116_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK14245.1|1358942_1359917_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1358597:1358814	attR	TATAGAACAAGCGGTGGTGAATATGGCTTACGACTATCCTGCTTATGGTCAGCACCGTGTGGCGAATGAACTTAACCGACAGGGGATAATGATTTCCGGCAGTGGTGTTCGCTCGGTTTGGTTGCGCCCTTATATCTTGATTATTAACTTTCAAAGGTTGATGATCCCCAACTGATCATTGGGATGTCACCGGAGAGTTTGTTTGCGCCCTTAGGCTT	NA	NA	NA	NA
AWK14246.1|1359913_1360678_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	60.2	6.2e-85
>prophage 12
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1716833	1729555	2824008	tRNA	Tupanvirus(37.5%)	13	NA	NA
AWK14463.1|1716833_1717838_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.7	4.1e-44
AWK14464.1|1717827_1718202_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14465.1|1718368_1718560_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14466.1|1718780_1719497_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14467.1|1719854_1720154_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	37.7	2.9e-06
AWK14468.1|1720158_1722546_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	2.1e-09
AWK14469.1|1722560_1723544_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.4	2.2e-34
AWK14470.1|1723869_1724253_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWK14471.1|1724292_1724496_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWK14472.1|1724656_1725208_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	8.3e-15
AWK14473.1|1725211_1727167_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.4e-127
AWK14474.1|1727273_1728854_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.4	2.1e-58
AWK14475.1|1729030_1729555_-	outer membrane protein OmpX	NA	Q9LA63	Enterobacterial_phage	32.7	2.5e-13
>prophage 13
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	1748310	1828954	2824008	protease,transposase,integrase,tRNA	Cronobacter_phage(11.76%)	58	1820041:1820060	1830393:1830412
AWK15384.1|1748310_1749927_+|protease	Lon protease	protease	NA	NA	NA	NA
AWK14484.1|1750053_1750590_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
AWK14485.1|1750668_1750839_-	ribosome modulation factor	NA	NA	NA	NA	NA
AWK14486.1|1751139_1752519_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14487.1|1752563_1754495_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.5e-42
AWK14488.1|1757456_1757636_+	hypothetical protein	NA	A0A0N9SHJ4	Paenibacillus_phage	46.2	4.2e-08
AWK14489.1|1757886_1758987_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14490.1|1759583_1760345_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14491.1|1762387_1763464_+	bifunctional riboflavin kinase/FMN adenylyltransferase	NA	NA	NA	NA	NA
AWK14492.1|1763496_1766313_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.3	1.2e-72
AWK14493.1|1766312_1766825_+	signal peptidase II	NA	NA	NA	NA	NA
AWK14494.1|1766831_1767302_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWK14495.1|1767282_1768236_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AWK14496.1|1768317_1769130_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AWK14497.1|1769359_1770529_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.2	5.8e-50
AWK14498.1|1770544_1773844_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AWK15385.1|1773858_1774368_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	44.0	1.8e-32
AWK14499.1|1774430_1776104_+	lipid A phosphoethanolamine transferase	NA	NA	NA	NA	NA
AWK14500.1|1776371_1776635_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWK14501.1|1776780_1777746_-	lipopolysaccharide heptosyltransferase 1	NA	NA	NA	NA	NA
AWK14502.1|1777745_1778807_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
AWK14503.1|1778863_1779799_-	ADP-glyceromanno-heptose 6-epimerase	NA	A0A1D8KKD9	Synechococcus_phage	33.5	5.7e-24
AWK14504.1|1779877_1780324_-	universal stress global response regulator UspA	NA	NA	NA	NA	NA
AWK14505.1|1780382_1781894_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
AWK14506.1|1782103_1783096_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14507.1|1784007_1785831_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14508.1|1786016_1786745_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWK14509.1|1788683_1789352_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	62.1	9.0e-64
AWK14510.1|1789626_1790901_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.0	2.7e-125
AWK14511.1|1791083_1793441_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	4.7e-224
AWK14512.1|1793527_1795411_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWK14513.1|1795553_1795940_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14514.1|1796100_1796838_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.9	1.8e-73
AWK14515.1|1797124_1798600_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14516.1|1799655_1800666_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWK14517.1|1800871_1801483_-	repressor LexA	NA	U5P451	Shigella_phage	44.4	1.6e-11
AWK14518.1|1801587_1802952_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AWK14519.1|1803031_1804840_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AWK14520.1|1806093_1806579_+	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
AWK14521.1|1806652_1806868_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14522.1|1806884_1807076_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14523.1|1807274_1807742_-	hypothetical protein	NA	S5WIN0	Leptospira_phage	59.3	2.7e-46
AWK14524.1|1807773_1807950_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14525.1|1808727_1809438_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK14526.1|1809515_1809725_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14527.1|1809711_1809918_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14528.1|1812782_1813526_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14529.1|1813922_1816013_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14530.1|1816954_1819738_-	hypothetical protein	NA	F1C571	Cronobacter_phage	42.9	6.0e-178
AWK14531.1|1819824_1820859_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1820041:1820060	attL	AAGCCTGAAAATGGCGGCTC	NA	NA	NA	NA
AWK14532.1|1820752_1822282_-	hypothetical protein	NA	F1C571	Cronobacter_phage	69.7	1.1e-194
AWK14533.1|1823273_1823720_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14534.1|1823857_1824565_-	peptidase P60	NA	K7PJV6	Enterobacteria_phage	71.2	2.1e-103
AWK15386.1|1824810_1825137_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14535.1|1825139_1826018_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.8	6.6e-38
AWK14536.1|1826007_1826382_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15387.1|1826855_1827683_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	34.6	9.9e-36
AWK14537.1|1827919_1828954_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
1830393:1830412	attR	GAGCCGCCATTTTCAGGCTT	NA	NA	NA	NA
>prophage 14
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	2040643	2116053	2824008	lysis,protease,transposase,tRNA	Shigella_phage(16.67%)	53	NA	NA
AWK14681.1|2040643_2041363_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AWK15403.1|2042850_2045688_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AWK14682.1|2045911_2046664_-	phosphoglyceromutase	NA	NA	NA	NA	NA
AWK14683.1|2046772_2047594_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWK14684.1|2048030_2048162_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AWK14685.1|2048195_2048978_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWK14686.1|2049006_2050029_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AWK14687.1|2050249_2052145_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	2.9e-91
AWK15404.1|2052258_2053062_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AWK14688.1|2053288_2053921_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
AWK14689.1|2054202_2055678_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AWK14690.1|2055862_2056579_+	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	44.9	4.1e-38
AWK14691.1|2056589_2057756_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.7	1.8e-88
AWK14692.1|2057741_2058434_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.8	2.8e-44
AWK14693.1|2058801_2059050_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14694.1|2059162_2060197_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14695.1|2060407_2061022_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWK14696.1|2061033_2061525_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AWK14697.1|2061563_2062307_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWK14698.1|2064527_2064923_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15405.1|2069143_2069647_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14699.1|2070097_2071663_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
AWK14700.1|2072830_2072971_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
AWK14701.1|2073077_2073761_+	protein TolQ	NA	NA	NA	NA	NA
AWK14702.1|2073799_2074228_+	protein TolR	NA	NA	NA	NA	NA
AWK14703.1|2075590_2076886_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
AWK14704.1|2076932_2077445_+	peptidoglycan-associated lipoprotein	NA	NA	NA	NA	NA
AWK14705.1|2077454_2078222_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AWK14706.1|2079507_2079879_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14707.1|2079948_2080734_-	hypothetical protein	NA	U5P429	Shigella_phage	26.5	5.7e-09
AWK14708.1|2081443_2082478_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14709.1|2082492_2082678_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14710.1|2082924_2083089_-	transcriptional regulator	NA	Q716D6	Shigella_phage	66.7	4.8e-11
AWK14711.1|2083095_2084130_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK14712.1|2085781_2085967_+	hypothetical protein	NA	A0A0A7NQP6	Lactobacillus_phage	47.2	3.3e-08
AWK14713.1|2085941_2086346_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14714.1|2088575_2090120_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14715.1|2090116_2097148_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14716.1|2098738_2098942_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	79.4	4.4e-22
AWK14717.1|2098938_2099442_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	66.5	8.6e-59
AWK14718.1|2099661_2099796_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14719.1|2100221_2100524_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14720.1|2101370_2101892_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14721.1|2103563_2104718_+	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
AWK14722.1|2104839_2105496_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AWK14723.1|2106494_2106806_-	Z-ring-associated protein	NA	NA	NA	NA	NA
AWK14724.1|2106927_2109600_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.7	1.6e-18
AWK14725.1|2109906_2111307_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.9	4.8e-75
AWK14726.1|2111609_2112689_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	4.6e-94
AWK14727.1|2112916_2114128_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AWK14728.1|2114158_2114719_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
AWK14729.1|2114820_2115012_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK14730.1|2115018_2116053_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	2125204	2150475	2824008	capsid,tail,plate,portal,transposase	Salmonella_phage(40.0%)	28	NA	NA
AWK14740.1|2125204_2126209_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	66.5	8.9e-132
AWK14741.1|2126208_2128002_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	62.0	1.1e-217
AWK14742.1|2128167_2128983_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	50.2	6.2e-59
AWK14743.1|2128984_2130073_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	62.9	6.5e-120
AWK14744.1|2129960_2130563_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	50.5	3.2e-44
AWK14745.1|2130751_2131231_+	hypothetical protein	NA	K4NZV5	Burkholderia_phage	46.9	2.6e-28
AWK14746.1|2131329_2131533_+|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	62.7	1.7e-18
AWK14747.1|2131551_2131803_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14748.1|2131786_2132305_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	67.3	1.6e-63
AWK14749.1|2132297_2132768_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15406.1|2133236_2133683_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	50.3	2.8e-29
AWK14750.1|2133702_2133987_-	transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	48.4	1.7e-16
AWK14751.1|2133983_2134298_-	hypothetical protein	NA	Q6UAT3	Klebsiella_phage	54.8	1.1e-24
AWK14752.1|2135065_2135413_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	57.7	1.7e-29
AWK14753.1|2135412_2136321_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.5	2.1e-108
AWK14754.1|2136536_2136731_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15407.1|2138232_2138433_+	hypothetical protein	NA	F1BUK2	Cronobacter_phage	61.4	1.3e-10
AWK14755.1|2138714_2140265_+	hypothetical protein	NA	NA	NA	NA	NA
AWK14756.1|2140342_2140771_-	hypothetical protein	NA	NA	NA	NA	NA
AWK14757.1|2140785_2141517_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15408.1|2141773_2142877_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWK14758.1|2142889_2143450_+	DNA-invertase	NA	A0A286S1P7	Klebsiella_phage	63.5	8.4e-55
AWK14759.1|2144728_2145244_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	60.2	4.7e-60
AWK14760.1|2145405_2145756_+|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	52.6	1.0e-18
AWK14761.1|2145770_2145890_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	1.8e-07
AWK14762.1|2145882_2148654_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	49.8	6.8e-198
AWK14763.1|2148739_2149504_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	60.6	1.9e-86
AWK14764.1|2149500_2150475_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	2523759	2589186	2824008	protease,tail,transposase,tRNA	Bacillus_phage(15.38%)	59	NA	NA
AWK15040.1|2523759_2525115_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AWK15041.1|2525149_2527537_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AWK15042.1|2527640_2528138_+	molecular chaperone	NA	NA	NA	NA	NA
AWK15043.1|2528141_2529209_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AWK15044.1|2529339_2529819_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AWK15045.1|2529815_2530604_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AWK15046.1|2530607_2531807_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AWK15047.1|2532812_2533847_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK15048.1|2533784_2534057_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15049.1|2534428_2537059_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.5	2.8e-76
AWK15050.1|2537310_2537496_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	70.6	7.6e-13
AWK15051.1|2537889_2539161_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWK15052.1|2539362_2539626_-	cell division protein BolA	NA	NA	NA	NA	NA
AWK15053.1|2539788_2540082_-	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AWK15054.1|2540084_2540711_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AWK15055.1|2540806_2541307_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AWK15056.1|2541310_2542093_-	ABC transporter permease	NA	NA	NA	NA	NA
AWK15057.1|2542280_2543111_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G9BWD6	Planktothrix_phage	30.7	3.4e-20
AWK15058.1|2543189_2544332_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.8	6.2e-113
AWK15059.1|2544595_2545084_-	hypothetical protein	NA	B5TK85	Pseudomonas_phage	43.7	1.3e-24
AWK15060.1|2545346_2546309_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
AWK15061.1|2546320_2546722_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWK15062.1|2546724_2547036_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
AWK15442.1|2547056_2549609_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AWK15063.1|2549613_2550315_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AWK15443.1|2550349_2551237_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
AWK15064.1|2551239_2551716_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15065.1|2553077_2553869_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AWK15066.1|2553883_2555221_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AWK15067.1|2555388_2555970_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.4	3.4e-67
AWK15068.1|2556076_2558101_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AWK15069.1|2558407_2560096_+	AsmA family protein	NA	NA	NA	NA	NA
AWK15444.1|2560177_2560798_+	protein disulfide oxidoreductase DsbA	NA	NA	NA	NA	NA
AWK15070.1|2560956_2561502_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15071.1|2564892_2565513_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AWK15072.1|2565613_2565841_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15073.1|2565826_2566546_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.2	1.3e-28
AWK15074.1|2566542_2567874_+	two-component system sensor histidine kinase EnvZ	NA	NA	NA	NA	NA
AWK15075.1|2567916_2568297_-	glyoxalase	NA	NA	NA	NA	NA
AWK15076.1|2568627_2569683_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15445.1|2570844_2571123_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	58.7	5.8e-25
AWK15077.1|2571122_2571407_+	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	53.4	9.5e-23
AWK15078.1|2571629_2571878_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15079.1|2571815_2572067_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	53.0	5.6e-19
AWK15080.1|2572612_2572882_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15081.1|2573741_2574464_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK15446.1|2574698_2574968_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	59.1	1.2e-19
AWK15082.1|2576816_2577636_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWK15083.1|2577682_2578114_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWK15084.1|2579299_2579485_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15085.1|2579597_2579969_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15086.1|2580063_2580288_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15087.1|2580761_2581559_+	hypothetical protein	NA	K7PL20	Enterobacteria_phage	51.6	4.3e-36
AWK15088.1|2582696_2583083_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15089.1|2583104_2583638_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15090.1|2583867_2584311_+	hypothetical protein	NA	A0A0K0MDC7	Pseudoalteromonas_phage	27.3	6.3e-05
AWK15091.1|2584393_2586331_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15092.1|2588237_2588687_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWK15093.1|2588709_2589186_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 17
CP021659	Candidatus Fukatsuia symbiotica strain 5D chromosome, complete genome	2824008	2613317	2664148	2824008	integrase,transposase,tRNA	Escherichia_phage(28.57%)	39	2623491:2623505	2665190:2665204
AWK15109.1|2613317_2613746_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15110.1|2613771_2614140_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15111.1|2614254_2614869_-	resolvase	NA	A0A0C4UR34	Shigella_phage	48.7	2.7e-38
AWK15112.1|2614984_2616157_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15113.1|2617065_2618730_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15114.1|2619369_2619825_+	heat-shock protein	NA	NA	NA	NA	NA
AWK15115.1|2620163_2620772_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15116.1|2620660_2621860_+	hypothetical protein	NA	G1BEM4	Escherichia_phage	37.1	1.6e-31
AWK15117.1|2622569_2622851_+	hypothetical protein	NA	A0A077SLK2	Escherichia_phage	50.6	2.6e-20
AWK15118.1|2623402_2623639_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
2623491:2623505	attL	TTGAAATTATCGTTG	NA	NA	NA	NA
AWK15119.1|2623625_2624036_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AWK15120.1|2631625_2631886_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15121.1|2632344_2632632_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AWK15122.1|2632631_2632853_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15123.1|2633315_2633522_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15124.1|2633662_2634028_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	41.2	1.4e-13
AWK15125.1|2635568_2636918_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
AWK15126.1|2637134_2640194_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15127.1|2640195_2641563_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AWK15128.1|2642850_2643834_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWK15129.1|2643901_2644681_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15130.1|2644677_2645286_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AWK15131.1|2646291_2646921_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AWK15132.1|2646917_2647343_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AWK15133.1|2647324_2649916_-	type-IV secretion system protein TraC	NA	NA	NA	NA	NA
AWK15134.1|2649928_2650426_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AWK15135.1|2651840_2652563_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AWK15136.1|2652549_2653116_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AWK15137.1|2653134_2653443_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWK15449.1|2653469_2653715_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15138.1|2654662_2656288_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15139.1|2656724_2658233_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.8	4.1e-72
AWK15450.1|2658726_2659095_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK15140.1|2659302_2659566_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15141.1|2660296_2660683_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15142.1|2660898_2661336_+	hypothetical protein	NA	A0A0N9SHJ4	Paenibacillus_phage	44.9	1.7e-15
AWK15143.1|2661163_2661646_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15144.1|2661912_2663010_-|integrase	integrase	integrase	A0A1W6JP34	Morganella_phage	72.0	5.5e-151
AWK15451.1|2663101_2664148_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2665190:2665204	attR	TTGAAATTATCGTTG	NA	NA	NA	NA
>prophage 1
CP021660	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-1, complete sequence	148316	90093	138972	148316	transposase	Sodalis_phage(20.0%)	42	NA	NA
AWK15528.1|90093_90459_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	47.0	8.5e-16
AWK15529.1|90834_91155_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15530.1|91239_92253_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.7	2.9e-45
AWK15531.1|93069_93198_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15532.1|95514_96105_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15533.1|96504_96690_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15534.1|96889_97753_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15535.1|98158_99268_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15536.1|99493_100588_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AWK15537.1|100816_101071_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15538.1|101067_101853_-	cobalamin biosynthesis protein CbiA	NA	F0PIG8	Enterococcus_phage	32.2	4.2e-12
AWK15539.1|102733_103360_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15540.1|103372_104515_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15541.1|104518_105838_+	ABC transporter	NA	NA	NA	NA	NA
AWK15542.1|105841_106699_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15543.1|107338_109003_+|transposase	transposase	transposase	M4T586	Rhodobacter_phage	24.6	1.3e-05
AWK15544.1|109911_111084_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK15545.1|111199_111814_+	resolvase	NA	A0A0C4UR34	Shigella_phage	48.7	2.7e-38
AWK15546.1|112469_112838_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15547.1|113629_116299_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15548.1|116382_116892_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15549.1|117445_118156_-	transcriptional regulator	NA	Q2A088	Sodalis_phage	31.4	9.4e-19
AWK15550.1|118831_119563_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWK15551.1|119954_120587_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
AWK15552.1|120918_121149_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15553.1|121097_121832_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15554.1|122047_122230_+	mRNA interferase	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	56.7	1.7e-09
AWK15555.1|122258_122687_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	72.7	1.7e-52
AWK15556.1|122880_123150_-	transcriptional regulator	NA	A3E2I1	Sodalis_phage	56.8	1.3e-18
AWK15557.1|123993_124296_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15558.1|124386_124818_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	31.4	1.1e-14
AWK15559.1|125230_125539_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15560.1|125605_126253_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15561.1|126500_127016_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWK15562.1|126999_127293_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15563.1|131134_131782_+	resolvase	NA	NA	NA	NA	NA
AWK15564.1|131783_131990_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15565.1|132117_133590_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15566.1|133643_134612_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15567.1|134662_137368_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15568.1|137343_137694_+	hypothetical protein	NA	NA	NA	NA	NA
AWK15569.1|137937_138972_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	0	5258	67447		Escherichia_phage(100.0%)	5	NA	NA
AWK15691.1|595_1105_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15692.1|1332_1536_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15693.1|1691_1985_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK15694.1|2056_2947_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15695.1|4298_5258_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	42.0	2.4e-65
>prophage 2
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	11523	14512	67447	transposase	Wolbachia_phage(66.67%)	4	NA	NA
AWK15701.1|11523_12090_+	DNA invertase	NA	Q1MVP4	Enterobacteria_phage	48.3	2.6e-40
AWK15702.1|12234_13269_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AWK15703.1|13271_13562_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	51.2	1.5e-15
AWK15704.1|13498_14512_-	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.9	5.2e-39
>prophage 3
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	28127	29516	67447		Aichi_virus(100.0%)	1	NA	NA
AWK15711.1|28127_29516_+	MFS transporter	NA	O13311	Aichi_virus	24.7	6.3e-11
>prophage 4
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	33875	34148	67447		Streptococcus_phage(100.0%)	1	NA	NA
AWK15713.1|33875_34148_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A1S5SCV8	Streptococcus_phage	44.8	2.5e-12
>prophage 5
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	44715	44868	67447		Stx_converting_phage(100.0%)	1	NA	NA
AWK15723.1|44715_44868_-	small toxic polypeptide	NA	A0A1I9LJU7	Stx_converting_phage	51.1	8.1e-05
>prophage 6
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	53094	55895	67447		Wolbachia_phage(25.0%)	5	NA	NA
AWK15746.1|53094_53592_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	36.0	1.8e-21
AWK15730.1|53840_54182_+	hypothetical protein	NA	O64357	Escherichia_phage	37.2	1.8e-07
AWK15731.1|54178_54463_+	transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	45.8	4.0e-13
AWK15732.1|54713_54938_-	hypothetical protein	NA	NA	NA	NA	NA
AWK15733.1|55088_55895_+	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	42.4	4.1e-55
>prophage 7
CP021662	Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-3, complete sequence	67447	63315	64556	67447		Wolbachia_phage(100.0%)	2	NA	NA
AWK15738.1|63315_64329_+	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	36.9	5.2e-39
AWK15739.1|64265_64556_+	hypothetical protein	NA	Q9JMP3	Wolbachia_phage	51.2	1.5e-15
