The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	326317	337198	5198840	transposase	Enterobacteria_phage(22.22%)	10	NA	NA
AWJ42160.1|326317_327373_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AWJ42161.1|327660_328764_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWJ42162.1|328775_330029_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
AWJ42163.1|330384_331599_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.5	7.5e-133
AWJ42164.1|331741_332623_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42165.1|332820_333018_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
AWJ42166.1|333017_333449_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
AWJ42167.1|333461_334295_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AWJ42168.1|334413_335627_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ42169.1|336127_337198_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
>prophage 2
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	550995	630887	5198840	protease,transposase,capsid,tail,tRNA,head	Escherichia_phage(33.33%)	75	NA	NA
AWJ42369.1|550995_551475_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWJ42370.1|551490_551769_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42371.1|551678_552473_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42372.1|552610_552952_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
AWJ42373.1|553065_555570_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
AWJ42374.1|555831_556764_+	glutaminase	NA	NA	NA	NA	NA
AWJ42375.1|556766_558059_+	amino acid permease	NA	NA	NA	NA	NA
AWJ42376.1|558183_558591_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ42377.1|558591_559050_-	NfeD family protein	NA	NA	NA	NA	NA
AWJ42378.1|559046_559964_-	paraslipin	NA	NA	NA	NA	NA
AWJ42379.1|560109_560787_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
AWJ42380.1|560773_561556_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWJ42381.1|561618_562473_-	co-chaperone YbbN	NA	NA	NA	NA	NA
AWJ42382.1|562533_563343_-	oxidoreductase	NA	NA	NA	NA	NA
AWJ42383.1|563332_563959_-	arylesterase	NA	NA	NA	NA	NA
AWJ42384.1|563926_564613_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
AWJ42385.1|564609_567024_+	ABC transporter permease	NA	NA	NA	NA	NA
AWJ42386.1|571645_571906_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42387.1|571944_572136_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42388.1|573137_574232_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWJ42389.1|574300_575227_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AWJ42390.1|575456_575939_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AWJ42391.1|576016_576832_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ42392.1|576921_578703_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
AWJ42393.1|578715_579492_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWJ42394.1|579591_580470_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AWJ42395.1|580638_582093_+	allantoin permease	NA	NA	NA	NA	NA
AWJ42396.1|582152_583514_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AWJ42397.1|583570_584872_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AWJ42398.1|584893_586039_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
AWJ42399.1|586167_586953_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AWJ42400.1|586963_588199_-	allantoate amidohydrolase	NA	NA	NA	NA	NA
AWJ42401.1|588220_589270_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AWJ42402.1|589586_591254_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
AWJ42403.1|591263_592523_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AWJ42404.1|592533_593349_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AWJ42405.1|593345_594239_+	carbamate kinase	NA	NA	NA	NA	NA
AWJ42406.1|594375_595443_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWJ42407.1|595439_595949_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWJ42408.1|596066_596789_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AWJ42409.1|596791_597286_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWJ42410.1|597459_598845_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWJ42411.1|598880_599402_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ42412.1|599509_599722_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ42413.1|599723_600590_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ42414.1|601070_601613_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ42415.1|601832_602525_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWJ42416.1|602555_605165_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ46740.1|605206_606172_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ42417.1|606216_606732_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ42418.1|606734_607367_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ42419.1|608577_608910_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ42420.1|608965_609991_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
AWJ42421.1|610032_610428_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWJ42422.1|610439_610739_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
AWJ42423.1|610759_611972_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AWJ42424.1|612065_612644_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWJ42425.1|612640_613036_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
AWJ46742.1|613043_613784_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWJ42426.1|613799_614222_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWJ42427.1|614203_614638_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWJ42428.1|614630_616811_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AWJ42429.1|616816_618029_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ46741.1|618099_618726_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ42430.1|618824_619130_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ42431.1|619313_620798_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ42432.1|620984_621938_-|protease	protease 7	protease	NA	NA	NA	NA
AWJ42433.1|621963_622155_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42434.1|622340_622457_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42435.1|622450_623212_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ42436.1|623268_623481_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42437.1|623394_624285_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42438.1|624285_627258_-	phage receptor	NA	NA	NA	NA	NA
AWJ42439.1|627244_629482_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWJ42440.1|629750_630887_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	850433	868387	5198840	transposase,integrase,holin	Enterobacteria_phage(50.0%)	25	860253:860267	867703:867717
AWJ42638.1|850433_851510_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
AWJ42639.1|851523_851934_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.2	1.1e-64
AWJ42640.1|851917_853131_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ42641.1|853136_853334_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
AWJ42642.1|853333_853549_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWJ42643.1|853547_853709_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42644.1|853987_855838_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWJ42645.1|856380_857097_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42646.1|857308_857998_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWJ42647.1|858012_858135_-	YlcG family protein	NA	NA	NA	NA	NA
AWJ42648.1|858474_859434_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWJ42649.1|859645_859834_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWJ42650.1|859830_860193_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
AWJ42651.1|860189_860480_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
860253:860267	attL	GTAAAGTCTGGCGTC	NA	NA	NA	NA
AWJ42652.1|860472_860685_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
AWJ42653.1|860677_860854_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AWJ42654.1|860853_861213_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
AWJ46748.1|861215_861371_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.0	4.7e-24
AWJ42655.1|861437_862650_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ42656.1|862692_862896_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	97.0	1.4e-28
AWJ42657.1|863001_863883_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWJ42658.1|864106_864937_+	cell division protein	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
AWJ42659.1|865060_865432_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWJ42660.1|866650_867031_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42661.1|867174_868387_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
867703:867717	attR	GTAAAGTCTGGCGTC	NA	NA	NA	NA
>prophage 4
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1079041	1121604	5198840	transposase,protease,holin,lysis	Escherichia_phage(37.93%)	62	NA	NA
AWJ42839.1|1079041_1080802_-|protease	Lon protease	protease	NA	NA	NA	NA
AWJ42840.1|1080987_1081440_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWJ46755.1|1081515_1082556_-	outer membrane protein A	NA	NA	NA	NA	NA
AWJ42841.1|1082710_1082929_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42842.1|1082912_1083422_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWJ42843.1|1083694_1084270_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AWJ46756.1|1084232_1086386_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWJ42844.1|1086404_1086851_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWJ42845.1|1086973_1089028_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
AWJ42846.1|1089059_1089518_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWJ42847.1|1089613_1090276_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWJ42848.1|1090448_1090862_+	CoA-binding protein	NA	NA	NA	NA	NA
AWJ42849.1|1090906_1091224_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWJ42850.1|1091281_1092472_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AWJ42851.1|1092566_1092845_+	acylphosphatase	NA	NA	NA	NA	NA
AWJ42852.1|1092841_1093171_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWJ42853.1|1093261_1093921_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
AWJ42854.1|1096730_1097944_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ42855.1|1097995_1099420_-	exonuclease	NA	NA	NA	NA	NA
AWJ42856.1|1099512_1099704_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ42857.1|1099700_1099889_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ46757.1|1100420_1100795_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42858.1|1100806_1100959_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
AWJ42859.1|1100996_1101191_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42860.1|1101231_1101948_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
AWJ42861.1|1101997_1102213_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ42862.1|1102209_1102635_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ42863.1|1102706_1103777_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
AWJ42864.1|1103817_1104240_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
AWJ42865.1|1104236_1104533_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
AWJ42866.1|1104529_1104991_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ42867.1|1104968_1105325_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWJ42868.1|1105375_1105588_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ42869.1|1105673_1105838_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ42870.1|1105839_1106103_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ42871.1|1106113_1106983_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWJ42872.1|1107098_1107203_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42873.1|1107191_1107347_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
AWJ42874.1|1107391_1107604_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
AWJ42875.1|1107771_1108032_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42876.1|1108051_1109101_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
AWJ42877.1|1109113_1109485_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWJ42878.1|1109474_1109846_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWJ42879.1|1109997_1110816_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWJ42880.1|1111102_1111300_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWJ42881.1|1111752_1112151_+	envelope protein	NA	NA	NA	NA	NA
AWJ42882.1|1112597_1112801_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWJ42883.1|1112918_1114769_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWJ42884.1|1115047_1115209_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42885.1|1115207_1115423_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWJ42886.1|1115385_1115730_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42887.1|1115678_1115915_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ42888.1|1115883_1116066_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42889.1|1116110_1116644_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AWJ42890.1|1116864_1116978_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
AWJ42891.1|1116979_1117447_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWJ42892.1|1117529_1117670_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ42893.1|1117911_1118226_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ46758.1|1118307_1118532_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AWJ42894.1|1118581_1119795_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ42895.1|1119881_1120775_-	molecular chaperone Tir	NA	NA	NA	NA	NA
AWJ42896.1|1121220_1121604_-	secretion protein EspV	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
>prophage 5
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1345181	1415590	5198840	integrase,transposase,capsid,holin,tail,tRNA,terminase,lysis,head	Stx2-converting_phage(32.14%)	80	1340275:1340289	1346756:1346770
1340275:1340289	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWJ43122.1|1345181_1346300_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
AWJ43123.1|1346268_1346538_-	excisionase	NA	NA	NA	NA	NA
AWJ43124.1|1346599_1349065_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
1346756:1346770	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWJ43125.1|1349157_1349349_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ43126.1|1349345_1349534_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ43127.1|1350017_1350236_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43128.1|1350276_1350666_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43129.1|1350592_1350757_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43130.1|1350961_1351240_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ43131.1|1351241_1351469_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43132.1|1351453_1351888_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43133.1|1351922_1352225_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
AWJ43134.1|1352221_1352647_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ43135.1|1352669_1353632_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AWJ43136.1|1353672_1354089_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
AWJ43137.1|1354128_1355342_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43138.1|1355404_1355659_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
AWJ43139.1|1355651_1355963_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
AWJ43140.1|1356268_1356847_+	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
AWJ43141.1|1356806_1357904_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
AWJ43142.1|1358538_1359752_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43143.1|1359789_1359930_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
AWJ43144.1|1359971_1360151_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43145.1|1360097_1360370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
AWJ43146.1|1360371_1361427_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
AWJ43147.1|1361427_1361793_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
AWJ43148.1|1361801_1362332_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWJ43149.1|1362450_1362771_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
AWJ43150.1|1362921_1363980_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
AWJ43151.1|1364471_1364657_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
AWJ43152.1|1364776_1366531_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
AWJ43153.1|1366570_1367784_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43154.1|1368218_1368380_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43155.1|1368378_1368594_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ43156.1|1368598_1368943_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ43157.1|1368993_1369527_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
AWJ43158.1|1369797_1370367_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ43159.1|1370520_1370988_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWJ43160.1|1371350_1371578_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWJ43161.1|1371619_1371985_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
AWJ46776.1|1371953_1372091_+	DNase	NA	NA	NA	NA	NA
AWJ43162.1|1372274_1372838_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWJ43163.1|1372834_1374496_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWJ43164.1|1374559_1376497_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
AWJ46777.1|1376541_1376763_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWJ43165.1|1379451_1379778_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ43166.1|1379787_1380138_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ43167.1|1380134_1380581_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ43168.1|1380577_1380922_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ43169.1|1380988_1381705_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AWJ43170.1|1381710_1382085_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
AWJ43171.1|1382108_1382390_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ43172.1|1382441_1385684_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.5	0.0e+00
AWJ43173.1|1385676_1386018_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
AWJ43174.1|1386017_1386716_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	4.4e-130
AWJ46778.1|1386732_1387053_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AWJ43175.1|1387160_1387334_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AWJ43176.1|1388381_1389119_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
AWJ43177.1|1389016_1389697_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWJ43178.1|1389933_1393413_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
AWJ43179.1|1393479_1394079_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
AWJ43180.1|1394143_1395466_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
AWJ43181.1|1395467_1395737_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
AWJ43182.1|1395952_1398301_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWJ43183.1|1398891_1402293_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
AWJ43184.1|1402449_1403040_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43185.1|1403062_1403188_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AWJ43186.1|1403267_1403543_-	secretion protein EspO	NA	NA	NA	NA	NA
AWJ43187.1|1403603_1404965_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
AWJ43188.1|1405085_1405298_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43189.1|1405328_1406192_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWJ43190.1|1406175_1407312_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWJ46779.1|1407290_1407506_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43191.1|1407561_1408791_+	peptidase T	NA	NA	NA	NA	NA
AWJ43192.1|1408936_1410058_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWJ43193.1|1410133_1411594_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWJ43194.1|1411593_1412265_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWJ43195.1|1412432_1413803_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWJ46780.1|1413806_1414448_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWJ43196.1|1414483_1415590_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1516806	1589828	5198840	protease,transposase,holin,tail,terminase,portal,lysis	Enterobacteria_phage(45.1%)	80	NA	NA
AWJ43292.1|1516806_1517355_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
AWJ43293.1|1518865_1519054_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43294.1|1519201_1520414_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43295.1|1520478_1521015_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
AWJ46788.1|1521047_1521329_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
AWJ43296.1|1521325_1521622_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
AWJ43297.1|1521618_1522080_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
AWJ43298.1|1522057_1522414_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
AWJ43299.1|1522509_1522881_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
AWJ43300.1|1522877_1523231_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
AWJ43301.1|1523436_1523736_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
AWJ43302.1|1523741_1523999_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
AWJ43303.1|1524134_1524413_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
AWJ43304.1|1524414_1525464_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
AWJ43305.1|1525476_1525851_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
AWJ43306.1|1525847_1526669_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AWJ43307.1|1526895_1527093_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AWJ43308.1|1527243_1528302_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
AWJ43309.1|1528896_1530843_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
AWJ43310.1|1530980_1531160_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWJ43311.1|1531200_1531446_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
AWJ43312.1|1531523_1531739_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ43313.1|1531742_1531988_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43314.1|1532013_1533226_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43315.1|1533649_1534183_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
AWJ43316.1|1534481_1534949_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	3.9e-74
AWJ43317.1|1535362_1535839_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWJ43318.1|1535835_1537959_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AWJ43319.1|1537931_1538168_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWJ43320.1|1538167_1539670_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWJ46789.1|1539683_1541639_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWJ43321.1|1541726_1542053_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWJ43322.1|1542045_1542327_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AWJ43323.1|1542329_1542953_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
AWJ43324.1|1542965_1543364_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AWJ43325.1|1543371_1544124_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AWJ43326.1|1544137_1544560_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AWJ43327.1|1544586_1544895_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AWJ43328.1|1544938_1547584_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
AWJ43329.1|1547580_1547910_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ43330.1|1548617_1549361_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWJ43331.1|1549258_1549939_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWJ43332.1|1550175_1553652_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.6	0.0e+00
AWJ43333.1|1553719_1554319_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWJ43334.1|1554383_1555697_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
AWJ43335.1|1555698_1555968_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWJ43336.1|1557103_1557694_+	protein kinase	NA	NA	NA	NA	NA
AWJ43337.1|1558730_1559237_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWJ43338.1|1559282_1559783_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWJ43339.1|1559868_1560048_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43340.1|1560428_1561235_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWJ43341.1|1561234_1562428_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWJ46790.1|1562439_1563798_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AWJ43342.1|1563801_1565397_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWJ43343.1|1565396_1566959_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWJ46791.1|1567050_1567095_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWJ43344.1|1567232_1568114_+	phosphatase	NA	NA	NA	NA	NA
AWJ43345.1|1568110_1568731_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWJ43346.1|1568831_1569704_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWJ43347.1|1569743_1570334_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWJ43348.1|1570330_1571089_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
AWJ43349.1|1571308_1572358_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWJ43350.1|1572393_1572645_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43351.1|1572689_1572902_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43352.1|1573024_1575622_+	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AWJ43353.1|1575831_1576806_+	LysR family transcriptional regulator CysB	NA	NA	NA	NA	NA
AWJ43354.1|1577100_1577265_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
AWJ43355.1|1577267_1577435_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43356.1|1577571_1577754_+	acnA regulatory region 60-length spurious protein	NA	NA	NA	NA	NA
AWJ43357.1|1577807_1580483_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
AWJ43358.1|1580546_1581137_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
AWJ43359.1|1581306_1582071_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
AWJ43360.1|1582219_1582528_+	LPS assembly protein A	NA	NA	NA	NA	NA
AWJ43361.1|1582534_1583704_+	LPS assembly protein B	NA	NA	NA	NA	NA
AWJ43362.1|1583895_1584633_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AWJ43363.1|1584632_1584959_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
AWJ43364.1|1585084_1585303_-	osmotically-inducible lipoprotein B	NA	NA	NA	NA	NA
AWJ43365.1|1585571_1586321_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ43366.1|1586410_1586584_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43367.1|1588614_1589828_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 7
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1650212	1684013	5198840	transposase,tRNA,integrase,holin	Escherichia_phage(56.76%)	48	1649846:1649861	1681002:1681017
1649846:1649861	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
AWJ46793.1|1650212_1651445_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AWJ43426.1|1651699_1652683_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWJ43427.1|1652957_1653131_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43428.1|1653160_1654534_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWJ43429.1|1654662_1655598_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWJ43430.1|1655649_1656885_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AWJ43431.1|1656886_1657102_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWJ46795.1|1657201_1657390_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWJ46794.1|1657427_1657577_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWJ43432.1|1657632_1658442_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWJ43433.1|1658434_1661035_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
AWJ43434.1|1661136_1661412_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
AWJ46796.1|1661486_1661657_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWJ43435.1|1661656_1661878_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWJ43436.1|1662006_1662285_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43437.1|1662319_1662808_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AWJ43438.1|1662804_1662960_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AWJ43439.1|1662970_1663150_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43440.1|1663137_1663356_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43441.1|1663392_1663812_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
AWJ43442.1|1663891_1664146_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWJ43443.1|1664142_1664565_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
AWJ43444.1|1664642_1665431_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
AWJ43445.1|1665437_1666184_+	replication protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
AWJ43446.1|1666155_1666968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.5e-121
AWJ43447.1|1666983_1667406_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
AWJ43448.1|1667511_1667724_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ43449.1|1667809_1667974_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ43450.1|1667975_1668239_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ43451.1|1668249_1668411_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
AWJ43452.1|1668489_1668735_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
AWJ43453.1|1669166_1670318_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
AWJ43454.1|1670285_1671275_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43455.1|1671274_1672666_-	ATPase	NA	NA	NA	NA	NA
AWJ43456.1|1673165_1673765_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AWJ43457.1|1673764_1674055_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
AWJ43458.1|1674051_1674606_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
AWJ43459.1|1675167_1675599_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ43460.1|1675489_1675756_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43461.1|1676169_1678023_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
AWJ43462.1|1678172_1678388_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWJ43463.1|1678392_1678737_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWJ43464.1|1678787_1679321_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
AWJ43465.1|1679594_1680134_+	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
AWJ43466.1|1680136_1681350_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1681002:1681017	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
AWJ43467.1|1682376_1682655_-	secretion protein EspO	NA	NA	NA	NA	NA
AWJ43468.1|1683043_1683229_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43469.1|1683365_1684013_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
>prophage 8
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1697769	1717148	5198840	transposase,tail	Escherichia_phage(41.18%)	25	NA	NA
AWJ43485.1|1697769_1698177_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWJ43486.1|1698321_1698480_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ43487.1|1698463_1699015_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43488.1|1699815_1700481_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWJ43489.1|1700514_1701249_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
AWJ43490.1|1702108_1702867_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWJ43491.1|1703145_1703358_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWJ43492.1|1703578_1703836_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43493.1|1703905_1704184_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
AWJ43494.1|1704185_1705241_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
AWJ43495.1|1705241_1705607_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWJ43496.1|1705603_1706293_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWJ43497.1|1706323_1706470_+	antiterminator	NA	NA	NA	NA	NA
AWJ43498.1|1707234_1707501_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43499.1|1707645_1707774_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43500.1|1707822_1709592_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
AWJ43501.1|1709643_1710856_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43502.1|1710822_1710945_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	86.1	4.3e-09
AWJ43503.1|1710946_1711216_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWJ43504.1|1711356_1712232_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
AWJ46800.1|1712456_1712828_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ46801.1|1713702_1714017_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
AWJ43505.1|1714076_1715360_+	MFS transporter	NA	NA	NA	NA	NA
AWJ43506.1|1715448_1716909_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
AWJ43507.1|1716944_1717148_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	1915256	1978828	5198840	protease,transposase,capsid,holin,tail,terminase,lysis,head	Stx2-converting_phage(34.04%)	72	NA	NA
AWJ43669.1|1915256_1916390_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
AWJ43670.1|1916530_1916965_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWJ43671.1|1917545_1918187_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWJ43672.1|1918268_1918898_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWJ43673.1|1918970_1919546_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
AWJ43674.1|1919658_1919928_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
AWJ43675.1|1919929_1921243_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
AWJ43676.1|1921307_1921907_-	outer membrane protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
AWJ43677.1|1921977_1925475_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
AWJ43678.1|1925608_1926136_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWJ43679.1|1926166_1926373_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43680.1|1926326_1927007_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.1	5.7e-106
AWJ43681.1|1926904_1927648_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWJ43682.1|1927658_1928357_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
AWJ43683.1|1928356_1928698_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ43684.1|1928690_1931933_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.0	0.0e+00
AWJ43685.1|1931984_1932266_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ43686.1|1932289_1932664_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ43687.1|1932669_1933386_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
AWJ43688.1|1933454_1933799_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWJ43689.1|1933795_1934242_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ43690.1|1934238_1934589_-|head,tail	head-tail adaptor protein	head,tail	H6WZL5	Escherichia_phage	100.0	2.0e-59
AWJ43691.1|1934598_1934925_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ43692.1|1937289_1937511_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWJ43693.1|1937555_1939493_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
AWJ43694.1|1939556_1941218_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
AWJ43695.1|1941214_1941778_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
AWJ43696.1|1941961_1942105_-	DNase	NA	NA	NA	NA	NA
AWJ43697.1|1942067_1942433_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
AWJ43698.1|1942474_1942702_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWJ43699.1|1943070_1943295_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43700.1|1943291_1943786_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
AWJ43701.1|1943787_1944006_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	91.1	3.0e-16
AWJ43702.1|1944083_1944617_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWJ46810.1|1944667_1945012_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ43703.1|1945016_1945232_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWJ43704.1|1945668_1947519_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
AWJ43705.1|1947937_1948168_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43706.1|1948941_1949463_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43707.1|1949446_1949674_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ43708.1|1949751_1950159_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
AWJ43709.1|1950351_1950504_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AWJ46811.1|1950515_1950881_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43710.1|1950849_1951137_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43711.1|1951552_1951741_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ43712.1|1951737_1951872_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43713.1|1951923_1953136_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43714.1|1955650_1956864_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ43715.1|1957188_1957440_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWJ43716.1|1957459_1958755_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
AWJ43717.1|1958774_1958885_-	transporter	NA	NA	NA	NA	NA
AWJ43718.1|1958942_1959962_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWJ43719.1|1959973_1961188_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ43720.1|1961168_1961357_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ43721.1|1961393_1961720_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWJ43722.1|1961854_1962196_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWJ43723.1|1962230_1962791_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWJ46812.1|1962793_1963504_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWJ43724.1|1963611_1963917_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWJ43725.1|1964115_1966542_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
AWJ46813.1|1966602_1969026_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
AWJ43726.1|1969036_1969654_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWJ43727.1|1969655_1970510_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWJ43728.1|1970552_1971167_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWJ46814.1|1971325_1972618_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWJ43729.1|1972570_1973266_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AWJ43730.1|1973390_1974611_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AWJ43731.1|1974745_1975639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ43732.1|1975745_1976999_+	MFS transporter	NA	NA	NA	NA	NA
AWJ43733.1|1977395_1977731_+	acid shock protein	NA	NA	NA	NA	NA
AWJ43734.1|1977823_1977907_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43735.1|1978006_1978828_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 10
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2102309	2140393	5198840	transposase,capsid,plate,holin,tail,tRNA,terminase,portal	Enterobacteria_phage(86.11%)	46	NA	NA
AWJ46819.1|2102309_2102588_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
AWJ43852.1|2102598_2102877_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
AWJ43853.1|2102888_2103131_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWJ43854.1|2103195_2104077_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
AWJ43855.1|2105649_2106609_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
AWJ43856.1|2106613_2106925_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
AWJ43857.1|2107289_2107559_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43858.1|2108121_2108646_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43859.1|2108660_2109707_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
AWJ43860.1|2109706_2111458_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
AWJ43861.1|2111612_2112449_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AWJ43862.1|2112472_2113525_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AWJ43863.1|2113570_2114371_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
AWJ43864.1|2114473_2114968_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AWJ43865.1|2114967_2115168_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWJ43866.1|2115170_2115494_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWJ43867.1|2115490_2115883_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWJ43868.1|2115879_2116287_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
AWJ46820.1|2116258_2116438_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43869.1|2116424_2116892_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AWJ43870.1|2116884_2117520_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AWJ43871.1|2117516_2118098_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
AWJ43872.1|2118094_2118445_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWJ43873.1|2118448_2119345_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
AWJ43874.1|2119337_2119868_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWJ43875.1|2119870_2122003_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
AWJ43876.1|2122002_2122581_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
AWJ46821.1|2122624_2123101_-	serine acetyltransferase	NA	NA	NA	NA	NA
AWJ43877.1|2123353_2123848_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.8e-85
AWJ43878.1|2123854_2126662_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
AWJ43879.1|2126648_2126885_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWJ43880.1|2126812_2127187_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
AWJ43881.1|2127242_2127755_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
AWJ43882.1|2127754_2128939_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
AWJ43883.1|2129096_2130206_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
AWJ43884.1|2130431_2131934_+	DNA-binding protein	NA	NA	NA	NA	NA
AWJ43885.1|2132177_2132438_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ43886.1|2132628_2132769_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
AWJ43887.1|2133075_2133375_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWJ43888.1|2133379_2135767_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWJ43889.1|2135781_2136765_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWJ46822.1|2137048_2137093_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWJ43890.1|2137215_2137572_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWJ43891.1|2137624_2137822_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWJ43892.1|2137918_2138461_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWJ43893.1|2138464_2140393_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 11
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2360025	2447917	5198840	transposase,capsid,holin,tail,terminase,portal,lysis,head	Enterobacteria_phage(34.92%)	109	NA	NA
AWJ44110.1|2360025_2361239_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ44111.1|2361244_2362369_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	91.6	4.4e-188
AWJ44112.1|2363760_2364558_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ44113.1|2364567_2365119_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AWJ44114.1|2365287_2365620_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AWJ44115.1|2365953_2366268_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
AWJ44116.1|2366481_2368140_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
AWJ44117.1|2368132_2369128_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
AWJ44118.1|2369120_2369807_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
AWJ44119.1|2369806_2371180_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
AWJ44120.1|2371198_2371642_+	flagellar protein FliJ	NA	NA	NA	NA	NA
AWJ44121.1|2371638_2372766_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
AWJ44122.1|2372870_2373335_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
AWJ44123.1|2373339_2374344_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
AWJ44124.1|2374340_2374754_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
AWJ44125.1|2374756_2375122_+	flagellar protein FliO	NA	NA	NA	NA	NA
AWJ44126.1|2375121_2375859_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
AWJ44127.1|2375868_2376138_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
AWJ44128.1|2376145_2376931_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
AWJ44129.1|2377220_2377844_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
AWJ44130.1|2377887_2378130_-	DsrB protein	NA	NA	NA	NA	NA
AWJ44131.1|2378238_2378466_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AWJ44132.1|2378763_2379579_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
AWJ44133.1|2379575_2381270_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
AWJ44134.1|2381190_2381379_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44135.1|2381440_2381623_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWJ44136.1|2381701_2382619_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWJ44137.1|2382791_2383712_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWJ44138.1|2383700_2384171_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AWJ44139.1|2384151_2385570_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
AWJ44140.1|2385636_2386332_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AWJ44141.1|2386371_2386737_-	permease	NA	NA	NA	NA	NA
AWJ44142.1|2387303_2388467_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
AWJ44143.1|2389057_2389909_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWJ44144.1|2390016_2391375_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AWJ46833.1|2391374_2392046_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AWJ44145.1|2392178_2392592_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWJ44146.1|2392700_2393705_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AWJ44147.1|2393705_2394341_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AWJ44148.1|2394597_2395248_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWJ44149.1|2395590_2396121_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AWJ44150.1|2396143_2396386_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44151.1|2397355_2398342_-	peptidase M85	NA	NA	NA	NA	NA
AWJ44152.1|2398774_2399044_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
AWJ44153.1|2399045_2400368_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.4	1.6e-75
AWJ44154.1|2400432_2401032_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWJ44155.1|2401099_2404576_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWJ44156.1|2404822_2405503_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWJ44157.1|2406148_2406847_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWJ44158.1|2406846_2407176_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ44159.1|2407172_2409785_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
AWJ44160.1|2409765_2410179_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ44161.1|2410205_2410628_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ44162.1|2410641_2411394_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ44163.1|2411401_2411797_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWJ44164.1|2411793_2412327_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
AWJ44165.1|2412342_2412696_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AWJ44166.1|2412688_2413072_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWJ44167.1|2413123_2414152_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
AWJ44168.1|2414209_2414557_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
AWJ44169.1|2414593_2416099_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AWJ44170.1|2416088_2417681_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
AWJ44171.1|2417677_2417884_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ44172.1|2417867_2419796_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
AWJ46834.1|2419767_2420274_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
AWJ44173.1|2420700_2420925_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
AWJ44174.1|2421006_2421321_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ44175.1|2421561_2421702_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44176.1|2421784_2422252_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	89.0	5.5e-68
AWJ44177.1|2422253_2422472_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
AWJ44178.1|2422549_2423083_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
AWJ44179.1|2423641_2423857_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
AWJ44180.1|2423933_2424206_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWJ44181.1|2424246_2424426_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWJ44182.1|2424563_2426501_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
AWJ44183.1|2426549_2426678_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44184.1|2426822_2427089_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44185.1|2426979_2427411_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ44186.1|2427498_2427924_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AWJ44187.1|2427920_2428271_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWJ44188.1|2428301_2429915_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
AWJ44189.1|2430400_2431114_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ44190.1|2431248_2431446_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
AWJ44191.1|2431669_2432224_-	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
AWJ44192.1|2432232_2432592_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
AWJ44193.1|2432604_2433654_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWJ44194.1|2433655_2433928_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWJ44195.1|2434049_2434394_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWJ44196.1|2434513_2434726_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWJ44197.1|2434959_2435517_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWJ44198.1|2435518_2435737_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWJ44199.1|2435864_2436176_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
AWJ44200.1|2436168_2436396_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWJ46835.1|2436392_2436674_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWJ44201.1|2436706_2437423_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
AWJ44202.1|2437444_2438191_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
AWJ44203.1|2438197_2439268_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
AWJ44204.1|2439339_2439765_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ44205.1|2439748_2440030_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AWJ44206.1|2440129_2440549_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AWJ46836.1|2440814_2440967_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
AWJ44207.1|2440978_2441617_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWJ46838.1|2441617_2441827_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ46837.1|2441875_2442136_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44208.1|2442397_2442586_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ44209.1|2442582_2442774_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ44210.1|2442866_2445254_+	exonuclease	NA	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
AWJ46839.1|2445489_2446287_+	protein MtfA	NA	NA	NA	NA	NA
AWJ46840.1|2446642_2447917_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
>prophage 12
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	2680639	2742166	5198840	integrase,transposase,capsid,holin,terminase,lysis	Enterobacteria_phage(23.08%)	56	2711220:2711255	2743106:2743141
AWJ44417.1|2680639_2681128_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
AWJ46851.1|2681290_2682214_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
AWJ44418.1|2682680_2682905_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWJ44419.1|2685301_2685559_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44420.1|2685590_2686238_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ44421.1|2686272_2687325_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWJ44422.1|2687321_2687879_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWJ44423.1|2687875_2689819_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWJ44424.1|2689815_2690295_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWJ44425.1|2690291_2690501_-	heme exporter protein D	NA	NA	NA	NA	NA
AWJ44426.1|2690497_2691235_-	heme exporter protein C	NA	NA	NA	NA	NA
AWJ44427.1|2691276_2691939_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWJ44428.1|2691935_2692559_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWJ44429.1|2692571_2693174_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWJ44430.1|2693183_2693633_-	nitrate reductase	NA	NA	NA	NA	NA
AWJ44431.1|2693629_2694493_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWJ44432.1|2694479_2695175_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWJ44433.1|2695181_2697668_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWJ44434.1|2697664_2697928_-	protein NapD	NA	NA	NA	NA	NA
AWJ44435.1|2697917_2698412_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWJ44436.1|2698511_2698685_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44437.1|2698820_2699309_+	ecotin	NA	NA	NA	NA	NA
AWJ44438.1|2699457_2701104_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AWJ44439.1|2701321_2702965_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWJ44440.1|2703040_2703691_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWJ44441.1|2703690_2704755_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWJ44442.1|2704828_2705884_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWJ44443.1|2705995_2707087_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWJ44444.1|2707367_2707595_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44445.1|2707569_2707809_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44446.1|2707825_2710498_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWJ44447.1|2710514_2711165_+	DNA-binding response regulator	NA	NA	NA	NA	NA
2711220:2711255	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
AWJ44448.1|2711364_2714214_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AWJ44449.1|2714488_2715265_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWJ44450.1|2715269_2716919_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWJ44451.1|2716919_2721434_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
AWJ44452.1|2722115_2723438_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
AWJ44453.1|2724131_2724665_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
AWJ44454.1|2724807_2726020_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ44455.1|2726060_2726585_-	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
AWJ44456.1|2726734_2727172_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
AWJ44457.1|2727168_2727666_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
AWJ46852.1|2727665_2727881_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWJ44458.1|2729753_2730377_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWJ44459.1|2730373_2731039_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWJ44460.1|2731035_2731638_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWJ44461.1|2731612_2732179_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWJ44462.1|2732726_2733659_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
AWJ44463.1|2733697_2734525_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
AWJ46853.1|2735028_2735211_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWJ44464.1|2735367_2735712_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWJ44465.1|2735817_2736036_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWJ44466.1|2736013_2737084_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWJ44467.1|2737078_2737705_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
AWJ44468.1|2737701_2739390_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
AWJ44469.1|2739538_2742166_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2743106:2743141	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
>prophage 13
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	3091900	3179817	5198840	transposase,tail,tRNA,terminase,portal,lysis	Enterobacteria_phage(72.41%)	94	NA	NA
AWJ44781.1|3091900_3092638_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWJ44782.1|3092769_3094104_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWJ44783.1|3094313_3095195_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ44784.1|3095298_3095886_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWJ44785.1|3095941_3096325_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWJ44786.1|3096628_3097318_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWJ44787.1|3097365_3098403_-	methyltransferase	NA	NA	NA	NA	NA
AWJ44788.1|3098392_3098596_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ44789.1|3098609_3099029_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWJ44790.1|3099097_3099796_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWJ44791.1|3099827_3102488_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWJ44792.1|3102601_3103957_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWJ44793.1|3104002_3104326_+	lipoprotein	NA	NA	NA	NA	NA
AWJ44794.1|3104322_3105621_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWJ44795.1|3105602_3105716_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWJ44796.1|3111473_3114047_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWJ44797.1|3114176_3114908_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWJ44798.1|3114904_3115885_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWJ44799.1|3116019_3116757_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWJ44800.1|3116786_3116993_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44801.1|3117027_3117369_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWJ46864.1|3117472_3117520_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44802.1|3117618_3118779_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWJ44803.1|3118821_3119943_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWJ44804.1|3119953_3121024_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWJ44805.1|3121233_3121599_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44806.1|3121748_3122267_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWJ44807.1|3122256_3123483_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWJ44808.1|3123498_3123981_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ44809.1|3124057_3124405_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWJ44810.1|3124446_3125214_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWJ44811.1|3125244_3125793_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWJ44812.1|3125811_3126060_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWJ44813.1|3126308_3127670_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ46865.1|3127836_3128628_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ46866.1|3128693_3129935_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWJ44814.1|3129989_3130583_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWJ44815.1|3130579_3130774_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWJ44816.1|3130705_3131584_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWJ44817.1|3131669_3133331_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWJ44818.1|3133479_3133821_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWJ44819.1|3133882_3134173_-	RnfH family protein	NA	NA	NA	NA	NA
AWJ44820.1|3134162_3134639_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWJ44821.1|3134770_3135253_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ44822.1|3136101_3136350_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
AWJ44823.1|3136717_3136987_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
AWJ44824.1|3138374_3138974_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
AWJ44825.1|3139041_3142518_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
AWJ44826.1|3142764_3143445_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.2	8.7e-115
AWJ44827.1|3143342_3144086_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
AWJ44828.1|3144091_3144790_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
AWJ44829.1|3144789_3145119_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ44830.1|3145115_3147761_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
AWJ44831.1|3147804_3148113_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AWJ44832.1|3148139_3148562_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AWJ44833.1|3148575_3149328_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AWJ44834.1|3149335_3149626_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
AWJ44835.1|3149680_3150893_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ44836.1|3151055_3151679_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
AWJ44837.1|3151681_3151963_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
AWJ44838.1|3151955_3152282_-	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AWJ44839.1|3152369_3154334_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AWJ44840.1|3154337_3155840_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
AWJ44841.1|3155839_3156076_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	100.0	4.5e-34
AWJ44842.1|3156048_3158172_-|terminase	terminase	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
AWJ44843.1|3158168_3158645_-	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AWJ44844.1|3159057_3159525_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
AWJ44845.1|3160308_3160578_-	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWJ44846.1|3160587_3161535_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
AWJ44847.1|3161807_3162053_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AWJ44848.1|3162041_3162476_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
AWJ44849.1|3162468_3162663_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AWJ44850.1|3162659_3163265_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
AWJ44851.1|3164062_3164767_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
AWJ44852.1|3165041_3165224_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AWJ44853.1|3165220_3165748_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
AWJ44854.1|3165744_3166191_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
AWJ46867.1|3166147_3166573_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	1.4e-78
AWJ44855.1|3166742_3167021_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AWJ44856.1|3167090_3167360_-	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
AWJ44857.1|3167359_3168811_-	helicase DnaB	NA	Q08J37	Stx2-converting_phage	100.0	7.7e-278
AWJ44858.1|3168785_3169685_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
AWJ44859.1|3169677_3169824_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
AWJ44860.1|3169858_3170137_-	hypothetical protein	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
AWJ44861.1|3171012_3171636_+	recombinase	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
AWJ44862.1|3171636_3172149_+	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
AWJ44863.1|3172162_3172456_+	RecBCD nuclease inhibitor	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
AWJ46868.1|3172466_3172634_+	DUF2737 domain-containing protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
AWJ44864.1|3172630_3173230_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
AWJ44865.1|3173231_3173579_+	hypothetical protein	NA	Q687G9	Enterobacteria_phage	100.0	9.4e-65
AWJ44866.1|3173581_3174795_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ44867.1|3175859_3176276_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWJ44868.1|3176348_3178097_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
AWJ46869.1|3178098_3179817_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
>prophage 14
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	3251345	3258485	5198840		Escherichia_phage(83.33%)	6	NA	NA
AWJ44937.1|3251345_3253907_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWJ44938.1|3254012_3254669_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWJ44939.1|3254719_3255487_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ44940.1|3255682_3256591_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ44941.1|3256587_3257850_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
AWJ44942.1|3257846_3258485_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 15
CP028117	Escherichia coli O111 str. RM9322 chromosome, complete genome	5198840	4784901	4842524	5198840	integrase,capsid,holin,tail,tRNA,terminase,lysis,head	Enterobacteria_phage(32.0%)	69	4788318:4788332	4844180:4844194
AWJ46332.1|4784901_4785024_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWJ46333.1|4785152_4785686_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
AWJ46334.1|4786103_4786385_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
AWJ46335.1|4786421_4786994_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
AWJ46336.1|4786993_4787728_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
AWJ46337.1|4787730_4787922_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
AWJ46338.1|4787974_4788391_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
4788318:4788332	attL	ACAAACGATTTATCG	NA	NA	NA	NA
AWJ46339.1|4788537_4789011_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
AWJ46340.1|4789007_4789358_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
AWJ46341.1|4789348_4789885_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
AWJ46342.1|4790012_4790837_-	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
AWJ46343.1|4790902_4791265_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ46344.1|4791633_4791888_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	94.9	1.4e-12
AWJ46345.1|4791968_4792661_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
AWJ46924.1|4792634_4792787_+	amino acid permease	NA	NA	NA	NA	NA
AWJ46346.1|4792758_4793019_+	XRE family transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
AWJ46347.1|4793011_4793563_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
AWJ46348.1|4795075_4795828_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
AWJ46349.1|4795913_4796123_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.4	2.6e-25
AWJ46350.1|4796137_4796290_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWJ46351.1|4797107_4798958_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
AWJ46352.1|4799252_4799399_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ46353.1|4799397_4799613_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ46354.1|4799612_4800110_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ46355.1|4800106_4800574_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	80.1	4.0e-58
AWJ46356.1|4800656_4800797_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ46357.1|4801039_4801354_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ46358.1|4801607_4802138_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
AWJ46359.1|4802253_4802817_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
AWJ46360.1|4802813_4804475_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
AWJ46361.1|4804538_4806476_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
AWJ46925.1|4806520_4806742_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWJ46362.1|4809105_4809432_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ46363.1|4809441_4809792_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ46364.1|4809788_4810235_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ46365.1|4810231_4810576_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ46366.1|4810642_4811359_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
AWJ46367.1|4811364_4811739_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWJ46368.1|4811762_4812044_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ46369.1|4812095_4815338_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
AWJ46370.1|4815330_4815672_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ46371.1|4815671_4816370_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
AWJ46372.1|4816380_4817124_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
AWJ46373.1|4817021_4817702_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.2	2.0e-106
AWJ46374.1|4817655_4817868_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ46375.1|4817937_4821414_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
AWJ46926.1|4821482_4822106_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWJ46376.1|4822170_4823484_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
AWJ46377.1|4823485_4823755_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AWJ46378.1|4823915_4824338_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
AWJ46379.1|4824467_4825526_-	type III effector	NA	NA	NA	NA	NA
AWJ46380.1|4825604_4826255_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWJ46381.1|4826437_4827028_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWJ46927.1|4827014_4827134_-	ferredoxin	NA	NA	NA	NA	NA
AWJ46382.1|4827529_4827778_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AWJ46383.1|4829026_4830064_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWJ46384.1|4830197_4830440_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWJ46385.1|4830605_4831589_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWJ46386.1|4831671_4833087_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWJ46387.1|4833139_4834219_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AWJ46388.1|4834471_4835665_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWJ46389.1|4835886_4836429_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ46390.1|4836791_4837505_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AWJ46391.1|4837615_4838032_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWJ46392.1|4838035_4838392_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWJ46393.1|4838426_4841249_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWJ46394.1|4841502_4842039_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWJ46395.1|4842137_4842419_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ46396.1|4842377_4842524_+|integrase	integrase	integrase	NA	NA	NA	NA
4844180:4844194	attR	CGATAAATCGTTTGT	NA	NA	NA	NA
>prophage 1
CP028118	Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence	78469	16014	48633	78469	transposase	Escherichia_phage(30.0%)	34	NA	NA
AWJ46966.1|16014_16380_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ46967.1|16379_17567_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ46968.1|17673_18045_-	DNA modification methylase	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
AWJ46969.1|18120_18426_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47017.1|18429_19332_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWJ46970.1|19604_20564_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
AWJ46971.1|20563_20959_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWJ46972.1|21918_22308_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
AWJ46973.1|23333_24546_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
AWJ46974.1|24512_24722_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	7.8e-06
AWJ46975.1|24866_28832_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
AWJ46976.1|29136_29328_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	3.5e-05
AWJ46977.1|29338_29593_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ46978.1|29731_30097_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ46979.1|30096_31284_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ46980.1|31487_31727_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ46981.1|31739_32000_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ46982.1|31941_32130_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ46983.1|32145_32340_-	replication protein	NA	NA	NA	NA	NA
AWJ46984.1|32702_33572_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWJ47019.1|33552_33627_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWJ47020.1|33710_33821_+	replication protein RepA	NA	NA	NA	NA	NA
AWJ46985.1|33861_34119_-	replication protein RepA	NA	NA	NA	NA	NA
AWJ46986.1|34358_34946_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWJ46987.1|34983_35193_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ46988.1|35238_35775_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	37.1	3.8e-20
AWJ46989.1|35944_36157_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47021.1|36899_37280_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AWJ46990.1|37674_39213_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.4e-298
AWJ46991.1|40031_41471_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWJ46992.1|41474_43595_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
AWJ46993.1|43644_46641_-	enterohemolysin	NA	NA	NA	NA	NA
AWJ46994.1|46642_47134_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
AWJ46995.1|48267_48633_+|transposase	transposase	transposase	NA	NA	NA	NA
