The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	317567	334037	5785882	holin	Enterobacteria_phage(14.29%)	20	NA	NA
AWJ52607.1|317567_318623_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
AWJ52608.1|318910_320014_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWJ52609.1|320025_321279_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
AWJ52610.1|321634_322849_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	56.2	8.3e-132
AWJ52611.1|323014_323230_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWJ52612.1|323277_323481_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
AWJ52613.1|323480_323912_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
AWJ52614.1|323924_324758_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
AWJ52615.1|324750_324933_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWJ52616.1|324926_326180_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	1.0e-12
AWJ52617.1|326176_326440_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
AWJ52618.1|326436_326658_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52619.1|326650_327253_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
AWJ52620.1|327263_327605_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
AWJ52621.1|327597_327969_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52622.1|327955_330712_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	8.9e-299
AWJ52623.1|330787_331039_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52624.1|331483_331945_+	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	72.2	2.2e-61
AWJ52625.1|331938_332616_+	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
AWJ52626.1|332615_334037_+	acyltransferase	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
>prophage 2
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	620371	727992	5785882	tRNA,lysis,integrase,transposase,capsid,head,plate,protease,terminase,tail	Enterobacteria_phage(33.67%)	140	630532:630578	719466:719512
AWJ52885.1|620371_621757_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWJ52886.1|621792_622314_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ52887.1|622421_622634_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ52888.1|622635_623502_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ52889.1|623982_624525_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ52890.1|624744_625437_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWJ52891.1|625467_628077_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ52892.1|628055_629096_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ52893.1|629106_629622_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ52894.1|629624_630257_-	DNA-binding response regulator	NA	NA	NA	NA	NA
630532:630578	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ52895.1|630591_631755_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AWJ52896.1|631610_631982_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWJ52897.1|631953_632232_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWJ52898.1|632279_632498_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
AWJ52899.1|632596_632878_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AWJ52900.1|632888_633080_-	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AWJ52901.1|633052_633235_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AWJ52902.1|633231_633912_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
AWJ52903.1|633908_634694_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ52904.1|634699_634996_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
AWJ57921.1|635071_635278_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.8e-26
AWJ52905.1|635828_636149_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52906.1|636284_636548_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
AWJ52907.1|636629_637385_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWJ52908.1|637423_637654_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWJ52909.1|637723_638263_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
AWJ52910.1|638259_639279_+	Replication protein O	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
AWJ52911.1|639275_639977_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
AWJ52912.1|640181_640529_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52913.1|641281_641890_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
AWJ52914.1|642189_642606_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
AWJ52915.1|642584_642986_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52916.1|643109_643211_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52917.1|643207_643663_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
AWJ52918.1|643662_643833_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWJ52919.1|643825_644116_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
AWJ52920.1|644112_644475_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AWJ52921.1|644471_644612_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AWJ52922.1|644697_645081_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AWJ52923.1|645269_646352_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
AWJ52924.1|646940_647156_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWJ52925.1|647155_647653_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AWJ52926.1|647649_648111_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AWJ52927.1|648142_648436_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ52928.1|648775_649989_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.0	2.3e-166
AWJ52929.1|650106_650301_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ52930.1|650448_650550_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52931.1|650689_651235_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWJ52932.1|651209_653135_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AWJ52933.1|653131_653338_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWJ52934.1|654491_655229_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
AWJ52935.1|655182_655383_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWJ57922.1|655650_655962_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52936.1|656000_656246_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AWJ52937.1|656281_656464_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
AWJ52938.1|656610_658650_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
AWJ52939.1|658749_659310_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
AWJ57923.1|659532_659736_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ52940.1|659815_660337_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AWJ52941.1|660371_661283_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
AWJ52942.1|661282_661843_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
AWJ52943.1|661833_662919_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
AWJ52944.1|662915_663353_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
AWJ52945.1|663345_663960_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
AWJ52946.1|663949_665074_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
AWJ52947.1|665057_666428_-	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
AWJ52948.1|666393_668469_-|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
AWJ52949.1|668595_669072_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
AWJ52950.1|669086_669452_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
AWJ52951.1|669460_670963_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
AWJ52952.1|670959_671205_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
AWJ52953.1|671205_671766_-	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
AWJ52954.1|671762_672182_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
AWJ52955.1|672178_672553_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52956.1|672596_673544_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
AWJ52957.1|673543_674668_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
AWJ52958.1|674844_675318_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
AWJ52959.1|675436_676762_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
AWJ52960.1|676745_678335_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
AWJ52961.1|678334_679999_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
AWJ52962.1|679998_680580_-	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
AWJ52963.1|680582_680873_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
AWJ52964.1|680869_681178_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AWJ52965.1|681158_681386_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWJ57924.1|681395_681842_-	lysozyme	NA	B6SD19	Bacteriophage	48.0	1.2e-11
AWJ52966.1|682060_682561_-	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
AWJ52967.1|682632_683058_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ52968.1|683127_683637_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
AWJ52969.1|683633_683930_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52970.1|683919_684117_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
AWJ52971.1|684109_684484_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52972.1|684480_684666_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52973.1|684662_685214_-	AsnC family protein	NA	NA	NA	NA	NA
AWJ52974.1|685217_685733_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
AWJ52975.1|685732_686266_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
AWJ52976.1|686269_686812_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
AWJ52977.1|686909_687440_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
AWJ52978.1|687451_687745_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52979.1|687749_688022_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52980.1|688018_688300_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
AWJ52981.1|688301_688556_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52982.1|688568_688790_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52983.1|688792_689725_-	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
AWJ52984.1|689795_691886_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
AWJ52985.1|691887_692136_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
AWJ52986.1|692326_692857_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
AWJ52987.1|694157_695729_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ52988.1|695748_696096_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ52989.1|696095_696773_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ52990.1|696813_697692_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
AWJ52991.1|697701_698034_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ52992.1|698089_699115_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWJ52993.1|699156_699552_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWJ52994.1|699563_699938_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
AWJ52995.1|699928_700507_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWJ52996.1|700503_700899_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
AWJ57925.1|700906_701647_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWJ52997.1|701662_702085_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	9.1e-70
AWJ52998.1|702066_702501_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWJ52999.1|702493_705055_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
AWJ53000.1|705051_705381_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
AWJ53001.1|705380_706079_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
AWJ53002.1|706764_707397_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
AWJ53003.1|707457_710871_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
AWJ53004.1|710941_711541_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
AWJ57926.1|711605_714566_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
AWJ53005.1|714565_715150_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
AWJ53006.1|715122_715260_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWJ57927.1|715204_715831_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ53007.1|715929_716235_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ53008.1|716418_717903_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ53009.1|718089_719043_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AWJ53010.1|719068_719260_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53011.1|719445_719562_-	hypothetical protein	NA	NA	NA	NA	NA
719466:719512	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ53012.1|719555_720317_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53013.1|720373_720586_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53014.1|720499_721390_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53015.1|721390_724363_-	phage receptor	NA	NA	NA	NA	NA
AWJ53016.1|724349_726587_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWJ53017.1|726855_727992_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	947402	1031252	5785882	lysis,integrase,holin,transposase,protease,terminase,tail	Enterobacteria_phage(47.69%)	98	945935:945969	1030093:1030127
945935:945969	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
AWJ53217.1|947402_948473_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
AWJ53218.1|948450_948669_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWJ53219.1|948775_949120_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
AWJ53220.1|949148_949316_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AWJ53221.1|949388_949673_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
AWJ53222.1|949665_949968_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
AWJ53223.1|949964_950582_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
AWJ53224.1|950583_951141_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
AWJ53225.1|951137_951695_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
AWJ53226.1|951691_951856_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
AWJ53227.1|951866_952160_-	RecBCD nuclease inhibitor	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AWJ53228.1|952183_952567_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
AWJ53229.1|952566_953172_-	recombinase	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
AWJ53230.1|953428_953581_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
AWJ53231.1|953565_953697_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AWJ53232.1|953721_954582_-	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
AWJ53233.1|956326_957028_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
AWJ53234.1|957024_957315_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ53235.1|957611_957968_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AWJ53236.1|957939_958350_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AWJ53237.1|958346_958523_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWJ53238.1|958662_958800_-	PapI protein	NA	A0A0N7BTS3	Escherichia_phage	88.5	2.5e-05
AWJ53239.1|958765_959979_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ53240.1|960384_960579_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ53241.1|960658_960799_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53242.1|960766_961384_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ53243.1|961533_961971_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
AWJ53244.1|961967_962465_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ53245.1|962464_962680_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ53246.1|962678_962840_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53247.1|965525_966242_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53248.1|966453_967143_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWJ53249.1|967157_967280_-	YlcG family protein	NA	NA	NA	NA	NA
AWJ53250.1|967618_968578_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWJ53251.1|968789_968978_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWJ53252.1|968974_969337_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AWJ53253.1|969333_969624_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
AWJ53254.1|969623_970346_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
AWJ53255.1|970338_970548_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
AWJ53256.1|970768_971981_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ53257.1|972071_972581_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
AWJ53258.1|972552_974481_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
AWJ53259.1|974464_974671_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ53260.1|976248_976425_+|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	56.4	1.1e-08
AWJ53261.1|976902_977250_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
AWJ53262.1|977298_978837_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ53263.1|978833_979202_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
AWJ53264.1|979209_979962_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
AWJ53265.1|979975_980407_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ53266.1|983401_983731_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ53267.1|983730_984429_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
AWJ53268.1|984434_985178_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AWJ53269.1|985075_985756_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.3e-113
AWJ53270.1|986001_989478_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
AWJ53271.1|989545_990145_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
AWJ53272.1|990209_991424_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
AWJ53273.1|991425_991695_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AWJ53274.1|991800_992682_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWJ53275.1|992905_993733_+	cell division protein	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
AWJ53276.1|993856_994228_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWJ53277.1|994702_996274_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ53278.1|996293_996641_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ53279.1|996640_997318_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ53280.1|997378_997954_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
AWJ53281.1|998154_998535_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53282.1|998618_998840_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53283.1|998852_999506_-	secretion protein EspJ	NA	NA	NA	NA	NA
AWJ53284.1|999915_1000095_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53285.1|1000009_1000486_-	kinase inhibitor	NA	NA	NA	NA	NA
AWJ53286.1|1000544_1001834_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AWJ53287.1|1001920_1002961_+	biotin synthase	NA	NA	NA	NA	NA
AWJ53288.1|1002957_1004112_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AWJ53289.1|1004098_1004854_+	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AWJ53290.1|1004846_1005524_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AWJ53291.1|1006102_1008124_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWJ53292.1|1008315_1009224_-	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AWJ53293.1|1009620_1010610_+	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AWJ53294.1|1010631_1011144_+	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AWJ53295.1|1011146_1011632_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AWJ53296.1|1011624_1011870_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AWJ53297.1|1011871_1012324_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AWJ53298.1|1012460_1013165_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53299.1|1013369_1014083_+	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AWJ53300.1|1014118_1015075_-	UPF0104 family protein	NA	NA	NA	NA	NA
AWJ53301.1|1015074_1016316_-	cardiolipin synthase B	NA	NA	NA	NA	NA
AWJ53302.1|1016312_1017074_-	EEP domain-containing protein	NA	NA	NA	NA	NA
AWJ53303.1|1017206_1017617_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53304.1|1017578_1018685_-	inner membrane transport permease YbhR	NA	NA	NA	NA	NA
AWJ53305.1|1018695_1019829_-	inner membrane transport permease YbhS	NA	NA	NA	NA	NA
AWJ53306.1|1019821_1021558_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
AWJ53307.1|1021550_1022549_-	secretion protein HlyD	NA	NA	NA	NA	NA
AWJ57933.1|1022548_1023220_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ53308.1|1023448_1024813_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AWJ53309.1|1025043_1026129_-	dehydrogenase	NA	NA	NA	NA	NA
AWJ53310.1|1026269_1027232_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWJ53311.1|1027259_1029410_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
AWJ53312.1|1029529_1030012_+	DUF1768 domain-containing protein	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
AWJ53313.1|1030271_1031252_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
1030093:1030127	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 4
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1213059	1361239	5785882	lysis,integrase,portal,holin,capsid,transposase,head,protease,terminase,tail	Escherichia_phage(34.51%)	176	1264928:1264944	1362991:1363007
AWJ53463.1|1213059_1214820_-|protease	Lon protease	protease	NA	NA	NA	NA
AWJ53464.1|1215005_1215458_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWJ53465.1|1215532_1216573_-	outer membrane protein A	NA	NA	NA	NA	NA
AWJ53466.1|1216727_1216946_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53467.1|1216929_1217439_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWJ53468.1|1217657_1218287_+	protein Sxy	NA	NA	NA	NA	NA
AWJ57939.1|1218249_1220403_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWJ53469.1|1220421_1220868_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWJ53470.1|1220990_1223045_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
AWJ53471.1|1223076_1223535_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWJ53472.1|1223630_1224293_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWJ53473.1|1224465_1224879_+	CoA-binding protein	NA	NA	NA	NA	NA
AWJ53474.1|1224923_1225241_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWJ53475.1|1225298_1226489_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AWJ53476.1|1226583_1226862_+	acylphosphatase	NA	NA	NA	NA	NA
AWJ53477.1|1226858_1227188_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWJ53478.1|1227278_1227938_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	48.5	2.4e-40
AWJ53479.1|1228345_1229365_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWJ53480.1|1229342_1229585_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ53481.1|1229652_1232103_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
AWJ53482.1|1232196_1232388_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ53483.1|1232384_1232573_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ57940.1|1233140_1233350_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57941.1|1233350_1233989_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
AWJ53484.1|1234000_1234153_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AWJ53485.1|1234429_1234717_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ53486.1|1234716_1234908_-	antitoxin	NA	NA	NA	NA	NA
AWJ53487.1|1234935_1235337_-	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AWJ53488.1|1235445_1235718_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AWJ53489.1|1235701_1236127_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53490.1|1236333_1236789_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53491.1|1236867_1237983_+	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
AWJ53492.1|1237989_1238736_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
AWJ53493.1|1238757_1239528_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	7.9e-80
AWJ53494.1|1239543_1239957_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AWJ53495.1|1240308_1241082_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ53496.1|1241629_1241842_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
AWJ53497.1|1242288_1243338_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
AWJ53498.1|1243350_1243722_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWJ53499.1|1243711_1244083_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWJ53500.1|1244234_1245053_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWJ53501.1|1245339_1245537_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWJ53502.1|1245989_1246388_+	envelope protein	NA	NA	NA	NA	NA
AWJ53503.1|1246834_1247038_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWJ53504.1|1247155_1249006_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWJ53505.1|1249284_1249446_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53506.1|1249444_1249660_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWJ53507.1|1249622_1249967_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53508.1|1249915_1250152_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53509.1|1250120_1250303_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53510.1|1250347_1250881_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AWJ53511.1|1251101_1251215_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AWJ53512.1|1251216_1251684_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWJ53513.1|1251766_1251907_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53514.1|1252148_1252463_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53515.1|1252544_1252769_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWJ53516.1|1253165_1253711_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ53517.1|1253685_1255611_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ53518.1|1255607_1255814_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ53519.1|1255810_1257412_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
AWJ53520.1|1257392_1258712_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ53521.1|1258721_1259054_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ53522.1|1259109_1260135_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ53523.1|1260176_1260572_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ53524.1|1260583_1260937_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ53525.1|1260947_1261526_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
AWJ53526.1|1261522_1261918_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ53527.1|1261925_1262678_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AWJ53528.1|1262691_1263114_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ53529.1|1263140_1263554_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ53530.1|1263534_1266147_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
1264928:1264944	attL	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
AWJ53531.1|1266143_1266473_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ53532.1|1266472_1267171_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	3.4e-130
AWJ53533.1|1267181_1267925_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.6e-149
AWJ53534.1|1267822_1268503_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	5.7e-114
AWJ53535.1|1268748_1272225_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	97.6	0.0e+00
AWJ57942.1|1272293_1272917_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWJ53536.1|1274295_1274565_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
AWJ53537.1|1274689_1275442_-	type III effector	NA	NA	NA	NA	NA
AWJ53538.1|1275757_1275940_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
AWJ53539.1|1276245_1276872_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
AWJ53540.1|1276947_1278160_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.1e-168
AWJ53541.1|1278200_1278461_-|integrase	integrase	integrase	NA	NA	NA	NA
AWJ53542.1|1278555_1278798_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ53543.1|1278865_1281316_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
AWJ53544.1|1281410_1281599_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ53545.1|1281595_1281784_-	cell division inhibitor	NA	NA	NA	NA	NA
AWJ53546.1|1282352_1282571_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53547.1|1282642_1282942_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53548.1|1283277_1283580_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
AWJ53549.1|1283582_1283942_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
AWJ53550.1|1283988_1284381_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
AWJ53551.1|1284507_1284768_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
AWJ53552.1|1284764_1285202_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
AWJ57943.1|1286090_1286753_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.2e-78
AWJ53553.1|1286786_1287512_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
AWJ53554.1|1287512_1287920_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
AWJ53555.1|1287916_1288213_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
AWJ53556.1|1288209_1288671_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ53557.1|1288648_1289005_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
AWJ53558.1|1289055_1289268_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
AWJ53559.1|1289301_1289484_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWJ53560.1|1289649_1290285_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
AWJ53561.1|1290372_1290591_+	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
AWJ53562.1|1290592_1290958_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.5e-68
AWJ53563.1|1290954_1291299_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
AWJ53564.1|1291503_1291803_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
AWJ53565.1|1291808_1292066_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
AWJ53566.1|1292201_1292474_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
AWJ53567.1|1292475_1293522_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
AWJ53568.1|1293534_1293894_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
AWJ53569.1|1293902_1294433_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWJ53570.1|1294551_1294872_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
AWJ53571.1|1295006_1295720_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53572.1|1296169_1296601_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ53573.1|1296491_1296758_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53574.1|1297078_1299016_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
AWJ53575.1|1299151_1299331_+	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
AWJ53576.1|1299371_1299617_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWJ53577.1|1299694_1299910_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ53578.1|1299914_1300448_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
AWJ53579.1|1300722_1301292_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
AWJ53580.1|1301448_1301916_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
AWJ53581.1|1301998_1302139_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53582.1|1302379_1302694_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53583.1|1302775_1303000_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
AWJ53584.1|1303041_1303407_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
AWJ53585.1|1303697_1304261_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ53586.1|1304257_1305919_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
AWJ53587.1|1305982_1307920_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
AWJ57944.1|1307964_1308186_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ53588.1|1310712_1311039_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ53589.1|1311049_1311400_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ53590.1|1311396_1311843_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ53591.1|1311839_1312184_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ53592.1|1312249_1312966_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
AWJ53593.1|1312971_1313346_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ53594.1|1313369_1313651_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ53595.1|1313698_1316941_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
AWJ53596.1|1316933_1317275_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ53597.1|1317274_1317973_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
AWJ57945.1|1317989_1318310_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AWJ53598.1|1318417_1318591_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AWJ57946.1|1318661_1319585_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
AWJ53599.1|1319639_1320377_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
AWJ53600.1|1320274_1320955_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	5.7e-114
AWJ53601.1|1324742_1325342_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
AWJ53602.1|1326720_1326990_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
AWJ53603.1|1327951_1328179_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	92.7	2.0e-23
AWJ53604.1|1328382_1328613_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53605.1|1328545_1328719_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AWJ53606.1|1328801_1330130_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
AWJ53607.1|1330150_1330645_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AWJ53608.1|1330655_1331246_-	nitroreductase family protein	NA	NA	NA	NA	NA
AWJ53609.1|1331255_1332056_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
AWJ53610.1|1332063_1332450_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
AWJ57947.1|1332461_1333154_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
AWJ53611.1|1333153_1334302_-	pyrimidine monooxygenase RutA	NA	NA	NA	NA	NA
AWJ53612.1|1334532_1335171_+	pyrimidine utilization regulatory protein R	NA	NA	NA	NA	NA
AWJ53613.1|1335210_1339173_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ53614.1|1339227_1339437_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53615.1|1339324_1339516_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53616.1|1339595_1341104_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWJ53617.1|1341768_1342599_+	ferrous iron permease EfeU	NA	NA	NA	NA	NA
AWJ53618.1|1342656_1343784_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
AWJ53619.1|1343789_1345061_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AWJ53620.1|1345544_1346468_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	7.8e-90
AWJ53621.1|1347048_1347735_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWJ53622.1|1348360_1349563_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
AWJ53623.1|1349749_1351567_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53624.1|1352678_1352975_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53625.1|1353201_1353399_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AWJ53626.1|1353617_1355051_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AWJ53627.1|1355871_1356435_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AWJ53628.1|1356589_1358950_+	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
AWJ53629.1|1359706_1361239_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
1362991:1363007	attR	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
>prophage 5
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1531005	1580136	5785882	lysis,integrase,holin,transposase,capsid,head,protease,terminase,tail	Stx2-converting_phage(39.02%)	58	1525232:1525246	1532580:1532594
1525232:1525246	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWJ53808.1|1531005_1532124_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
AWJ53809.1|1532092_1532362_-	excisionase	NA	NA	NA	NA	NA
AWJ53810.1|1532423_1534895_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1532580:1532594	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWJ53811.1|1534987_1535179_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ53812.1|1535175_1535364_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ53813.1|1535853_1536006_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
AWJ53814.1|1536281_1536929_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
AWJ53815.1|1537023_1537251_+	cell division protein	NA	NA	NA	NA	NA
AWJ53816.1|1537247_1537673_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53817.1|1537683_1537884_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53818.1|1538570_1539233_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	95.4	2.3e-83
AWJ53819.1|1539267_1539966_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
AWJ53820.1|1539987_1540212_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
AWJ53821.1|1540341_1541498_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ53822.1|1542411_1544262_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AWJ53823.1|1544543_1544759_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWJ53824.1|1544721_1545066_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53825.1|1545014_1545251_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53826.1|1545219_1545414_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53827.1|1545446_1545980_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AWJ53828.1|1546057_1546249_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AWJ57963.1|1546406_1546874_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AWJ53829.1|1546897_1547122_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57964.1|1547118_1547337_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AWJ53830.1|1547478_1547619_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53831.1|1547748_1547934_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
AWJ53832.1|1547975_1548341_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
AWJ53833.1|1548630_1549194_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ53834.1|1549190_1550852_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ53835.1|1550915_1552853_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
AWJ57965.1|1552897_1553119_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ53836.1|1555644_1555971_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ53837.1|1555981_1556332_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
AWJ53838.1|1556328_1556775_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ53839.1|1556842_1557115_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
AWJ53840.1|1557180_1557897_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
AWJ53841.1|1557902_1558277_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ53842.1|1558300_1558582_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ53843.1|1558629_1561872_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
AWJ53844.1|1561864_1562206_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWJ53845.1|1562205_1562904_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AWJ53846.1|1562914_1563658_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWJ53847.1|1563555_1564236_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.3e-113
AWJ53848.1|1564481_1567955_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.9	0.0e+00
AWJ53849.1|1568021_1568621_+	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
AWJ57966.1|1568685_1569999_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
AWJ53850.1|1569949_1570093_-	copper resistance protein	NA	NA	NA	NA	NA
AWJ53851.1|1570054_1570732_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ53852.1|1570731_1571079_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ53853.1|1571098_1572670_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ53854.1|1572707_1572977_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
AWJ53855.1|1573093_1573369_-	secretion protein EspO	NA	NA	NA	NA	NA
AWJ53856.1|1573431_1574793_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
AWJ53857.1|1575169_1575322_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
AWJ53858.1|1575917_1577036_+	hydrogenase-1 small chain	NA	NA	NA	NA	NA
AWJ53859.1|1577032_1578826_+	hydrogenase-1 large chain	NA	NA	NA	NA	NA
AWJ53860.1|1578844_1579552_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
AWJ53861.1|1579548_1580136_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1610630	1688858	5785882	tRNA,lysis,holin,capsid,transposase,head,terminase,tail	Escherichia_phage(31.76%)	108	NA	NA
AWJ53891.1|1610630_1611941_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
AWJ53892.1|1611993_1612278_-	DNA-binding protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
AWJ53893.1|1612323_1612575_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
AWJ53894.1|1612562_1612796_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
AWJ53895.1|1612939_1613302_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
AWJ53896.1|1613337_1613553_-	DUF1382 domain-containing protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
AWJ53897.1|1613485_1614397_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
AWJ57969.1|1614393_1614681_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	9.5e-55
AWJ53898.1|1614878_1616034_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ57970.1|1616177_1616375_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
AWJ53899.1|1616380_1616839_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
AWJ53900.1|1616841_1617033_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
AWJ53901.1|1617034_1617412_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	92.6	1.9e-63
AWJ53902.1|1617408_1618038_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
AWJ53903.1|1618034_1618199_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
AWJ53904.1|1618209_1618506_-	RecBCD nuclease inhibitor	NA	G9L665	Escherichia_phage	98.0	2.3e-48
AWJ53905.1|1618529_1619117_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
AWJ53906.1|1619113_1619794_-	ATP-binding protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
AWJ53907.1|1619802_1619991_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AWJ53908.1|1619987_1620227_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.6e-37
AWJ53909.1|1620427_1620898_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AWJ53910.1|1620956_1621340_-	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AWJ53911.1|1621847_1622252_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
AWJ53912.1|1622248_1622905_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
AWJ53913.1|1622901_1623189_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
AWJ53914.1|1623325_1624030_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AWJ53915.1|1624143_1624377_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AWJ53916.1|1624515_1624812_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
AWJ53917.1|1624844_1625783_+	Replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
AWJ53918.1|1625779_1626481_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
AWJ53919.1|1626477_1626768_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
AWJ53920.1|1626838_1627117_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
AWJ53921.1|1627249_1627465_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AWJ53922.1|1627475_1627712_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AWJ53923.1|1627668_1628115_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AWJ53924.1|1628111_1628639_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AWJ53925.1|1628635_1628818_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AWJ53926.1|1629092_1629827_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
AWJ53927.1|1629901_1630624_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
AWJ53928.1|1630623_1631229_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
AWJ53929.1|1631225_1631420_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
AWJ53930.1|1631412_1631847_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
AWJ53931.1|1631835_1632081_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AWJ53932.1|1632353_1633301_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
AWJ53933.1|1633310_1633580_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWJ53934.1|1633730_1633958_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
AWJ53935.1|1634079_1636017_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
AWJ53936.1|1636152_1636332_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ53937.1|1636372_1636645_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
AWJ53938.1|1636721_1636937_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AWJ53939.1|1636941_1637286_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ53940.1|1637336_1637870_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
AWJ53941.1|1638140_1638710_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ53942.1|1638863_1639331_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWJ53943.1|1639693_1639921_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AWJ53944.1|1639962_1640328_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AWJ53945.1|1640615_1641179_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ53946.1|1641175_1642837_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ53947.1|1642900_1644838_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
AWJ57971.1|1644882_1645104_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ53948.1|1647626_1647953_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ53949.1|1647963_1648314_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
AWJ53950.1|1648310_1648757_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ53951.1|1648824_1649097_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.9	3.9e-42
AWJ53952.1|1649883_1650258_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ53953.1|1650281_1650563_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ53954.1|1650610_1653853_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
AWJ53955.1|1653845_1654187_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWJ53956.1|1654186_1654885_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AWJ53957.1|1655601_1656216_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.1	1.8e-98
AWJ57974.1|1660005_1660629_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWJ57972.1|1660692_1662015_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
AWJ53958.1|1662016_1662286_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
AWJ57973.1|1662465_1662975_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
AWJ53959.1|1663265_1663847_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AWJ53960.1|1663914_1664550_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AWJ53961.1|1664677_1665736_-	type III effector	NA	NA	NA	NA	NA
AWJ53962.1|1665810_1666461_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWJ53963.1|1666643_1667234_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWJ53964.1|1667507_1668371_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWJ53965.1|1668354_1669491_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWJ57975.1|1669469_1669685_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ53966.1|1669740_1670970_+	peptidase T	NA	NA	NA	NA	NA
AWJ53967.1|1671115_1672237_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWJ53968.1|1672485_1673715_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
AWJ53969.1|1674080_1674269_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AWJ53970.1|1674326_1675355_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWJ53971.1|1675344_1675602_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53972.1|1675574_1675808_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53973.1|1675800_1676034_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53974.1|1676039_1676339_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWJ53975.1|1676335_1677736_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
AWJ53976.1|1677936_1678188_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53977.1|1678184_1678595_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ53978.1|1678605_1678878_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ53979.1|1678834_1678963_+	trigger factor	NA	NA	NA	NA	NA
AWJ53980.1|1679004_1679229_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53981.1|1679480_1679687_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53982.1|1679686_1680742_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
AWJ53983.1|1680754_1681090_+|head	head decoration protein	head	NA	NA	NA	NA
AWJ53984.1|1681102_1681516_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AWJ53985.1|1681721_1682264_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
AWJ53986.1|1682518_1682800_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ53987.1|1683401_1684862_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWJ53988.1|1684861_1685533_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWJ53989.1|1685700_1687071_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWJ57976.1|1687074_1687716_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWJ53990.1|1687751_1688858_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1801407	1815621	5785882	tail,holin,transposase	Escherichia_phage(42.86%)	19	NA	NA
AWJ54103.1|1801407_1802073_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWJ54104.1|1803699_1804458_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWJ54105.1|1804736_1804949_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWJ54106.1|1805169_1805427_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54107.1|1805496_1805775_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
AWJ54108.1|1805776_1806832_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
AWJ54109.1|1806832_1807198_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWJ54110.1|1807194_1807884_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWJ54111.1|1807914_1808061_+	antiterminator	NA	NA	NA	NA	NA
AWJ54112.1|1808820_1809087_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54113.1|1809231_1809360_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54114.1|1809408_1811262_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
AWJ54115.1|1811411_1811627_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWJ54116.1|1811631_1811976_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWJ54117.1|1812026_1812560_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
AWJ54118.1|1812830_1813349_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
AWJ54119.1|1813405_1814561_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ54120.1|1814664_1814934_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
AWJ54121.1|1815078_1815621_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
>prophage 8
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	1917884	1974070	5785882	tRNA,lysis,portal,holin,transposase,capsid,head,terminase,tail	Escherichia_phage(43.28%)	76	NA	NA
AWJ57991.1|1917884_1919117_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AWJ54218.1|1919371_1920355_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWJ54219.1|1920629_1920803_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54220.1|1920832_1922206_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWJ54221.1|1922334_1923270_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWJ54222.1|1923321_1924557_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
AWJ54223.1|1924558_1924774_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWJ57993.1|1924873_1925062_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWJ57992.1|1925099_1925249_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWJ54224.1|1925304_1926114_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWJ54225.1|1926106_1928707_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
AWJ54226.1|1928808_1929084_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AWJ57994.1|1929158_1929329_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWJ54227.1|1929328_1929550_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWJ57995.1|1929970_1930123_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
AWJ54228.1|1930181_1930385_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54229.1|1930421_1930841_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AWJ54230.1|1930920_1931175_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWJ54231.1|1931171_1931594_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
AWJ57996.1|1931657_1932137_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
AWJ54232.1|1932139_1933353_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ54233.1|1933783_1934530_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
AWJ54234.1|1934501_1935314_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.1e-119
AWJ54235.1|1935329_1935752_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
AWJ54236.1|1935748_1936045_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
AWJ54237.1|1936041_1936503_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ54238.1|1936480_1936837_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWJ54239.1|1936887_1937100_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ54240.1|1937185_1937350_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ54241.1|1937351_1937615_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ54242.1|1937625_1938495_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWJ54243.1|1938610_1938715_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54244.1|1938904_1939117_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
AWJ57997.1|1939284_1939563_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AWJ54245.1|1939564_1940614_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
AWJ54246.1|1940626_1941001_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
AWJ54247.1|1940997_1941819_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ54248.1|1942309_1942576_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54249.1|1942989_1944840_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWJ54250.1|1945118_1945280_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54251.1|1945278_1945494_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ54252.1|1945493_1945991_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ54253.1|1945987_1946425_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ54254.1|1946574_1947192_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ54255.1|1947159_1947300_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54256.1|1947379_1947574_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ54257.1|1947721_1947823_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54258.1|1947962_1948508_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ54259.1|1948482_1950408_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ54260.1|1950404_1950611_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ54261.1|1950603_1952208_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.0	2.0e-303
AWJ54262.1|1952188_1953508_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ54263.1|1953517_1953850_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ54264.1|1953905_1954931_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ54265.1|1954972_1955368_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ54266.1|1955379_1955733_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ54267.1|1955744_1956323_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.3e-79
AWJ54268.1|1956319_1956715_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ54269.1|1956722_1957475_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AWJ54270.1|1957488_1957920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ54271.1|1957946_1958360_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
AWJ54272.1|1958340_1960980_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
AWJ54273.1|1960915_1961245_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ54274.1|1961244_1961943_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
AWJ54275.1|1961948_1962692_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AWJ54276.1|1962589_1963270_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.3e-113
AWJ54277.1|1963515_1966992_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AWJ54278.1|1967059_1967659_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
AWJ54279.1|1967723_1969037_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
AWJ54280.1|1968999_1969308_+|tail	phage tail protein	tail	B6ETG7	Enterobacteria_phage	96.1	9.9e-50
AWJ54281.1|1969420_1969996_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
AWJ54282.1|1970068_1970698_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWJ54283.1|1970779_1971421_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWJ54284.1|1971451_1971619_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AWJ54285.1|1972361_1972796_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWJ54286.1|1972936_1974070_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 9
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2176990	2276478	5785882	lysis,portal,holin,capsid,transposase,head,terminase,tail	Enterobacteria_phage(45.26%)	127	NA	NA
AWJ54452.1|2176990_2177260_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
AWJ54453.1|2177261_2178575_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
AWJ58007.1|2178639_2179263_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
AWJ54454.1|2179331_2182808_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
AWJ54455.1|2183053_2183734_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	96.0	2.7e-116
AWJ54456.1|2183631_2184375_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
AWJ54457.1|2184385_2185084_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ54458.1|2185083_2185413_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ54459.1|2188001_2188415_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ54460.1|2188441_2188864_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ54461.1|2188877_2189630_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
AWJ54462.1|2189637_2190033_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
AWJ54463.1|2190029_2190563_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
AWJ54464.1|2190577_2190931_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
AWJ54465.1|2190942_2191338_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
AWJ54466.1|2191379_2192405_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ54467.1|2192460_2192793_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWJ54468.1|2192802_2194122_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
AWJ54469.1|2194102_2195704_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
AWJ54470.1|2195700_2195907_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ54471.1|2195903_2197829_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
AWJ54472.1|2197803_2198349_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
AWJ54473.1|2198462_2198720_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	5.8e-11
AWJ54474.1|2198735_2198960_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
AWJ54475.1|2199041_2199356_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ54476.1|2199598_2199739_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54477.1|2199821_2200289_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	1.6e-67
AWJ54478.1|2200620_2201154_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
AWJ54479.1|2201665_2202457_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AWJ54480.1|2202460_2202676_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWJ54481.1|2202674_2202836_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54482.1|2203114_2204965_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
AWJ54483.1|2205013_2205142_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54484.1|2205286_2205553_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54485.1|2205443_2205875_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
AWJ54486.1|2206064_2206274_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
AWJ54487.1|2206326_2206551_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54488.1|2207395_2208148_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
AWJ54489.1|2208161_2209211_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
AWJ54490.1|2209212_2209482_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
AWJ54491.1|2209535_2209763_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54492.1|2209986_2210358_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ54493.1|2210350_2210668_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ54494.1|2210770_2210983_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AWJ54495.1|2211027_2211201_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AWJ54496.1|2211197_2211749_-	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
AWJ54497.1|2212100_2212286_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54498.1|2212345_2213107_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
AWJ54499.1|2213136_2213877_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
AWJ54500.1|2213883_2214849_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
AWJ54501.1|2214829_2215351_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54502.1|2215334_2215565_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ54503.1|2215648_2216056_+	transcriptional regulator	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
AWJ54504.1|2216222_2216375_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
AWJ58008.1|2216386_2217025_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWJ58009.1|2217025_2217235_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54505.1|2217283_2217544_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54506.1|2217799_2217988_+	cell division inhibitor	NA	NA	NA	NA	NA
AWJ54507.1|2217984_2218173_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ54508.1|2218265_2220728_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
AWJ54509.1|2220800_2221052_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
AWJ54510.1|2221488_2222644_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ54511.1|2224464_2224698_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWJ54512.1|2225014_2225605_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
AWJ54513.1|2225702_2226278_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AWJ54514.1|2226338_2227495_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ54515.1|2227556_2230505_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.0	2.9e-53
AWJ54516.1|2230569_2231169_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
AWJ54517.1|2231239_2234653_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
AWJ54518.1|2234713_2235361_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AWJ54519.1|2235258_2236002_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
AWJ54520.1|2236006_2236705_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
AWJ54521.1|2236714_2237044_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
AWJ54522.1|2237043_2240109_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
AWJ54523.1|2240080_2240410_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWJ58010.1|2240418_2240805_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
AWJ54524.1|2240865_2241609_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
AWJ58011.1|2241619_2242021_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AWJ54525.1|2242017_2242596_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
AWJ54526.1|2242607_2242883_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AWJ54527.1|2242875_2243244_-	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	98.1	6.3e-51
AWJ54528.1|2243285_2245313_-	peptidase S14	NA	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AWJ54529.1|2245257_2246766_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
AWJ54530.1|2246765_2246978_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWJ54531.1|2246974_2249074_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
AWJ58012.1|2249082_2249622_-	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AWJ54532.1|2250182_2250389_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
AWJ54533.1|2250543_2250744_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	68.0	2.9e-10
AWJ54534.1|2250689_2251100_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AWJ58013.1|2251251_2251425_-	protein GnsB	NA	NA	NA	NA	NA
AWJ54535.1|2251596_2251869_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54536.1|2251899_2252088_-	cold-shock protein	NA	NA	NA	NA	NA
AWJ54537.1|2252098_2252311_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWJ54538.1|2252673_2253171_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWJ54539.1|2253167_2253701_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWJ54540.1|2253697_2254009_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWJ54541.1|2254013_2254229_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWJ54542.1|2254982_2255198_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
AWJ54543.1|2255498_2255711_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AWJ54544.1|2256132_2256885_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
AWJ54545.1|2256898_2257948_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AWJ54546.1|2257949_2258228_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54547.1|2258294_2258546_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54548.1|2258762_2258918_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWJ54549.1|2258989_2259277_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWJ54550.1|2259276_2259516_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWJ54551.1|2259540_2259846_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54552.1|2260048_2260381_+	protein flxA	NA	NA	NA	NA	NA
AWJ54553.1|2260817_2262158_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWJ54554.1|2262191_2262611_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
AWJ54555.1|2262651_2263671_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.8e-55
AWJ54556.1|2263597_2264119_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54557.1|2264102_2264330_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ54558.1|2264356_2264815_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AWJ54559.1|2265007_2265163_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AWJ54560.1|2265122_2265740_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54561.1|2266226_2266415_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ54562.1|2266411_2266603_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ54563.1|2266696_2269168_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AWJ54564.1|2270953_2271301_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ54565.1|2271300_2271978_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ54566.1|2272217_2273513_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
AWJ54567.1|2273532_2273643_-	transporter	NA	NA	NA	NA	NA
AWJ54568.1|2273700_2274720_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWJ54569.1|2274731_2275946_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ54570.1|2275926_2276115_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54571.1|2276151_2276478_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 10
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2292763	2305937	5785882	portal,capsid,head,protease,terminase,tail	uncultured_Caudovirales_phage(88.89%)	21	NA	NA
AWJ54584.1|2292763_2293585_+|protease	serine protease	protease	NA	NA	NA	NA
AWJ54585.1|2293623_2293953_-	spermidine export protein MdtI	NA	NA	NA	NA	NA
AWJ54586.1|2293939_2294305_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AWJ54587.1|2294411_2294582_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54588.1|2295179_2295362_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54589.1|2295618_2295900_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54590.1|2295913_2297575_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
AWJ54591.1|2297558_2297915_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AWJ58017.1|2298038_2298212_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54592.1|2298204_2298645_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
AWJ54593.1|2298644_2298941_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
AWJ54594.1|2298937_2299276_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
AWJ54595.1|2299272_2300484_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AWJ54596.1|2300485_2301058_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
AWJ54597.1|2301097_2302255_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
AWJ54598.1|2302546_2302849_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54599.1|2302811_2302940_-	trigger factor	NA	NA	NA	NA	NA
AWJ54600.1|2302896_2303169_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ54601.1|2303179_2303590_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ54602.1|2303586_2303832_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54603.1|2304119_2305937_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	4.4e-129
>prophage 11
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2505981	2603166	5785882	tRNA,lysis,integrase,capsid,transposase,head,protease,terminase,tail	Escherichia_phage(31.34%)	118	2545482:2545496	2604613:2604627
AWJ54800.1|2505981_2507190_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
AWJ54801.1|2507197_2507629_+|transposase	IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
AWJ54802.1|2507644_2507833_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AWJ54803.1|2507836_2508196_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AWJ54804.1|2508368_2509007_-	leucine efflux protein	NA	NA	NA	NA	NA
AWJ58024.1|2509133_2510057_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ54805.1|2510159_2511245_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWJ54806.1|2511495_2513106_+	BCCT family transporter	NA	NA	NA	NA	NA
AWJ54807.1|2513137_2514262_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AWJ54808.1|2514317_2515283_+	oxidoreductase	NA	NA	NA	NA	NA
AWJ54809.1|2515336_2516464_-	ribonuclease D	NA	NA	NA	NA	NA
AWJ54810.1|2516533_2518219_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AWJ54811.1|2518423_2519005_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54812.1|2519044_2519740_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWJ54813.1|2519797_2521708_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWJ58025.1|2521839_2522184_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54814.1|2522546_2522906_+	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWJ54815.1|2523025_2523205_-	YoaH family protein	NA	NA	NA	NA	NA
AWJ54816.1|2523278_2524640_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWJ54817.1|2524643_2525222_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AWJ54818.1|2525405_2526770_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWJ54819.1|2526900_2528499_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWJ54820.1|2528502_2530053_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AWJ54821.1|2530040_2530250_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54822.1|2530350_2530545_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54823.1|2530515_2531487_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AWJ54824.1|2531549_2532350_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AWJ54825.1|2532362_2533214_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AWJ54826.1|2533268_2533727_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AWJ58026.1|2533913_2534159_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54827.1|2534101_2534722_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AWJ54828.1|2534718_2535528_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AWJ54829.1|2535693_2535903_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AWJ54830.1|2535915_2536059_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AWJ54831.1|2536020_2536227_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54832.1|2536727_2537015_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54833.1|2537089_2537233_-	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
AWJ54834.1|2537391_2537631_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54835.1|2537773_2538565_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AWJ54836.1|2538741_2540115_+	MFS transporter	NA	NA	NA	NA	NA
AWJ54837.1|2540160_2541042_-|protease	protease HtpX	protease	NA	NA	NA	NA
AWJ54838.1|2541233_2543282_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
AWJ54839.1|2543301_2544000_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWJ54840.1|2544096_2544594_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AWJ54841.1|2544723_2546007_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
2545482:2545496	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
AWJ54842.1|2545975_2548609_+	MCE family protein	NA	NA	NA	NA	NA
AWJ58027.1|2548688_2550128_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWJ54843.1|2550245_2550482_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AWJ58028.1|2550586_2550778_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ54844.1|2550778_2551435_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AWJ58029.1|2552668_2553040_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ54845.1|2553264_2554140_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
AWJ54846.1|2554280_2554550_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
AWJ54847.1|2554551_2555865_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
AWJ54848.1|2555929_2556529_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
AWJ54849.1|2556584_2558123_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
AWJ54850.1|2558171_2558519_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ54851.1|2558515_2558920_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
AWJ54852.1|2559058_2562454_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.5	0.0e+00
AWJ54853.1|2562796_2563477_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.3	6.5e-110
AWJ54854.1|2563374_2564118_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	1.7e-148
AWJ54855.1|2564128_2564827_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
AWJ54856.1|2564826_2565156_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ54857.1|2565152_2567765_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
AWJ54858.1|2567745_2568159_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ54859.1|2568185_2568608_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ54860.1|2568621_2569374_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ54861.1|2569381_2569777_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ54862.1|2569773_2570352_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWJ54863.1|2570363_2570717_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ54864.1|2570728_2571124_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ54865.1|2571165_2572191_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ54866.1|2572246_2572579_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ54867.1|2572588_2573908_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ54868.1|2575485_2575692_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ54869.1|2575688_2577614_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ54870.1|2577588_2578134_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ54871.1|2578273_2578375_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54872.1|2578522_2578717_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ54873.1|2578796_2578937_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54874.1|2578904_2579522_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ54875.1|2579671_2580109_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ54876.1|2580105_2580603_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ54877.1|2580602_2580782_-|lysis	lysis protein	lysis	A0A0P0ZC45	Stx2-converting_phage	100.0	2.7e-23
AWJ54878.1|2581254_2583105_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWJ54879.1|2583518_2583785_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54880.1|2584274_2585096_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ54881.1|2585092_2585467_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
AWJ54882.1|2585479_2586529_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWJ54883.1|2586530_2586803_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWJ54884.1|2586924_2587269_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWJ54885.1|2587388_2587601_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWJ54886.1|2587834_2588392_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWJ54887.1|2588393_2588612_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWJ54888.1|2588739_2589051_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AWJ54889.1|2589043_2589271_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWJ58030.1|2589267_2589549_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWJ54890.1|2589581_2590343_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
AWJ58031.1|2591116_2592079_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
AWJ54891.1|2592101_2592527_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ54892.1|2592523_2592826_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
AWJ54893.1|2592860_2593295_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54894.1|2593279_2593507_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54895.1|2593508_2593787_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ58032.1|2594073_2594226_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
AWJ54896.1|2594646_2594868_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
AWJ58033.1|2594867_2595038_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AWJ54897.1|2595111_2595387_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
AWJ54898.1|2595485_2598137_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
AWJ54899.1|2598129_2598939_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
AWJ58034.1|2598995_2599190_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
AWJ54900.1|2599182_2599371_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
AWJ54901.1|2599477_2599759_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
AWJ54902.1|2599724_2600840_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	9.4e-98
AWJ54903.1|2601192_2601534_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ54904.1|2601546_2602419_-	copper resistance protein D	NA	NA	NA	NA	NA
AWJ54905.1|2602422_2602797_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWJ54906.1|2602935_2603166_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2604613:2604627	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 12
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2649439	2743314	5785882	tRNA,integrase,portal,holin,capsid,plate,terminase,tail	Enterobacteria_phage(72.34%)	104	2689373:2689387	2745007:2745021
AWJ54947.1|2649439_2650411_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWJ54948.1|2650575_2653005_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AWJ54949.1|2653029_2654130_-	cytochrome C	NA	NA	NA	NA	NA
AWJ54950.1|2654517_2655264_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWJ54951.1|2655277_2655844_-	VOC family protein	NA	NA	NA	NA	NA
AWJ54952.1|2656059_2657793_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
AWJ54953.1|2657969_2658458_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AWJ54954.1|2658577_2658970_-	flagellar biosynthesis protein FlhE	NA	NA	NA	NA	NA
AWJ54955.1|2658969_2661048_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AWJ54956.1|2661040_2662189_-	flagellar biosynthetic protein FlhB	NA	NA	NA	NA	NA
AWJ54957.1|2662390_2663035_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AWJ54958.1|2663045_2663435_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AWJ54959.1|2663449_2664499_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWJ54960.1|2664501_2665362_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWJ54961.1|2665380_2666985_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
AWJ54962.1|2667030_2668692_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWJ54963.1|2668836_2669340_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AWJ54964.1|2669360_2671325_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AWJ54965.1|2671329_2672256_-	motility protein B	NA	NA	NA	NA	NA
AWJ54966.1|2672252_2673140_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AWJ54967.1|2673266_2673845_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AWJ54968.1|2673847_2674198_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AWJ54969.1|2674977_2675406_+	universal stress protein UspC	NA	NA	NA	NA	NA
AWJ54970.1|2675412_2676837_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AWJ54971.1|2676811_2677612_-	trehalose-6-phosphate phosphatase	NA	NA	NA	NA	NA
AWJ54972.1|2677778_2678765_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AWJ54973.1|2678779_2680294_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
AWJ54974.1|2680363_2681353_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ54975.1|2682149_2682653_+	non-heme ferritin	NA	NA	NA	NA	NA
AWJ54976.1|2682731_2682983_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AWJ58038.1|2683049_2683241_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54977.1|2683446_2683770_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54978.1|2683940_2684438_+	non-heme ferritin	NA	NA	NA	NA	NA
AWJ54979.1|2684475_2684715_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AWJ54980.1|2684905_2686117_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AWJ54981.1|2686178_2686844_-	YecA family protein	NA	NA	NA	NA	NA
AWJ54982.1|2687200_2688202_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
AWJ54983.1|2688207_2688555_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ54984.1|2688584_2689235_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ54985.1|2689250_2689655_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
2689373:2689387	attL	TCACCGCGTTTTTCA	NA	NA	NA	NA
AWJ54986.1|2689730_2689937_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ54987.1|2689953_2690157_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AWJ54988.1|2690178_2690529_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
AWJ54989.1|2690539_2690818_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
AWJ54990.1|2690829_2691072_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
AWJ54991.1|2691268_2691472_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
AWJ54992.1|2691468_2691687_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
AWJ54993.1|2691795_2692185_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWJ54994.1|2692181_2695022_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AWJ54995.1|2695098_2696058_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
AWJ54996.1|2696062_2696374_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
AWJ54997.1|2696437_2697028_+	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
AWJ54998.1|2697517_2698564_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AWJ54999.1|2698563_2700315_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
AWJ55000.1|2700469_2701306_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
AWJ55001.1|2701329_2702382_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
AWJ55002.1|2702427_2703228_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
AWJ55003.1|2703329_2703824_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AWJ55004.1|2703823_2704024_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
AWJ55005.1|2704026_2704350_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AWJ55006.1|2704346_2704739_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
AWJ55007.1|2704735_2705143_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
AWJ55008.1|2705281_2707159_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
AWJ55009.1|2707182_2707650_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
AWJ55010.1|2707642_2708278_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AWJ55011.1|2708274_2708856_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
AWJ55012.1|2708852_2709203_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWJ55013.1|2709206_2710103_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
AWJ55014.1|2710095_2710626_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
AWJ55015.1|2710628_2712761_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
AWJ55016.1|2712760_2713339_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
AWJ58039.1|2713382_2713859_-	serine acetyltransferase	NA	NA	NA	NA	NA
AWJ55017.1|2714111_2714606_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.2	8.9e-85
AWJ55018.1|2714612_2717420_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
AWJ55019.1|2717406_2717643_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AWJ55020.1|2717570_2717936_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AWJ55021.1|2717990_2718503_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AWJ55022.1|2718502_2719687_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
AWJ55023.1|2719844_2720945_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
AWJ55024.1|2721344_2722484_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55025.1|2722770_2723031_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55026.1|2723221_2723362_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
AWJ55027.1|2724824_2725373_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AWJ55028.1|2725429_2727262_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWJ55029.1|2727258_2727915_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ55030.1|2728056_2728173_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ55031.1|2728373_2728598_+	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AWJ55032.1|2728665_2729388_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AWJ55033.1|2729617_2730370_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
AWJ55034.1|2730366_2731035_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWJ55035.1|2731049_2732036_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AWJ55036.1|2732140_2732941_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ55037.1|2733028_2733580_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AWJ55038.1|2733625_2734345_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AWJ55039.1|2734509_2735973_-	flagellin FliC	NA	NA	NA	NA	NA
AWJ55040.1|2736227_2737640_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AWJ55041.1|2737654_2738065_+	flagella export chaperone FliS	NA	NA	NA	NA	NA
AWJ55042.1|2738064_2738430_+	flagellar protein FliT	NA	NA	NA	NA	NA
AWJ55043.1|2738507_2739995_+	alpha-amylase	NA	NA	NA	NA	NA
AWJ55044.1|2740028_2740442_-	lipoprotein	NA	NA	NA	NA	NA
AWJ55045.1|2740628_2741834_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AWJ55046.1|2741830_2742064_+	SirA-like protein	NA	NA	NA	NA	NA
AWJ55047.1|2742170_2742839_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
AWJ55048.1|2743119_2743314_+|integrase	integrase	integrase	NA	NA	NA	NA
2745007:2745021	attR	TGAAAAACGCGGTGA	NA	NA	NA	NA
>prophage 13
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2883299	2889601	5785882		Enterobacteria_phage(50.0%)	7	NA	NA
AWJ55163.1|2883299_2883842_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
AWJ55164.1|2883846_2884725_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
AWJ55165.1|2884782_2885682_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
AWJ55166.1|2885681_2886767_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
AWJ55167.1|2886838_2887102_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55168.1|2887138_2888032_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AWJ55169.1|2888206_2889601_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 14
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	2981043	2990971	5785882	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
AWJ55237.1|2981043_2982180_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
AWJ55238.1|2982176_2984177_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWJ58052.1|2984508_2984889_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AWJ55239.1|2984885_2985233_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ55240.1|2985282_2986668_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWJ55241.1|2987099_2987570_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
AWJ55242.1|2987616_2988336_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ55243.1|2988332_2990018_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ55244.1|2990239_2990971_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 15
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3069681	3165221	5785882	lysis,integrase,portal,holin,capsid,transposase,head,terminase,tail	Enterobacteria_phage(40.0%)	106	3100215:3100233	3174437:3174455
AWJ55325.1|3069681_3070170_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
AWJ55326.1|3070332_3071256_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
AWJ55327.1|3074345_3074603_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55328.1|3074634_3075282_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ55329.1|3075316_3076369_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWJ55330.1|3076365_3076923_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWJ55331.1|3076919_3078863_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWJ55332.1|3078859_3079339_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWJ55333.1|3079335_3079545_-	heme exporter protein D	NA	NA	NA	NA	NA
AWJ55334.1|3079541_3080279_-	heme exporter protein C	NA	NA	NA	NA	NA
AWJ55335.1|3080320_3080983_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWJ55336.1|3080979_3081603_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWJ55337.1|3081615_3082218_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWJ55338.1|3082227_3082677_-	nitrate reductase	NA	NA	NA	NA	NA
AWJ55339.1|3082673_3083537_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWJ55340.1|3083523_3084219_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWJ55341.1|3084225_3086712_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWJ55342.1|3086708_3086972_-	protein NapD	NA	NA	NA	NA	NA
AWJ55343.1|3086961_3087456_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWJ55344.1|3087555_3087729_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55345.1|3087864_3088353_+	ecotin	NA	NA	NA	NA	NA
AWJ55346.1|3088501_3090148_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AWJ55347.1|3090365_3092009_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWJ55348.1|3092084_3092735_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWJ55349.1|3092734_3093799_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWJ55350.1|3093872_3094928_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWJ55351.1|3095039_3096131_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWJ55352.1|3096411_3096639_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55353.1|3096613_3096853_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55354.1|3096869_3099542_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWJ55355.1|3099558_3100209_+	DNA-binding response regulator	NA	NA	NA	NA	NA
3100215:3100233	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
AWJ55356.1|3100294_3103144_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
AWJ55357.1|3103418_3104195_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWJ55358.1|3104199_3105849_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWJ55359.1|3105849_3110364_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
AWJ55360.1|3111045_3112368_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
AWJ55361.1|3113061_3113709_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
AWJ55362.1|3113918_3114188_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
AWJ55363.1|3115566_3116166_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
AWJ55364.1|3116233_3116515_-	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	97.5	3.9e-37
AWJ55365.1|3116511_3118050_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ55366.1|3118098_3118446_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ55367.1|3118442_3118847_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
AWJ55368.1|3118875_3122175_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
AWJ55369.1|3122235_3122907_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	1.2e-103
AWJ55370.1|3122804_3123548_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
AWJ55371.1|3123553_3124252_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AWJ55372.1|3124251_3124581_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
AWJ55373.1|3124577_3127139_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
AWJ55374.1|3127119_3127533_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWJ55375.1|3127559_3127991_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ55376.1|3128004_3128757_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
AWJ55377.1|3128764_3129160_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
AWJ55378.1|3129156_3129732_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
AWJ55379.1|3129746_3130100_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
AWJ55380.1|3130092_3130515_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55381.1|3130518_3131403_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
AWJ55382.1|3131460_3131808_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
AWJ55383.1|3131844_3133350_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
AWJ55384.1|3133339_3134932_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
AWJ55385.1|3134928_3135135_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
AWJ55386.1|3135118_3135325_-	hypothetical protein	NA	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
AWJ55387.1|3135337_3137047_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
AWJ55388.1|3137018_3137528_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWJ55389.1|3137922_3138117_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ55390.1|3138476_3138770_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ55391.1|3138801_3139263_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AWJ55392.1|3139259_3139757_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
AWJ58056.1|3139756_3139972_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWJ55393.1|3140837_3141554_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55394.1|3141833_3142457_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWJ55395.1|3142453_3143119_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWJ55396.1|3143115_3143718_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWJ55397.1|3143692_3144259_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWJ55398.1|3144758_3146594_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
AWJ55399.1|3147097_3147280_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWJ55400.1|3147276_3147804_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
AWJ55401.1|3147800_3148247_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
AWJ55402.1|3148533_3148824_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ55403.1|3148820_3149522_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
AWJ55404.1|3149518_3150457_-	Replication protein O	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
AWJ55405.1|3150489_3150786_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
AWJ55406.1|3150895_3151081_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AWJ55407.1|3151161_3151812_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
AWJ55408.1|3152126_3152432_+	regulator	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
AWJ55409.1|3152434_3152773_+	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
AWJ55410.1|3152906_3153377_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AWJ55411.1|3153526_3153895_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
AWJ58058.1|3153974_3154265_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	1.3e-40
AWJ55412.1|3154198_3154351_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
AWJ55413.1|3154319_3154616_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ55414.1|3154621_3155407_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ55415.1|3155403_3156081_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
AWJ58059.1|3156080_3156263_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
AWJ55416.1|3156235_3156427_+	DUF1382 domain-containing protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
AWJ55417.1|3156437_3156719_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
AWJ55418.1|3156817_3157039_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
AWJ58057.1|3157083_3157641_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	96.3	2.1e-37
AWJ55419.1|3157637_3157988_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
AWJ55420.1|3158062_3158305_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
AWJ55421.1|3158423_3158768_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWJ55422.1|3158873_3159092_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWJ55423.1|3159069_3160140_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWJ55424.1|3160154_3160760_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
AWJ55425.1|3160756_3162445_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
AWJ55426.1|3162593_3165221_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3174437:3174455	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 16
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3253895	3389570	5785882	tRNA,lysis,portal,holin,capsid,transposase,bacteriocin,head,terminase,tail	Escherichia_phage(43.07%)	173	NA	NA
AWJ55505.1|3253895_3254708_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWJ55506.1|3254707_3255721_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ55507.1|3255786_3256923_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
AWJ55508.1|3257021_3258017_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AWJ55509.1|3258013_3259192_-	MFS transporter	NA	NA	NA	NA	NA
AWJ55510.1|3259133_3259355_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55511.1|3259475_3260696_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWJ55512.1|3260854_3262861_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWJ55513.1|3262981_3263260_-	YfcL family protein	NA	NA	NA	NA	NA
AWJ55514.1|3263293_3263842_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWJ55515.1|3263841_3264651_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55516.1|3264650_3265475_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWJ55517.1|3265478_3266564_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AWJ55518.1|3266598_3267531_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWJ55519.1|3267696_3268248_+	endonuclease SmrB	NA	NA	NA	NA	NA
AWJ55520.1|3268320_3269172_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AWJ55521.1|3269173_3269713_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ55522.1|3269709_3270198_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ55523.1|3270194_3270704_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55524.1|3270719_3271472_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ55525.1|3271491_3274137_-	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ55526.1|3274218_3274782_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWJ55527.1|3275465_3275951_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AWJ55528.1|3276153_3278298_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWJ55529.1|3278297_3279608_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWJ55530.1|3279787_3280072_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AWJ55531.1|3280156_3280408_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55532.1|3280443_3281784_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AWJ55533.1|3282148_3283207_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55534.1|3283388_3284144_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWJ55535.1|3284169_3284340_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55536.1|3284437_3285370_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AWJ55537.1|3285591_3293946_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.9	0.0e+00
AWJ55538.1|3294015_3295281_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
AWJ55539.1|3295291_3295543_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
AWJ55540.1|3295553_3296000_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
AWJ55541.1|3296002_3296656_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
AWJ55542.1|3296749_3297151_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
AWJ55543.1|3297207_3297348_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AWJ55544.1|3297580_3298318_-	hypothetical protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
AWJ55545.1|3298397_3299015_-	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
AWJ55546.1|3299020_3299299_-	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
AWJ55547.1|3299313_3300582_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
AWJ55548.1|3300578_3302204_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
AWJ55549.1|3302498_3302741_-	hypothetical protein	NA	A0A0N7CHY0	Escherichia_phage	100.0	3.9e-41
AWJ55550.1|3302825_3303095_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AWJ55551.1|3303096_3305034_-|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
AWJ55552.1|3305030_3305681_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
AWJ55553.1|3305680_3306244_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
AWJ55554.1|3306227_3306689_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
AWJ55555.1|3306738_3307128_-	hypothetical protein	NA	V5UT93	Shigella_phage	99.2	2.9e-62
AWJ55556.1|3307182_3308397_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
AWJ55557.1|3308420_3309428_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
AWJ55558.1|3309585_3311730_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
AWJ55559.1|3311729_3313436_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
AWJ55560.1|3313416_3314211_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
AWJ55561.1|3314503_3315055_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
AWJ55562.1|3315231_3315699_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	98.7	5.0e-77
AWJ55563.1|3315852_3316422_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ55564.1|3316692_3317226_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
AWJ55565.1|3317230_3317446_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWJ55566.1|3317523_3317769_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWJ55567.1|3317809_3317989_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWJ55568.1|3318125_3320063_-	DUF1737 domain-containing protein	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
AWJ55569.1|3320560_3320830_-	Shiga toxin Stx2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
AWJ55570.1|3320841_3321801_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
AWJ55571.1|3322183_3322336_-	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
AWJ55572.1|3322350_3322596_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
AWJ55573.1|3322584_3323019_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AWJ55574.1|3323011_3323206_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
AWJ55575.1|3323202_3323766_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
AWJ55576.1|3323773_3324223_-	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
AWJ55577.1|3324222_3325194_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
AWJ55578.1|3325183_3326704_-	ATP-dependent helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
AWJ55579.1|3326697_3327075_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
AWJ55580.1|3327241_3327436_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55581.1|3327606_3327810_-	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
AWJ55582.1|3327905_3328619_+	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
AWJ55583.1|3328713_3330183_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
AWJ55584.1|3330179_3331133_+	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
AWJ58064.1|3331887_3332535_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	4.3e-119
AWJ55585.1|3332440_3332635_-	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	100.0	1.3e-31
AWJ55586.1|3332790_3333465_+	hypothetical protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
AWJ55587.1|3333535_3333748_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
AWJ55588.1|3333759_3334041_+	AbrB family transcriptional regulator	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
AWJ55589.1|3334061_3334343_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
AWJ55590.1|3334359_3335310_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	98.1	9.5e-176
AWJ55591.1|3335306_3335996_+	exonuclease	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
AWJ55592.1|3335995_3336583_+	DUF669 domain-containing protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
AWJ55593.1|3336657_3337005_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
AWJ55594.1|3337068_3337890_+	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
AWJ55595.1|3337966_3338410_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
AWJ55596.1|3338517_3339396_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	99.7	3.8e-179
AWJ55597.1|3339589_3339829_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	8.0e-39
AWJ55598.1|3339825_3340527_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	99.6	3.9e-134
AWJ55599.1|3340531_3340720_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55600.1|3340862_3341027_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	87.0	2.6e-17
AWJ55601.1|3341028_3341316_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
AWJ55602.1|3341319_3341943_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.6	3.6e-115
AWJ55603.1|3342038_3342767_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
AWJ55604.1|3343090_3343729_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
AWJ55605.1|3343784_3344216_+	regulator	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
AWJ55606.1|3344212_3344839_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
AWJ55607.1|3344798_3345011_+	DUF1382 domain-containing protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
AWJ55608.1|3345046_3345445_+	DUF1627 domain-containing protein	NA	G3CFH0	Escherichia_phage	99.2	4.7e-52
AWJ55609.1|3345588_3345822_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
AWJ55610.1|3345809_3346061_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
AWJ55611.1|3346121_3346304_+	DNA-binding protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
AWJ55612.1|3346287_3347457_-	DUF4102 domain-containing protein	NA	G3CFG6	Escherichia_phage	100.0	7.5e-231
AWJ55613.1|3347888_3349046_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.2	1.1e-221
AWJ55614.1|3349290_3350433_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
AWJ55615.1|3350503_3352627_-|tail	phage tail protein	tail	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
AWJ55616.1|3352748_3353015_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
AWJ55617.1|3353085_3353571_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55618.1|3353585_3355430_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
AWJ55619.1|3355429_3356836_-	acyltransferase	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
AWJ55620.1|3356845_3357538_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
AWJ55621.1|3357540_3357996_-	hypothetical protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
AWJ55622.1|3357995_3358844_-	hypothetical protein	NA	Q716G6	Shigella_phage	97.9	1.5e-100
AWJ55623.1|3358843_3360262_-	hypothetical protein	NA	Q716G7	Shigella_phage	99.2	2.3e-274
AWJ55624.1|3360270_3360753_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AWJ55625.1|3360727_3360913_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
AWJ55626.1|3360955_3362227_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
AWJ55627.1|3362238_3363123_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	98.6	3.4e-143
AWJ55628.1|3363136_3365263_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
AWJ55629.1|3365265_3366678_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
AWJ55630.1|3366674_3367100_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	87.9	1.8e-65
AWJ55631.1|3367179_3367422_-	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AWJ55632.1|3367525_3367897_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
AWJ55633.1|3368180_3368699_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
AWJ55634.1|3368904_3369342_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
AWJ55635.1|3369338_3369815_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AWJ55636.1|3369798_3370122_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AWJ55637.1|3370609_3370828_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55638.1|3371038_3371233_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55639.1|3371194_3371818_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AWJ55640.1|3371814_3372480_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
AWJ55641.1|3372457_3372664_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AWJ55642.1|3372660_3373266_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
AWJ55643.1|3373258_3373468_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
AWJ55644.1|3373427_3373829_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
AWJ55645.1|3373831_3374008_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWJ55646.1|3374004_3374415_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AWJ55647.1|3374386_3374743_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AWJ55648.1|3375012_3375198_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55649.1|3375208_3375424_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
AWJ55650.1|3375510_3376887_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
AWJ55651.1|3376883_3377705_-	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
AWJ58065.1|3377888_3378167_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
AWJ55652.1|3378276_3378501_-	transcriptional regulator	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
AWJ55653.1|3378645_3379320_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
AWJ55654.1|3379360_3379657_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55655.1|3380090_3380363_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
AWJ55656.1|3380365_3380728_+	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
AWJ55657.1|3380758_3381253_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
AWJ55658.1|3381453_3381924_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
AWJ55659.1|3382067_3382379_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
AWJ55660.1|3382573_3382726_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AWJ55661.1|3382778_3383935_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ55662.1|3383950_3384160_+	hypothetical protein	NA	K7PH22	Enterobacteria_phage	100.0	2.8e-24
AWJ55663.1|3384249_3384855_+	recombinase	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
AWJ55664.1|3384854_3385238_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
AWJ55665.1|3385261_3385555_+	RecBCD nuclease inhibitor	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
AWJ55666.1|3385726_3386314_+	DUF4752 domain-containing protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
AWJ55667.1|3386310_3386979_+	hypothetical protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
AWJ55668.1|3386980_3387169_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
AWJ55669.1|3387172_3387790_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
AWJ55670.1|3387786_3388374_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
AWJ55671.1|3388373_3388652_+	DUF4752 domain-containing protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
AWJ55672.1|3388664_3388865_+	hypothetical protein	NA	K7PMC6	Enterobacterial_phage	87.3	9.0e-20
AWJ55673.1|3388797_3389109_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.1e-55
AWJ55674.1|3389144_3389312_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
AWJ55675.1|3389369_3389570_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 17
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3548964	3604187	5785882	integrase,holin,protease,terminase,tail	Escherichia_phage(45.28%)	63	3563828:3563844	3601073:3601089
AWJ55814.1|3548964_3550428_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AWJ55815.1|3550448_3550808_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AWJ55816.1|3550945_3551692_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWJ55817.1|3551741_3553031_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AWJ55818.1|3553116_3553743_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWJ55819.1|3553863_3554049_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55820.1|3554067_3555105_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AWJ55821.1|3555104_3555743_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AWJ55822.1|3555913_3557980_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
AWJ55823.1|3557984_3559526_+	exopolyphosphatase	NA	NA	NA	NA	NA
AWJ55824.1|3559564_3561808_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AWJ55825.1|3561989_3562142_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AWJ55826.1|3562159_3562351_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AWJ55827.1|3562412_3562559_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AWJ55828.1|3562661_3563180_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
AWJ55829.1|3563195_3563735_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
3563828:3563844	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AWJ55830.1|3563954_3564437_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
AWJ55831.1|3564433_3565063_-	endolysin	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
AWJ55832.1|3565052_3565361_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
AWJ55833.1|3565357_3565750_-	hypothetical protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
AWJ58071.1|3565898_3566261_+	GtrA family protein	NA	I1TED9	Salmonella_phage	80.8	2.2e-48
AWJ55834.1|3566397_3569019_-|tail	phage tail protein	tail	A0A193GYU1	Enterobacter_phage	70.1	4.3e-125
AWJ55835.1|3569214_3569472_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
AWJ55836.1|3569503_3569800_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AWJ55837.1|3569995_3572470_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
AWJ55838.1|3572475_3574278_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
AWJ55839.1|3574274_3576788_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.8	0.0e+00
AWJ55840.1|3576787_3577333_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
AWJ55841.1|3577332_3577797_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
AWJ55842.1|3577796_3580268_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
AWJ55843.1|3580267_3580873_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	98.5	4.0e-111
AWJ55844.1|3580872_3581196_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
AWJ55845.1|3581246_3581582_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AWJ55846.1|3581592_3582030_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	96.6	7.7e-72
AWJ55847.1|3582081_3583068_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AWJ55848.1|3583082_3583778_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
AWJ55849.1|3583780_3584077_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AWJ55850.1|3584073_3585753_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.4e-301
AWJ55851.1|3585767_3585974_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AWJ55852.1|3586676_3587048_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	4.5e-57
AWJ55853.1|3587138_3588614_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.4	1.3e-296
AWJ55854.1|3588610_3589285_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
AWJ55855.1|3589325_3589664_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
AWJ55856.1|3589656_3589938_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	92.5	1.0e-45
AWJ55857.1|3589930_3590797_-	Eaa protein	NA	A0A0H4IU61	Shigella_phage	57.9	2.9e-70
AWJ55858.1|3590798_3591260_-	hypothetical protein	NA	A0A0P0ZFW8	Escherichia_phage	76.5	7.4e-57
AWJ55859.1|3591223_3591856_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	68.0	1.9e-63
AWJ55860.1|3591917_3592262_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
AWJ58072.1|3592379_3593165_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.5	6.7e-151
AWJ55861.1|3593161_3593977_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
AWJ55862.1|3593992_3594193_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AWJ55863.1|3594343_3594574_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AWJ55864.1|3594728_3595313_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AWJ55865.1|3595621_3595921_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
AWJ55866.1|3595917_3596739_+	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	96.7	1.8e-159
AWJ55867.1|3596735_3597617_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
AWJ55868.1|3597666_3597915_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AWJ58073.1|3598072_3598324_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	97.6	4.4e-40
AWJ55869.1|3598316_3598967_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	2.5e-127
AWJ55870.1|3598963_3599623_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
AWJ55871.1|3599625_3600882_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.3	1.7e-236
AWJ55872.1|3601074_3602652_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
3601073:3601089	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AWJ55873.1|3602720_3604187_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 18
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3681676	3786998	5785882	tRNA,lysis,holin,capsid,head,terminase,tail	Stx2-converting_phage(32.39%)	114	NA	NA
AWJ55943.1|3681676_3682414_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWJ55944.1|3682545_3683880_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWJ58075.1|3684088_3684970_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ55945.1|3685072_3685660_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWJ55946.1|3685715_3686099_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWJ55947.1|3686403_3687093_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWJ55948.1|3687140_3688178_-	methyltransferase	NA	NA	NA	NA	NA
AWJ55949.1|3688167_3688371_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55950.1|3688384_3688804_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWJ55951.1|3688872_3689571_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWJ55952.1|3689602_3692263_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWJ55953.1|3692376_3693732_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWJ55954.1|3693777_3694101_+	lipoprotein	NA	NA	NA	NA	NA
AWJ55955.1|3694097_3695396_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWJ55956.1|3695377_3695491_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWJ55957.1|3701249_3703823_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWJ55958.1|3703952_3704684_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWJ55959.1|3704680_3705661_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWJ55960.1|3705795_3706533_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWJ55961.1|3706562_3706769_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55962.1|3706803_3707145_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWJ58076.1|3707248_3707296_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55963.1|3707394_3708555_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWJ55964.1|3708597_3709719_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWJ55965.1|3709729_3710800_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWJ55966.1|3711009_3711375_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55967.1|3711524_3712043_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWJ55968.1|3712032_3713259_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWJ55969.1|3713274_3713757_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ55970.1|3713833_3714181_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWJ55971.1|3714222_3714990_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWJ55972.1|3715020_3715569_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWJ55973.1|3715587_3715836_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWJ55974.1|3716084_3717446_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ58077.1|3717612_3718404_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ58078.1|3718469_3719711_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWJ55975.1|3719765_3720359_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWJ55976.1|3720355_3720550_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWJ55977.1|3720481_3721360_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWJ55978.1|3721445_3723107_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWJ55979.1|3723255_3723597_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWJ55980.1|3723658_3723949_-	RnfH family protein	NA	NA	NA	NA	NA
AWJ55981.1|3723938_3724415_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWJ55982.1|3724546_3725029_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ55983.1|3726783_3728145_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
AWJ55984.1|3728521_3731923_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
AWJ55985.1|3732515_3734864_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWJ55986.1|3735079_3735349_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
AWJ55987.1|3735350_3736664_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
AWJ58079.1|3736728_3737328_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
AWJ55988.1|3737395_3740869_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
AWJ55989.1|3740935_3741154_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ55990.1|3741107_3741788_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.3	8.2e-113
AWJ55991.1|3741685_3742429_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
AWJ55992.1|3742439_3743138_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
AWJ55993.1|3743137_3743479_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
AWJ55994.1|3743471_3746714_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
AWJ55995.1|3746761_3747043_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
AWJ55996.1|3747066_3747441_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
AWJ55997.1|3747446_3748163_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
AWJ55998.1|3748228_3748573_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ55999.1|3748569_3749016_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ56000.1|3749012_3749363_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ56001.1|3749373_3749700_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ56002.1|3752226_3752448_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ56003.1|3752492_3754430_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
AWJ56004.1|3754493_3756155_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ56005.1|3756151_3756715_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ56006.1|3756830_3757037_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	89.7	1.4e-28
AWJ56007.1|3757005_3757371_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
AWJ56008.1|3757412_3757640_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWJ56009.1|3758008_3758233_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ56010.1|3758229_3758724_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.2	9.0e-77
AWJ56011.1|3759022_3759556_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWJ56012.1|3759606_3759951_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ56013.1|3759955_3760171_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWJ56014.1|3760247_3760520_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWJ56015.1|3760560_3760740_-	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ56016.1|3760875_3762813_-	sialate O-acetylesterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
AWJ56017.1|3762861_3762990_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ56018.1|3763134_3763401_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ56019.1|3763932_3764859_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ56020.1|3764845_3765394_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ56021.1|3765406_3765748_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AWJ56022.1|3765765_3766755_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
AWJ56023.1|3766762_3767560_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
AWJ56024.1|3767579_3767969_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
AWJ56025.1|3767965_3768292_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWJ56026.1|3768288_3768942_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
AWJ56027.1|3768941_3769436_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
AWJ56028.1|3769432_3770251_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
AWJ56029.1|3770247_3770472_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AWJ56030.1|3770468_3771620_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
AWJ56031.1|3771616_3772168_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AWJ56032.1|3772211_3772412_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWJ56033.1|3772502_3773177_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AWJ56034.1|3773576_3773771_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	1.7e-31
AWJ56035.1|3773843_3774206_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ56036.1|3774271_3775096_+	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
AWJ56037.1|3775224_3775761_+	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
AWJ56038.1|3775751_3776630_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
AWJ56039.1|3776626_3776830_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
AWJ56040.1|3776822_3777062_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
AWJ56041.1|3777058_3777388_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
AWJ56042.1|3777389_3778253_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
AWJ56043.1|3778337_3778580_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
AWJ56044.1|3778583_3778730_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
AWJ56045.1|3778738_3778948_+	excisionase	NA	I6PBM8	Cronobacter_phage	88.2	1.6e-30
AWJ56046.1|3778902_3780078_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
AWJ58080.1|3780560_3781469_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
AWJ58081.1|3781767_3783003_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	99.5	6.5e-233
AWJ56047.1|3783041_3783458_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWJ56048.1|3783529_3785278_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
AWJ56049.1|3785279_3786998_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 19
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	3859789	3866929	5785882		Escherichia_phage(83.33%)	6	NA	NA
AWJ56118.1|3859789_3862351_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWJ56119.1|3862456_3863113_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWJ56120.1|3863163_3863931_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ56121.1|3864126_3865035_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ56122.1|3865031_3866294_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWJ56123.1|3866290_3866929_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 20
CP028126	Escherichia coli O26 str. RM10386 chromosome, complete genome	5785882	4946579	4959912	5785882	transposase	Enterobacteria_phage(66.67%)	17	NA	NA
AWJ57131.1|4946579_4947749_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.1	1.7e-198
AWJ57132.1|4947768_4949628_+	helicase	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
AWJ57133.1|4949624_4950050_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57134.1|4950377_4950950_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AWJ57135.1|4951023_4951524_-	transactivation protein	NA	NA	NA	NA	NA
AWJ57136.1|4951520_4952255_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
AWJ57137.1|4952602_4952794_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57138.1|4952806_4953073_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWJ57139.1|4953069_4953669_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
AWJ57140.1|4953661_4953949_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWJ57141.1|4953941_4954397_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
AWJ57142.1|4954472_4956044_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ57143.1|4956063_4956411_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ57144.1|4956410_4957088_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ57145.1|4957064_4957247_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57146.1|4957243_4957564_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ57147.1|4957578_4959912_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
>prophage 1
CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	0	7581	98899		Escherichia_phage(50.0%)	8	NA	NA
AWJ52224.1|1796_2606_-	helicase	NA	A0A077SK46	Escherichia_phage	99.6	3.4e-158
AWJ52225.1|2898_3783_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
AWJ52226.1|4116_4509_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
AWJ52227.1|4686_5109_-	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AWJ52228.1|5148_5937_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
AWJ52229.1|5945_6125_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
AWJ52230.1|6399_6684_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
AWJ52231.1|6687_7581_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.0	2.5e-154
>prophage 2
CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	11594	74028	98899	portal,lysis,holin,head,tail,terminase,plate,protease	Escherichia_phage(65.71%)	71	NA	NA
AWJ52232.1|11594_12026_-	hypothetical protein	NA	Q71T99	Escherichia_phage	75.4	1.3e-18
AWJ52233.1|12026_12218_-	hypothetical protein	NA	Q71T98	Escherichia_phage	96.8	6.6e-28
AWJ52234.1|12409_12646_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AWJ52235.1|12626_13454_+|protease	serine protease	protease	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
AWJ52236.1|13837_15202_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
AWJ52237.1|15201_16200_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	3.7e-194
AWJ52238.1|17887_18673_-|plate	baseplate	plate	A0A077SLJ8	Escherichia_phage	98.9	3.0e-143
AWJ52239.1|18659_19388_-|tail	phage tail protein	tail	A0A077SK19	Escherichia_phage	100.0	9.3e-139
AWJ52240.1|21140_21386_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
AWJ52241.1|22031_22187_+	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
AWJ52242.1|22128_22791_+	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AWJ52243.1|23309_23987_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AWJ52244.1|23983_24685_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	5.4e-144
AWJ52245.1|24766_24985_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AWJ52246.1|24986_25214_+	hypothetical protein	NA	A0A077SL55	Escherichia_phage	100.0	6.2e-17
AWJ52247.1|25150_26248_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.7	1.6e-203
AWJ52248.1|26320_26827_+	3'-phosphatase	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
AWJ52249.1|27020_27746_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	3.8e-140
AWJ52321.1|27785_27977_+	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	4.7e-18
AWJ52250.1|27973_28189_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52251.1|28181_28826_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	99.1	4.4e-132
AWJ52252.1|28822_29590_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	98.5	8.8e-31
AWJ52253.1|29586_30075_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	88.0	4.4e-44
AWJ52254.1|30247_30436_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AWJ52322.1|30365_30647_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	91.4	6.7e-45
AWJ52255.1|30643_31186_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	74.6	7.3e-72
AWJ52256.1|31268_31502_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
AWJ52257.1|31680_31974_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
AWJ52258.1|31980_32355_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.0	3.2e-66
AWJ52259.1|32336_33269_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	98.4	1.4e-179
AWJ52260.1|33265_33628_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
AWJ52261.1|33938_34136_+	hypothetical protein	NA	Q71TI2	Escherichia_phage	98.5	7.5e-27
AWJ52262.1|34289_34541_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
AWJ52263.1|34664_35054_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
AWJ52264.1|35126_35348_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWJ52265.1|35347_35728_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AWJ52266.1|35732_35912_+	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
AWJ52267.1|35939_36983_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.9e-207
AWJ52268.1|37071_37524_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
AWJ52269.1|37610_38804_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.5	4.8e-209
AWJ52270.1|38803_40288_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
AWJ52271.1|40489_40849_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
AWJ52272.1|40845_41964_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	87.9	1.2e-177
AWJ52273.1|41996_42848_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AWJ52274.1|42958_43168_-	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AWJ52275.1|43133_43229_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AWJ52276.1|43247_43361_-	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AWJ52277.1|43723_44314_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	5.6e-25
AWJ52278.1|47591_47813_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AWJ52279.1|47820_48852_+	recombinase	NA	A0A077SLE7	Escherichia_phage	99.7	4.9e-194
AWJ52280.1|48902_49214_+	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	99.0	3.9e-46
AWJ52281.1|49460_50021_+	recombinase	NA	Q71TG3	Escherichia_phage	96.8	5.5e-99
AWJ52282.1|50210_50852_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
AWJ52283.1|52251_52500_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AWJ52284.1|52496_52937_-	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AWJ52285.1|59812_61522_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AWJ52286.1|61514_62534_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
AWJ52287.1|62513_62690_-|holin	antiholin	holin	Q71TR5	Escherichia_phage	89.7	1.7e-25
AWJ52323.1|62825_63383_-	lysozyme	NA	Q71TF3	Escherichia_phage	96.8	1.7e-103
AWJ52288.1|63552_64041_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	90.1	2.3e-77
AWJ52289.1|64238_64916_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	97.8	1.9e-125
AWJ52290.1|64922_65705_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
AWJ52291.1|65697_66792_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.3	1.3e-40
AWJ52292.1|66823_67132_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
AWJ52293.1|67121_70109_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.2	0.0e+00
AWJ52294.1|70121_70487_-	ddrA	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
AWJ52295.1|70483_72403_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.7	0.0e+00
AWJ52296.1|72404_73007_-	odaE	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
AWJ52297.1|72993_73437_-|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	99.3	2.9e-82
AWJ52298.1|73433_73550_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	8.0e-13
AWJ52299.1|73530_74028_+	hypothetical protein	NA	A0A077SL44	Escherichia_phage	63.1	1.4e-24
>prophage 3
CP028125	Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence	98899	78569	98088	98899	tail,plate	Escherichia_phage(50.0%)	22	NA	NA
AWJ52300.1|78569_79004_-|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
AWJ52301.1|79082_79919_-|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
AWJ52302.1|79918_81352_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.2	4.5e-270
AWJ52303.1|81348_81705_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AWJ52304.1|81704_85097_-	lytic transglycosylase domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	98.4	0.0e+00
AWJ52305.1|85178_86060_-	morphogenetic protein	NA	Q71TC9	Escherichia_phage	99.7	4.8e-174
AWJ52306.1|86074_86686_-|tail	phage tail protein	tail	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
AWJ52307.1|86696_87263_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	100.0	6.6e-100
AWJ52308.1|87321_87591_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52309.1|87849_88524_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
AWJ52310.1|88720_88891_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ52311.1|88924_89146_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	94.5	6.9e-37
AWJ52312.1|89142_90180_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	92.8	7.0e-172
AWJ52313.1|90343_91144_+	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AWJ52314.1|91173_92019_+	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	99.6	2.2e-152
AWJ52324.1|92069_92315_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AWJ52315.1|92496_92652_+	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	88.2	3.4e-14
AWJ52316.1|92768_93278_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	1.1e-90
AWJ52317.1|93289_93871_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	96.9	2.1e-101
AWJ52318.1|93906_94722_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	9.8e-113
AWJ52319.1|94731_96321_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	99.6	3.7e-305
AWJ52320.1|96381_98088_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
>prophage 1
CP028124	Escherichia coli O26 str. RM10386 plasmid pRM10386-2, complete sequence	83012	7192	54064	83012	transposase,bacteriocin,integrase	Stx2-converting_phage(35.29%)	51	2428:2442	37039:37053
2428:2442	attL	ATTGATGCAACAGGA	NA	NA	NA	NA
AWJ52152.1|7192_7531_+|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
AWJ52153.1|7538_7919_-	colicin M immunity protein	NA	NA	NA	NA	NA
AWJ52154.1|8064_8847_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
AWJ52155.1|8848_9262_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52156.1|9375_9570_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52157.1|9705_9843_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AWJ52158.1|9820_10051_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWJ52159.1|10047_10464_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWJ52160.1|10625_11171_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52161.1|11238_12394_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ52162.1|13199_14060_-	hypothetical protein	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
AWJ52163.1|14187_14574_+	recombinase	NA	NA	NA	NA	NA
AWJ52164.1|14627_15302_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ52165.1|15298_15646_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ52166.1|15649_17218_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWJ52167.1|17764_17914_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWJ52168.1|17877_18543_-	traC	NA	NA	NA	NA	NA
AWJ52169.1|18683_19325_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AWJ52170.1|19611_19842_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52171.1|19949_20039_+	positive regulator for repZ translation	NA	NA	NA	NA	NA
AWJ52172.1|20026_21058_+	replication initiation protein	NA	NA	NA	NA	NA
AWJ52218.1|22017_22461_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52173.1|24499_24835_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52174.1|25115_26303_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ52175.1|26302_26668_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ52176.1|26786_26978_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52177.1|29118_29466_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ52178.1|29462_30137_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ52179.1|30190_30418_-	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
AWJ52180.1|30580_31558_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWJ52181.1|32363_33576_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
AWJ52182.1|34201_35389_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ52183.1|35388_35637_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ52184.1|35709_36923_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
AWJ52185.1|37107_37320_+	hypothetical protein	NA	NA	NA	NA	NA
37039:37053	attR	TCCTGTTGCATCAAT	NA	NA	NA	NA
AWJ52186.1|37307_39317_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AWJ52187.1|39360_39750_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
AWJ52188.1|40710_41106_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWJ52189.1|41105_42065_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
AWJ52190.1|46570_47161_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	5.6e-25
AWJ52191.1|47441_48125_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
AWJ52219.1|48124_48343_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52192.1|48354_48789_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWJ52193.1|48833_49316_+	recombinase	NA	NA	NA	NA	NA
AWJ52194.1|49312_50032_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWJ52220.1|50308_50626_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
AWJ52195.1|51087_51588_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
AWJ52196.1|52103_52319_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52197.1|52315_52750_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AWJ52198.1|52842_53109_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ52199.1|53173_54064_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
>prophage 2
CP028124	Escherichia coli O26 str. RM10386 plasmid pRM10386-2, complete sequence	83012	63471	75249	83012	transposase,protease	Stx2-converting_phage(83.33%)	8	NA	NA
AWJ52207.1|63471_67374_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
AWJ52208.1|68661_69336_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ52209.1|69332_69680_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ52210.1|69683_71252_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWJ52211.1|71530_72718_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ52212.1|72717_73083_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ52213.1|73319_73667_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ52214.1|73716_75249_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
