The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	198427	260601	5057506	plate,protease,transposase,tRNA	Emiliania_huxleyi_virus(12.5%)	54	NA	NA
AWJ47406.1|198427_199780_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AWJ47407.1|199809_202242_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AWJ47408.1|202363_202849_+	chaperone protein Skp	NA	NA	NA	NA	NA
AWJ47409.1|202852_203878_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AWJ47410.1|203982_204438_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AWJ47411.1|204441_205230_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AWJ47412.1|205229_206378_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AWJ47413.1|206374_206971_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AWJ47414.1|207007_210490_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AWJ47415.1|210502_211462_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AWJ47416.1|211560_213702_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AWJ47417.1|213758_214148_+	VOC family protein	NA	NA	NA	NA	NA
AWJ47418.1|214212_215511_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AWJ51935.1|215559_215814_-	protein rof	NA	NA	NA	NA	NA
AWJ47419.1|215806_216007_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47420.1|216172_216718_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47421.1|216714_217137_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AWJ47422.1|217150_217861_+	copper homeostasis/adhesion lipoprotein NlpE	NA	NA	NA	NA	NA
AWJ47423.1|217867_218119_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47424.1|218110_219091_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
AWJ47425.1|219293_220118_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47426.1|220170_221889_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AWJ47427.1|221999_222707_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AWJ47428.1|222703_223108_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AWJ47429.1|223225_224041_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AWJ47430.1|224080_224734_-	methionine ABC transporter	NA	NA	NA	NA	NA
AWJ47431.1|224726_225758_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AWJ47432.1|225945_226518_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AWJ47433.1|232264_233068_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
AWJ47434.1|233064_233979_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ47435.1|234219_235020_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AWJ47436.1|235097_235868_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ47437.1|235915_237274_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AWJ47438.1|237345_238101_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWJ47439.1|238134_238857_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ47440.1|238853_239321_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWJ51936.1|239385_240117_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
AWJ47441.1|240056_240236_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47442.1|240652_241438_+	aminopeptidase	NA	NA	NA	NA	NA
AWJ47443.1|241574_242054_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47444.1|242063_242978_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47445.1|243021_243504_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWJ47446.1|243527_244880_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ51937.1|244890_248355_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AWJ47447.1|248433_249915_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWJ47448.1|249853_250597_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AWJ47449.1|250593_253353_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	9.4e-83
AWJ47450.1|253361_254123_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47451.1|254127_255459_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWJ47452.1|255461_255986_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWJ47453.1|255982_257263_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWJ47454.1|257287_258370_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWJ47455.1|258333_260184_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWJ47456.1|260187_260601_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	564334	627476	5057506	tail,holin,protease,portal,transposase,capsid,terminase,lysis,integrase,head,tRNA	Enterobacteria_phage(42.31%)	74	574496:574542	618950:618996
AWJ47735.1|564334_565720_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AWJ47736.1|565755_566277_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ47737.1|566384_566597_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ47738.1|566598_567465_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ47739.1|567945_568488_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ47740.1|568707_569400_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AWJ47741.1|569430_572040_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ47742.1|572052_573060_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ47743.1|573070_573586_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ47744.1|573588_574221_-	DNA-binding response regulator	NA	NA	NA	NA	NA
574496:574542	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ47745.1|574555_575719_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.3	2.8e-198
AWJ47746.1|575574_576030_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
AWJ47747.1|575945_576251_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
AWJ47748.1|576250_576613_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
AWJ47749.1|576603_577140_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	97.8	5.3e-99
AWJ47750.1|577267_578092_-	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWJ47751.1|578157_578520_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWJ51948.1|578945_579506_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47752.1|579825_580518_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
AWJ47753.1|580615_580876_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
AWJ47754.1|580868_581420_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.4	2.9e-100
AWJ47755.1|581595_581775_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AWJ47756.1|581764_582706_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
AWJ47757.1|582702_583197_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.1e-86
AWJ47758.1|583163_583523_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	96.3	2.1e-51
AWJ47759.1|583519_583909_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
AWJ47760.1|583928_584726_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
AWJ47761.1|584733_585723_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	5.4e-190
AWJ47762.1|585740_586124_+	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AWJ47763.1|586313_587411_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
AWJ47764.1|587999_588215_+|holin	holin	holin	A5LH82	Enterobacteria_phage	98.6	3.4e-33
AWJ47765.1|588214_588712_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AWJ47766.1|588708_589170_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.0e-74
AWJ47767.1|589201_589495_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AWJ47768.1|589785_590196_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	99.3	9.4e-72
AWJ47769.1|590481_590688_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AWJ47770.1|590852_591047_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AWJ47771.1|591194_591296_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47772.1|591435_591981_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AWJ47773.1|591955_593881_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ47774.1|593877_594084_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWJ47775.1|594080_595682_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
AWJ47776.1|595662_596982_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AWJ47777.1|596991_597324_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ47778.1|597379_598405_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWJ47779.1|598446_598842_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
AWJ47780.1|598853_599207_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ47781.1|599218_599797_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
AWJ47782.1|599793_600189_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AWJ51949.1|600196_600937_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AWJ47783.1|600952_601375_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
AWJ47784.1|601356_601791_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AWJ47785.1|601783_604345_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.4	0.0e+00
AWJ47786.1|604341_604671_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AWJ47787.1|604670_605369_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
AWJ47788.1|605374_606118_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
AWJ47789.1|606015_606687_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AWJ47790.1|606746_610244_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.9	0.0e+00
AWJ47791.1|610314_610914_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	4.8e-109
AWJ51950.1|610978_614050_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
AWJ47792.1|614049_614634_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
AWJ47793.1|614606_614744_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWJ51951.1|614688_615315_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ47794.1|615413_615719_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ47795.1|615902_617387_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ47796.1|617573_618527_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AWJ47797.1|618552_618744_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47798.1|618929_619046_-	hypothetical protein	NA	NA	NA	NA	NA
618950:618996	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ47799.1|619039_619801_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ47800.1|619857_620070_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47801.1|619983_620874_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47802.1|620874_623847_-	phage receptor	NA	NA	NA	NA	NA
AWJ47803.1|623833_626071_-	bacteriophage N4 adsorption protein B	NA	NA	NA	NA	NA
AWJ47804.1|626339_627476_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1107985	1172659	5057506	tail,holin,bacteriocin,portal,capsid,terminase,lysis	Escherichia_phage(68.83%)	79	NA	NA
AWJ48231.1|1107985_1109296_-	DUF3596 domain-containing protein	NA	A0A0P0ZGT7	Escherichia_phage	100.0	2.4e-254
AWJ48232.1|1109348_1109633_-	DNA-binding protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
AWJ48233.1|1109678_1109930_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
AWJ48234.1|1109917_1110151_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	98.7	3.1e-35
AWJ48235.1|1110294_1110684_-	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
AWJ48236.1|1110719_1110932_-	DUF1382 domain-containing protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
AWJ48237.1|1110891_1111518_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
AWJ48238.1|1111514_1111946_-	regulator	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
AWJ48239.1|1112001_1112679_-	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
AWJ48240.1|1113003_1113261_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
AWJ51968.1|1113389_1113587_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	98.5	9.2e-33
AWJ48241.1|1113676_1113982_+	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
AWJ51969.1|1114024_1114594_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
AWJ48242.1|1114845_1115127_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	1.8e-50
AWJ48243.1|1115329_1116223_-	hypothetical protein	NA	A0A0N7BYR8	Escherichia_phage	92.1	6.0e-164
AWJ48244.1|1116219_1116459_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
AWJ48245.1|1116451_1116655_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
AWJ48246.1|1116651_1117530_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
AWJ48247.1|1117637_1118081_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	100.0	1.7e-79
AWJ48248.1|1118157_1118979_-	DUF2303 domain-containing protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
AWJ48249.1|1119042_1119390_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
AWJ48250.1|1119465_1120053_-	DUF669 domain-containing protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
AWJ48251.1|1120052_1120742_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	100.0	2.7e-135
AWJ48252.1|1120738_1121689_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
AWJ48253.1|1121707_1121989_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
AWJ48254.1|1122303_1122516_-	cell division inhibitor protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
AWJ48255.1|1122586_1123234_-	hypothetical protein	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
AWJ48256.1|1124094_1125048_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
AWJ48257.1|1125044_1126514_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
AWJ48258.1|1126608_1127322_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
AWJ48259.1|1127417_1127621_+	Cro/Cl family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
AWJ48260.1|1127791_1127986_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48261.1|1128152_1128530_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
AWJ48262.1|1128523_1130044_+	ATP-dependent helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
AWJ48263.1|1130033_1131005_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
AWJ48264.1|1131004_1131454_+	DUF1367 domain-containing protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
AWJ48265.1|1131461_1132025_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
AWJ48266.1|1132021_1132216_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
AWJ48267.1|1132208_1132643_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
AWJ48268.1|1132631_1132877_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AWJ48269.1|1133149_1134097_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
AWJ48270.1|1134106_1134376_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWJ48271.1|1134526_1134754_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	79.4	2.4e-21
AWJ48272.1|1134879_1136820_+	sialate O-acetylesterase	NA	A0A0H4IQ82	Shigella_phage	99.5	0.0e+00
AWJ48273.1|1136955_1137135_+	DUF1378 domain-containing protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
AWJ48274.1|1137175_1137421_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
AWJ48275.1|1137498_1137714_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AWJ48276.1|1137718_1138252_+	lysozyme	NA	A0A2L1IV49	Escherichia_phage	92.7	5.1e-94
AWJ48277.1|1138525_1139095_+	hypothetical protein	NA	A0A0N7KZV8	Escherichia_phage	97.9	6.4e-103
AWJ48278.1|1139251_1139689_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	1.4e-68
AWJ48279.1|1139891_1140434_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
AWJ48280.1|1140592_1140973_+	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	1.6e-65
AWJ48281.1|1141372_1142179_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
AWJ48282.1|1142159_1143866_+|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.8	0.0e+00
AWJ48283.1|1143865_1146010_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	100.0	0.0e+00
AWJ48284.1|1146167_1147175_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
AWJ48285.1|1147198_1148413_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
AWJ48286.1|1148467_1148857_+	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	100.0	3.8e-62
AWJ48287.1|1148907_1149369_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
AWJ48288.1|1149352_1149916_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
AWJ48289.1|1149915_1150566_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	100.0	3.5e-121
AWJ48290.1|1150562_1152344_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.2	1.3e-61
AWJ48291.1|1152412_1153084_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.3	5.1e-107
AWJ48292.1|1153162_1154788_+	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
AWJ48293.1|1154784_1156053_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
AWJ48294.1|1156067_1156346_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
AWJ48295.1|1156351_1156969_+	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	99.5	1.5e-121
AWJ48296.1|1157533_1157752_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	97.2	9.2e-34
AWJ48297.1|1157833_1157974_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AWJ48298.1|1158030_1158432_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
AWJ48299.1|1158525_1159182_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
AWJ51970.1|1159640_1159892_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	92.3	1.5e-11
AWJ48300.1|1159902_1161147_+	hypothetical protein	NA	A0A088CBK4	Shigella_phage	96.2	5.5e-208
AWJ48301.1|1161236_1169618_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	97.4	0.0e+00
AWJ48302.1|1169986_1170193_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	94.5	6.2e-24
AWJ48303.1|1170390_1170627_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48304.1|1170559_1170733_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AWJ48305.1|1170815_1172144_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
AWJ48306.1|1172164_1172659_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 4
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1399694	1468345	5057506	tail,holin,protease,portal,capsid,terminase,lysis,integrase,head	Escherichia_phage(31.48%)	82	1399531:1399555	1454540:1454564
1399531:1399555	attL	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
AWJ48527.1|1399694_1400825_-|integrase	integrase	integrase	O21940	Phage_21	51.4	1.2e-103
AWJ48528.1|1400802_1401051_-	excisionase	NA	NA	NA	NA	NA
AWJ48529.1|1401115_1403587_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
AWJ48530.1|1403682_1403871_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ48531.1|1403867_1404056_-	cell division inhibitor	NA	NA	NA	NA	NA
AWJ51986.1|1404614_1404917_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ51985.1|1404840_1405209_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48532.1|1405220_1405373_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AWJ48533.1|1405562_1406021_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	6.2e-24
AWJ48534.1|1406047_1406275_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ48535.1|1406258_1406780_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48536.1|1406760_1407726_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
AWJ48537.1|1407732_1408473_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
AWJ48538.1|1408502_1409264_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
AWJ48539.1|1409323_1409518_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48540.1|1409859_1410411_+	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
AWJ48541.1|1410407_1410581_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AWJ48542.1|1410625_1410838_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
AWJ48543.1|1410940_1411258_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ48544.1|1411846_1412074_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48545.1|1412127_1412397_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
AWJ48546.1|1412398_1413448_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.9e-109
AWJ48547.1|1413460_1413823_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
AWJ48548.1|1413815_1414481_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
AWJ48549.1|1414734_1415448_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48550.1|1415621_1415819_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
AWJ48551.1|1415970_1417029_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
AWJ48552.1|1417508_1417937_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AWJ48553.1|1418633_1419359_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ48554.1|1419447_1419726_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48555.1|1421221_1423186_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	2.0e-297
AWJ48556.1|1423320_1423500_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
AWJ48557.1|1423540_1423786_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWJ48558.1|1423863_1424079_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
AWJ48559.1|1424082_1424874_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
AWJ48560.1|1426044_1426260_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ51987.1|1426408_1426876_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	86.5	5.1e-66
AWJ48561.1|1426899_1427124_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ51988.1|1427120_1427339_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	9.9e-12
AWJ48562.1|1427281_1427533_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	94.2	2.7e-29
AWJ48563.1|1427468_1427795_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
AWJ48564.1|1427926_1428127_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
AWJ48565.1|1428168_1428534_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWJ51989.1|1428822_1429386_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
AWJ48566.1|1429382_1431044_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
AWJ48567.1|1431107_1433045_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
AWJ51990.1|1433089_1433311_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AWJ48568.1|1433256_1435842_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.2	0.0e+00
AWJ48569.1|1435838_1436165_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
AWJ48570.1|1436175_1436526_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
AWJ48571.1|1436522_1436969_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
AWJ48572.1|1436965_1437310_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
AWJ48573.1|1437376_1438093_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
AWJ48574.1|1438107_1438482_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
AWJ48575.1|1438505_1438787_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	1.0e-45
AWJ48576.1|1438835_1442078_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
AWJ48577.1|1442070_1442412_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	80.4	4.9e-50
AWJ51991.1|1442619_1443774_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	66.7	1.1e-138
AWJ48578.1|1443984_1444683_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
AWJ48579.1|1444693_1445437_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	3.8e-148
AWJ48580.1|1445334_1446015_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.0	7.7e-111
AWJ48581.1|1446924_1450611_+|tail	phage tail protein	tail	S5MW25	Escherichia_phage	87.9	0.0e+00
AWJ48582.1|1450809_1450950_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
AWJ48583.1|1451094_1452363_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
AWJ48584.1|1452431_1453103_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
AWJ48585.1|1453150_1453414_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48586.1|1453510_1454071_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
AWJ48587.1|1454717_1455224_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1454540:1454564	attR	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
AWJ48588.1|1455269_1455770_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AWJ48589.1|1455855_1456035_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48590.1|1456415_1457222_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWJ48591.1|1457221_1458415_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWJ51992.1|1458426_1459785_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
AWJ48592.1|1459788_1461384_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWJ48593.1|1461383_1462946_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AWJ51993.1|1463037_1463082_-	trp operon leader peptide	NA	NA	NA	NA	NA
AWJ48594.1|1463219_1464101_+	phosphatase	NA	NA	NA	NA	NA
AWJ48595.1|1464097_1464718_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWJ48596.1|1464818_1465691_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWJ48597.1|1465730_1466321_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWJ48598.1|1466317_1467076_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
AWJ48599.1|1467295_1468345_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1756739	1815489	5057506	tail,portal,transposase,capsid,terminase,lysis,head	Enterobacteria_phage(39.22%)	75	NA	NA
AWJ48849.1|1756739_1758200_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	8.6e-43
AWJ48850.1|1758288_1759572_-	MFS transporter	NA	NA	NA	NA	NA
AWJ48851.1|1760358_1760592_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWJ48852.1|1760908_1761499_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWJ48853.1|1761596_1762172_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AWJ48854.1|1762171_1765570_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	2.4e-11
AWJ48855.1|1765634_1766234_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
AWJ48856.1|1766301_1769781_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AWJ48857.1|1769841_1770483_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.0e-96
AWJ48858.1|1770380_1771124_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
AWJ48859.1|1771129_1771828_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
AWJ48860.1|1771827_1772157_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWJ48861.1|1774724_1775159_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
AWJ48862.1|1775140_1775563_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
AWJ52005.1|1775578_1776319_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
AWJ48863.1|1776326_1776722_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
AWJ48864.1|1776718_1777297_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
AWJ48865.1|1777308_1777662_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ48866.1|1777673_1778069_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
AWJ48867.1|1778110_1779136_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWJ48868.1|1779191_1779524_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ48869.1|1779533_1780853_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	1.6e-234
AWJ48870.1|1780833_1782435_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
AWJ48871.1|1782431_1782638_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWJ48872.1|1782634_1784560_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ48873.1|1784534_1785080_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
AWJ48874.1|1785219_1785321_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48875.1|1785468_1785702_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AWJ48876.1|1785759_1786170_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AWJ48877.1|1786665_1786938_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48878.1|1786968_1787157_-	cold-shock protein	NA	NA	NA	NA	NA
AWJ48879.1|1787167_1787380_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWJ48880.1|1787742_1788240_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWJ48881.1|1788236_1788770_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWJ48882.1|1788766_1789078_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWJ48883.1|1789082_1789298_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWJ48884.1|1790051_1790267_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AWJ48885.1|1790567_1790780_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AWJ48886.1|1791201_1791954_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AWJ48887.1|1791967_1793017_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.0	6.3e-112
AWJ48888.1|1793018_1793297_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48889.1|1793363_1793615_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48890.1|1793831_1793987_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWJ48891.1|1794058_1794346_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWJ48892.1|1794345_1794585_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWJ48893.1|1794609_1794915_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48894.1|1795117_1795450_+	protein flxA	NA	NA	NA	NA	NA
AWJ48895.1|1795719_1795842_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AWJ48896.1|1795886_1797200_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ48897.1|1797377_1797560_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AWJ48898.1|1797534_1797714_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48899.1|1798866_1799223_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AWJ48900.1|1799219_1799642_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AWJ48901.1|1799682_1800702_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.4e-55
AWJ48902.1|1800628_1801150_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48903.1|1801133_1801364_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AWJ48904.1|1801447_1801855_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AWJ48905.1|1802021_1802177_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWJ48906.1|1802136_1802307_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48907.1|1802336_1802555_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ48908.1|1803122_1803311_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ48909.1|1803307_1803499_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ48910.1|1803591_1806063_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	7.2e-58
AWJ48911.1|1806135_1806387_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWJ48912.1|1806406_1807702_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AWJ48913.1|1807721_1807832_-	transporter	NA	NA	NA	NA	NA
AWJ48914.1|1807889_1808909_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
AWJ48915.1|1808920_1810135_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ48916.1|1810115_1810304_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48917.1|1810340_1810667_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWJ48918.1|1810801_1811143_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWJ48919.1|1811177_1811738_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWJ52006.1|1811740_1812451_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWJ48920.1|1812558_1812864_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWJ48921.1|1813062_1815489_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
>prophage 6
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	1826953	1839651	5057506	tail,protease,portal,capsid,terminase,head	uncultured_Caudovirales_phage(100.0%)	19	NA	NA
AWJ48931.1|1826953_1827775_+|protease	serine protease	protease	NA	NA	NA	NA
AWJ48932.1|1827813_1828143_-	spermidine export protein MdtI	NA	NA	NA	NA	NA
AWJ48933.1|1828129_1828495_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AWJ48934.1|1828601_1828772_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48935.1|1829858_1830140_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48936.1|1830153_1831815_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
AWJ48937.1|1831798_1832155_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AWJ52009.1|1832278_1832452_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48938.1|1832444_1832885_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
AWJ48939.1|1832884_1833181_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
AWJ48940.1|1833177_1833516_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
AWJ48941.1|1833512_1834724_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AWJ48942.1|1834725_1835298_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
AWJ48943.1|1835337_1836495_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	1.1e-136
AWJ48944.1|1836782_1837055_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ48945.1|1837065_1837476_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ48946.1|1837485_1837791_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52010.1|1837787_1838039_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ48947.1|1838241_1839651_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.9	3.4e-113
>prophage 7
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2231757	2279042	5057506	tail,plate,holin,transposase,portal,capsid,terminase,integrase,head	Escherichia_phage(24.24%)	64	2235113:2235172	2279112:2279188
AWJ49344.1|2231757_2232738_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
AWJ49345.1|2233036_2233687_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AWJ49346.1|2234029_2234560_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
AWJ49347.1|2234582_2234825_+	hypothetical protein	NA	NA	NA	NA	NA
2235113:2235172	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
AWJ49348.1|2235537_2236542_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ49349.1|2236547_2237591_-	late control protein	NA	R9TNM7	Vibrio_phage	28.7	9.9e-33
AWJ49350.1|2237594_2237807_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ49351.1|2237805_2238066_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.9e-06
AWJ52025.1|2238044_2238434_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	39.5	1.5e-15
AWJ49352.1|2238469_2240110_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
AWJ49353.1|2240218_2240500_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWJ49354.1|2240512_2241025_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ49355.1|2241042_2242536_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	34.1	3.8e-70
AWJ49356.1|2243726_2244353_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.5	3.1e-26
AWJ49357.1|2244355_2245276_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
AWJ49358.1|2245272_2245614_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.8e-20
AWJ49359.1|2245616_2246519_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AWJ49360.1|2246499_2247036_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49361.1|2247032_2247713_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49362.1|2247744_2248125_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49363.1|2248121_2248529_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWJ49364.1|2248559_2249594_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	57.4	9.2e-108
AWJ49365.1|2249655_2249985_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
AWJ49366.1|2249984_2251295_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
AWJ49367.1|2251294_2252866_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.5	6.6e-190
AWJ49368.1|2252862_2253096_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49369.1|2253092_2254958_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
AWJ49370.1|2254944_2255511_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
AWJ52026.1|2255883_2256129_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49371.1|2256735_2257014_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49372.1|2257152_2257347_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49373.1|2257354_2257834_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
AWJ49374.1|2257820_2258105_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.0e-08
AWJ49375.1|2258104_2258488_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49376.1|2258600_2259272_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.4	7.8e-15
AWJ49377.1|2259271_2259565_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
AWJ49378.1|2259561_2260158_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.6	1.4e-71
AWJ49379.1|2260234_2260414_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ52027.1|2260565_2261207_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49380.1|2261325_2261604_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49381.1|2262171_2262660_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AWJ49382.1|2262669_2263275_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49383.1|2263384_2263789_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49384.1|2264109_2264775_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49385.1|2264979_2265177_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49386.1|2265803_2266727_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AWJ49387.1|2266904_2267699_-	hypothetical protein	NA	A0A088CD42	Shigella_phage	74.6	2.8e-48
AWJ49388.1|2267971_2268193_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49389.1|2268380_2268605_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49390.1|2268601_2268835_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49391.1|2268834_2269236_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49392.1|2269274_2270666_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	45.6	1.2e-102
AWJ49393.1|2270662_2271727_-	replication protein RepO	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
AWJ49394.1|2271729_2271954_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
AWJ49395.1|2271993_2272470_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	5.5e-23
AWJ49396.1|2272528_2272759_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	61.8	4.2e-21
AWJ49397.1|2272857_2273271_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AWJ49398.1|2274267_2274588_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49399.1|2274618_2276841_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.4	1.1e-92
AWJ49400.1|2276837_2277407_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	50.3	3.6e-37
AWJ49401.1|2277406_2277589_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49402.1|2277638_2277833_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	60.3	2.6e-11
AWJ49403.1|2277798_2278014_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	67.6	1.0e-21
AWJ49404.1|2278013_2279042_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	55.4	5.6e-97
2279112:2279188	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 8
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2322578	2331730	5057506		Acanthocystis_turfacea_Chlorella_virus(28.57%)	8	NA	NA
AWJ49440.1|2322578_2323745_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.2e-110
AWJ49441.1|2323992_2325399_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.8e-37
AWJ49442.1|2325562_2326933_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.8	2.2e-32
AWJ49443.1|2326957_2327704_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.4	3.5e-08
AWJ49444.1|2327769_2329173_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	6.3e-51
AWJ49445.1|2329184_2329640_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWJ49446.1|2329642_2330608_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	52.4	3.1e-89
AWJ49447.1|2330611_2331730_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	63.3	1.4e-130
>prophage 9
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	2391689	2492031	5057506	tail,holin,protease,portal,capsid,terminase,lysis,head,tRNA	Enterobacteria_phage(40.91%)	106	NA	NA
AWJ49495.1|2391689_2393051_+|protease	protease	protease	Q6DW11	Phage_TP	100.0	1.1e-217
AWJ49496.1|2393243_2393393_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49497.1|2393380_2393698_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49498.1|2394112_2395012_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AWJ49499.1|2395093_2395873_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWJ49500.1|2395972_2397013_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AWJ49501.1|2397060_2398416_-	galactitol permease IIC component	NA	NA	NA	NA	NA
AWJ49502.1|2398419_2398704_-	galactitol-specific phosphotransferase enzyme IIB component	NA	NA	NA	NA	NA
AWJ49503.1|2398734_2399187_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AWJ49504.1|2399196_2400459_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
AWJ49505.1|2400487_2401342_-	tagatose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AWJ49506.1|2401649_2402702_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWJ49507.1|2402958_2404236_+	MFS transporter	NA	NA	NA	NA	NA
AWJ49508.1|2404232_2405237_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
AWJ49509.1|2405233_2406199_+	sugar kinase	NA	NA	NA	NA	NA
AWJ49510.1|2406172_2406919_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ49511.1|2406970_2407789_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
AWJ49512.1|2407853_2408654_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWJ49513.1|2408650_2409439_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWJ49514.1|2409661_2409934_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ49515.1|2410054_2410879_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWJ49516.1|2411097_2411436_+	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AWJ49517.1|2411517_2412552_-	adhesin	NA	NA	NA	NA	NA
AWJ49518.1|2412565_2415046_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AWJ49519.1|2415061_2415736_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AWJ49520.1|2415815_2416358_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49521.1|2416650_2416932_-	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AWJ49522.1|2417194_2418304_-	protein mrp	NA	NA	NA	NA	NA
AWJ49523.1|2418435_2420469_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
AWJ49524.1|2420609_2424404_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AWJ49525.1|2424413_2428046_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AWJ49526.1|2428106_2428427_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49527.1|2429609_2430698_+	MoxR family ATPase	NA	NA	NA	NA	NA
AWJ49528.1|2430708_2432988_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49529.1|2432980_2434117_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
AWJ49530.1|2434113_2436114_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AWJ49531.1|2436238_2436700_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWJ49532.1|2436740_2437211_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWJ49533.1|2437257_2437977_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ49534.1|2437973_2439659_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ49535.1|2440173_2440422_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
AWJ52035.1|2440691_2441366_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
AWJ49536.1|2441377_2441590_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ49537.1|2441599_2443312_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	5.9e-67
AWJ49538.1|2443456_2443597_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
AWJ49539.1|2443795_2447482_-|tail	phage tail protein	tail	S5MW25	Escherichia_phage	87.1	0.0e+00
AWJ49540.1|2448390_2449071_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.9	1.8e-107
AWJ49541.1|2448968_2449712_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	1.5e-144
AWJ49542.1|2449722_2450421_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
AWJ49543.1|2450420_2450750_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
AWJ49544.1|2450746_2453326_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	78.6	0.0e+00
AWJ49545.1|2453306_2453720_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
AWJ49546.1|2453746_2454178_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
AWJ49547.1|2454193_2454943_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
AWJ49548.1|2454950_2455346_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
AWJ49549.1|2455342_2455918_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
AWJ49550.1|2455933_2456287_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
AWJ49551.1|2456279_2456663_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
AWJ49552.1|2456714_2457743_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
AWJ49553.1|2457800_2458148_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
AWJ49554.1|2458183_2459689_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
AWJ49555.1|2459678_2461271_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
AWJ49556.1|2461267_2461474_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ49557.1|2461457_2463428_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	3.1e-261
AWJ49558.1|2463357_2463906_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
AWJ52036.1|2463995_2464190_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49559.1|2464568_2465111_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	98.9	4.1e-99
AWJ52037.1|2465313_2465751_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
AWJ49560.1|2465902_2466475_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
AWJ49561.1|2466749_2467283_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	6.2e-100
AWJ49562.1|2467417_2467705_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49563.1|2467793_2468585_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AWJ49564.1|2468588_2468804_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
AWJ49565.1|2468995_2469184_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49566.1|2469298_2471263_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.5	1.2e-294
AWJ49567.1|2471506_2471830_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	99.1	5.9e-61
AWJ49568.1|2472127_2472397_-	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
AWJ49569.1|2472408_2473368_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
AWJ49570.1|2473750_2474809_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.0	2.1e-192
AWJ49571.1|2474959_2475157_-	TrmB family transcriptional regulator	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
AWJ49572.1|2475391_2476009_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ49573.1|2476075_2476468_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
AWJ49574.1|2476485_2477475_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	2.0e-192
AWJ49575.1|2477527_2477785_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
AWJ49576.1|2477781_2479182_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	4.1e-244
AWJ49577.1|2479178_2480057_-	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
AWJ49578.1|2480067_2480994_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	92.9	9.6e-157
AWJ49579.1|2480990_2481215_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
AWJ49580.1|2481211_2482075_-	peptidase	NA	S5MQL6	Escherichia_phage	82.5	8.8e-128
AWJ49581.1|2482052_2482232_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	86.4	1.7e-25
AWJ49582.1|2482251_2482959_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	81.6	3.8e-105
AWJ49583.1|2483040_2483274_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
AWJ49584.1|2483430_2484120_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
AWJ49585.1|2484267_2484960_+	transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
AWJ49586.1|2484965_2485166_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49587.1|2485363_2485546_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
AWJ49588.1|2485551_2486124_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
AWJ49589.1|2486308_2486497_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49590.1|2486493_2487321_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.9	4.8e-131
AWJ49591.1|2487361_2487733_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	4.7e-62
AWJ49592.1|2487924_2488179_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AWJ49593.1|2488212_2489499_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
AWJ49594.1|2489534_2490221_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
AWJ49595.1|2490280_2490388_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ49596.1|2490368_2491100_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWJ49597.1|2491104_2492031_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	3028047	3035811	5057506	integrase,transposase	Escherichia_phage(66.67%)	6	3025835:3025848	3032948:3032961
3025835:3025848	attL	CGACTATTTGAACT	NA	NA	NA	NA
AWJ50075.1|3028047_3028530_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ52055.1|3029272_3030502_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	1.7e-233
AWJ50076.1|3030540_3030957_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWJ50077.1|3031028_3032777_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
AWJ50078.1|3032778_3034497_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
3032948:3032961	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
AWJ50079.1|3034648_3035811_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	6.8e-51
>prophage 11
CP028122	Escherichia coli O43 str. RM10042 chromosome, complete genome	5057506	3105911	3113051	5057506		Escherichia_phage(83.33%)	6	NA	NA
AWJ50148.1|3105911_3108473_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AWJ50149.1|3108578_3109235_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AWJ50150.1|3109285_3110053_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ50151.1|3110248_3111157_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ50152.1|3111153_3112416_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
AWJ50153.1|3112412_3113051_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	0	16397	109466	transposase,protease	Stx2-converting_phage(37.5%)	13	NA	NA
AWJ47135.1|1033_1330_-	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
AWJ47136.1|1357_1549_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47137.1|1558_1924_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47138.1|1934_2126_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	2.7e-05
AWJ47139.1|2430_4860_-|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	49.6	3.2e-207
AWJ47140.1|4820_6596_-	peptidase	NA	Q9LA58	Enterobacterial_phage	43.4	1.1e-105
AWJ47221.1|8621_9923_+	hypothetical protein	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.7e-05
AWJ47141.1|11008_11215_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47142.1|11153_13241_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	3.1e-09
AWJ47143.1|13501_13924_-	entry exclusion protein 2	NA	NA	NA	NA	NA
AWJ47144.1|14108_15623_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.7	2.8e-286
AWJ47145.1|15672_16020_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ47222.1|16016_16397_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
>prophage 2
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	21945	28732	109466		Moraxella_phage(25.0%)	7	NA	NA
AWJ47150.1|21945_22398_+	thermonuclease	NA	A0A0R6PHV6	Moraxella_phage	31.1	2.4e-12
AWJ47151.1|24600_26739_+	transporter	NA	Q9LA58	Enterobacterial_phage	48.5	1.1e-163
AWJ47152.1|27043_27235_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	41.3	2.7e-05
AWJ47153.1|27245_27611_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47154.1|27620_27812_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ47155.1|27839_28151_+	flagellar biosynthesis protein FlgM	NA	NA	NA	NA	NA
AWJ47156.1|28306_28732_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	54.5	1.7e-28
>prophage 3
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	36251	38846	109466	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
AWJ47161.1|36251_36926_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	6.2e-12
AWJ47162.1|36922_37270_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	7.8e-43
AWJ47163.1|37289_38846_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.7	9.8e-162
>prophage 4
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	59772	63307	109466	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
AWJ47175.1|59772_60234_-	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	35.1	8.0e-19
AWJ47176.1|61018_62533_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.7	2.8e-286
AWJ47177.1|62582_62930_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ47225.1|62926_63307_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	2.7e-65
>prophage 5
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	72676	80481	109466	integrase	Cronobacter_phage(25.0%)	13	66290:66303	82359:82372
66290:66303	attL	TTCCTGCATCGTGA	NA	NA	NA	NA
AWJ47190.1|72676_73360_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
AWJ47191.1|73436_73742_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47226.1|73745_74648_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWJ47228.1|74685_74955_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ47227.1|75066_75315_+	protein ImpC	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
AWJ47192.1|75311_75749_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
AWJ47193.1|75748_76741_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
AWJ47194.1|76770_77019_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
AWJ47195.1|77023_77452_-	plasmid stability protein	NA	NA	NA	NA	NA
AWJ47196.1|77420_78392_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
AWJ47197.1|78620_79265_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
AWJ47198.1|79258_79534_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWJ47199.1|79671_80481_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
82359:82372	attR	TCACGATGCAGGAA	NA	NA	NA	NA
>prophage 6
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	85593	86571	109466		Salmonella_phage(100.0%)	1	NA	NA
AWJ47207.1|85593_86571_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	64.5	5.5e-102
>prophage 7
CP028121	Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence	109466	106671	109061	109466	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
AWJ47217.1|106671_108264_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.0	3.6e-175
AWJ47218.1|108294_108645_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
AWJ47219.1|108641_109061_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	87.6	6.1e-42
