The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	601768	670639	5648177	tail,transposase,lysis,integrase,tRNA,head,terminase,protease,capsid,portal	Enterobacteria_phage(57.89%)	83	611929:611975	662113:662159
AWJ36761.1|601768_603154_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWJ36762.1|603189_603711_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ36763.1|603818_604031_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ36764.1|604032_604899_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ36765.1|605379_605922_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ36766.1|606141_606834_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWJ36767.1|606864_609474_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ36768.1|609452_610493_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ36769.1|610503_611019_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ36770.1|611021_611654_-	DNA-binding response regulator	NA	NA	NA	NA	NA
611929:611975	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ36771.1|611988_613152_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AWJ36772.1|613007_613379_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWJ36773.1|613350_613629_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWJ36774.1|613676_613895_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
AWJ36775.1|613993_614275_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AWJ36776.1|614285_614477_-	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AWJ36777.1|614449_614632_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AWJ36778.1|614628_615309_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
AWJ36779.1|615305_616091_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ36780.1|616096_616393_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ36781.1|616468_616675_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.8e-26
AWJ36782.1|617225_617546_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36783.1|617681_617945_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
AWJ36784.1|618026_618782_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWJ36785.1|618820_619051_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWJ36786.1|619120_619660_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
AWJ36787.1|619656_620676_+	Replication protein O	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
AWJ36788.1|620672_621374_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
AWJ36789.1|621578_621926_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36790.1|622678_623287_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
AWJ36791.1|623586_624003_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
AWJ36792.1|623981_624383_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36793.1|624506_624608_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36794.1|624604_625060_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
AWJ36795.1|625059_625230_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWJ36796.1|625222_625513_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
AWJ36797.1|625509_625872_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AWJ36798.1|625868_626009_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AWJ36799.1|626094_626478_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AWJ36800.1|626666_627749_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
AWJ36801.1|628337_628553_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWJ36802.1|628552_629050_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AWJ36803.1|629538_629832_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ36804.1|631502_631697_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ36805.1|631844_631946_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36806.1|632085_632631_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWJ36807.1|632605_634531_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
AWJ36808.1|634527_634734_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWJ36809.1|634730_636332_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
AWJ36810.1|636804_638376_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ36811.1|638395_638743_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ36812.1|638742_639420_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ36813.1|639460_640339_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
AWJ36814.1|640348_640681_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ36815.1|640736_641762_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWJ36816.1|641803_642199_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWJ36817.1|642210_642585_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
AWJ36818.1|642575_643154_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWJ36819.1|643150_643546_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
AWJ41648.1|643553_644294_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWJ36820.1|644309_644732_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWJ36821.1|644713_645148_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWJ36822.1|645140_647702_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
AWJ36823.1|647698_648028_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
AWJ36824.1|648027_648726_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
AWJ36825.1|649411_650044_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
AWJ36826.1|650104_653518_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
AWJ36827.1|653588_654188_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
AWJ41649.1|654252_657213_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
AWJ36828.1|657212_657797_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
AWJ36829.1|657769_657907_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWJ41650.1|657851_658478_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ36830.1|658576_658882_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ36831.1|659065_660550_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ36832.1|660736_661690_-|protease	outer membrane protease	protease	NA	NA	NA	NA
AWJ36833.1|661715_661907_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36834.1|662092_662209_-	hypothetical protein	NA	NA	NA	NA	NA
662113:662159	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AWJ36835.1|662202_662964_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ36836.1|663020_663233_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36837.1|663146_664037_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36838.1|664037_667010_-	phage receptor	NA	NA	NA	NA	NA
AWJ36839.1|666996_669234_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AWJ36840.1|669502_670639_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	890167	940674	5648177	transposase,holin,tail,lysis,integrase,protease,terminase,portal	Enterobacteria_phage(51.61%)	67	907703:907717	939864:939878
AWJ37040.1|890167_891238_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
AWJ37041.1|891215_891434_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWJ37042.1|891540_891885_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
AWJ37043.1|891913_892081_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AWJ37044.1|892153_892438_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
AWJ37045.1|892430_892733_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
AWJ37046.1|892729_893347_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
AWJ37047.1|893348_893906_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
AWJ37048.1|893902_894460_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
AWJ41656.1|894456_894621_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
AWJ37049.1|894631_894925_-	RecBCD nuclease inhibitor	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AWJ37050.1|894948_895332_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
AWJ37051.1|895331_895937_-	recombinase	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
AWJ37052.1|896126_897282_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ37053.1|897460_897613_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
AWJ37054.1|897597_897729_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AWJ37055.1|898155_899369_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ37056.1|901671_902373_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
AWJ37057.1|902369_902660_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ37058.1|902956_903313_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AWJ37059.1|903284_903695_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AWJ37060.1|903691_903868_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWJ37061.1|903870_904269_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.2	2.9e-70
AWJ37062.1|904228_904438_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
AWJ37063.1|904430_905153_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
AWJ37064.1|905152_905443_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
AWJ37065.1|905439_905802_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AWJ37066.1|905798_905987_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWJ37067.1|906198_907158_-	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWJ37068.1|907496_907619_+	YlcG family protein	NA	NA	NA	NA	NA
AWJ37069.1|907633_908323_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
907703:907717	attL	ACGAAAGGCCAGCTC	NA	NA	NA	NA
AWJ37070.1|908534_909251_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37071.1|911936_912098_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37072.1|912096_912312_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ37073.1|912311_912809_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ37074.1|912805_913243_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.2	1.1e-70
AWJ37075.1|913392_914010_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ37076.1|913977_914118_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37077.1|914197_914392_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ37078.1|914787_915297_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
AWJ37079.1|915268_917197_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
AWJ37080.1|917180_917387_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ37081.1|917383_918976_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
AWJ37082.1|918965_919142_+|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	56.4	1.1e-08
AWJ37083.1|919219_919624_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWJ37084.1|919620_919968_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
AWJ37085.1|920016_921555_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ37086.1|921551_921920_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
AWJ37087.1|921927_922680_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
AWJ37088.1|922693_923125_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ37089.1|923151_923565_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
AWJ37090.1|923545_926125_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
AWJ37091.1|926121_926451_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ37092.1|926450_927149_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
AWJ37093.1|927154_927898_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWJ37094.1|927795_928476_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	4.1e-112
AWJ37095.1|928721_932198_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
AWJ37096.1|932265_932865_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
AWJ37097.1|932929_934144_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
AWJ37098.1|934145_934415_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AWJ37099.1|934520_935402_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWJ37100.1|935625_936453_+	cell division protein	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
AWJ37101.1|936576_936948_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWJ37102.1|937422_938994_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ37103.1|939013_939361_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ37104.1|939360_940038_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
939864:939878	attR	ACGAAAGGCCAGCTC	NA	NA	NA	NA
AWJ37105.1|940098_940674_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 3
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1155779	1293594	5648177	transposase,holin,tail,lysis,integrase,head,protease,terminase,capsid,portal	Escherichia_phage(35.4%)	171	1208960:1208976	1307022:1307038
AWJ37289.1|1155779_1157540_-|protease	Lon protease	protease	NA	NA	NA	NA
AWJ37290.1|1157725_1158178_+	macrodomain Ter protein	NA	NA	NA	NA	NA
AWJ41663.1|1158252_1159293_-	outer membrane protein A	NA	NA	NA	NA	NA
AWJ37291.1|1159447_1159666_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37292.1|1159649_1160159_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
AWJ37293.1|1160377_1161007_+	protein Sxy	NA	NA	NA	NA	NA
AWJ41664.1|1160969_1163123_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AWJ37294.1|1163141_1163588_-	YccF domain-containing protein	NA	NA	NA	NA	NA
AWJ37295.1|1163710_1165765_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
AWJ37296.1|1165796_1166255_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AWJ37297.1|1166350_1167013_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AWJ37298.1|1167185_1167599_+	CoA-binding protein	NA	NA	NA	NA	NA
AWJ37299.1|1167643_1167961_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
AWJ37300.1|1168018_1169209_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AWJ37301.1|1169303_1169582_+	acylphosphatase	NA	NA	NA	NA	NA
AWJ37302.1|1169578_1169908_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
AWJ37303.1|1169998_1170658_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
AWJ37304.1|1171066_1172086_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWJ37305.1|1172063_1172306_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ37306.1|1172373_1174824_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
AWJ37307.1|1174917_1175109_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ37308.1|1175105_1175294_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ41665.1|1175861_1176071_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ41666.1|1176071_1176710_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
AWJ37309.1|1176721_1176874_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AWJ37310.1|1177150_1177438_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ37311.1|1177437_1177629_-	antitoxin	NA	NA	NA	NA	NA
AWJ37312.1|1177656_1178058_-	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AWJ37313.1|1178166_1178439_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AWJ37314.1|1178422_1178848_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37315.1|1179054_1179510_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37316.1|1179588_1180704_+	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
AWJ37317.1|1180710_1181457_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
AWJ37318.1|1181478_1182249_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AWJ37319.1|1182264_1182678_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AWJ37320.1|1183268_1184482_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AWJ37321.1|1185662_1185875_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AWJ37322.1|1186042_1186321_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ37323.1|1186322_1187372_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
AWJ37324.1|1187384_1187756_+	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWJ37325.1|1187745_1188117_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
AWJ37326.1|1188268_1189087_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWJ37327.1|1189373_1189571_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
AWJ37328.1|1189708_1190422_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37329.1|1190868_1191072_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWJ37330.1|1191189_1193040_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWJ37331.1|1193318_1193480_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37332.1|1193478_1193694_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWJ37333.1|1193656_1194001_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37334.1|1193949_1194186_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37335.1|1194154_1194337_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37336.1|1194381_1194915_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AWJ37337.1|1195135_1195249_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AWJ37338.1|1195250_1195718_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWJ37339.1|1195800_1195941_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37340.1|1196182_1196497_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37341.1|1196578_1196803_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWJ37342.1|1197199_1197745_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ37343.1|1197719_1199645_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ37344.1|1199641_1199848_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ37345.1|1199844_1201446_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
AWJ37346.1|1201426_1202746_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ37347.1|1202755_1203088_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ37348.1|1203143_1204169_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ37349.1|1204209_1204605_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ37350.1|1204616_1204970_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ37351.1|1204981_1205560_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
AWJ37352.1|1205556_1205952_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ37353.1|1205959_1206712_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AWJ37354.1|1206725_1207148_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ37355.1|1207174_1207588_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
1208960:1208976	attL	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
AWJ37356.1|1210175_1210505_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ37357.1|1210504_1211203_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
AWJ37358.1|1211213_1211957_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
AWJ37359.1|1211854_1212535_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.7e-113
AWJ37360.1|1212780_1216257_+|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	97.9	0.0e+00
AWJ41667.1|1216325_1216949_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	2.3e-69
AWJ37361.1|1218327_1218597_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
AWJ37362.1|1218721_1219474_-	type III effector	NA	NA	NA	NA	NA
AWJ37363.1|1219789_1219972_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
AWJ37364.1|1220277_1220904_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
AWJ37365.1|1220979_1222192_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ37366.1|1222232_1222493_-|integrase	integrase	integrase	NA	NA	NA	NA
AWJ37367.1|1222587_1222830_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ37368.1|1222897_1225348_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
AWJ37369.1|1225442_1225631_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ37370.1|1225627_1225816_-	cell division inhibitor	NA	NA	NA	NA	NA
AWJ37371.1|1226384_1226603_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37372.1|1226674_1226974_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37373.1|1227309_1227612_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
AWJ37374.1|1227614_1227974_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
AWJ37375.1|1228020_1228413_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
AWJ37376.1|1228539_1228800_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
AWJ37377.1|1228796_1229234_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
AWJ41668.1|1230122_1230785_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.2e-78
AWJ37378.1|1230818_1231544_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
AWJ37379.1|1231544_1231952_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
AWJ37380.1|1231948_1232245_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
AWJ37381.1|1232241_1232703_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ37382.1|1232680_1233037_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
AWJ37383.1|1233087_1233300_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
AWJ37384.1|1233333_1233516_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWJ37385.1|1233681_1234317_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
AWJ37386.1|1234404_1234623_+	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
AWJ37387.1|1234624_1234990_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
AWJ37388.1|1234986_1235331_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
AWJ37389.1|1235535_1235835_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
AWJ37390.1|1235840_1236098_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
AWJ37391.1|1236233_1236506_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
AWJ37392.1|1236507_1237554_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
AWJ37393.1|1237566_1237926_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
AWJ37394.1|1237934_1238465_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWJ37395.1|1238583_1238904_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
AWJ37396.1|1239038_1239752_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37397.1|1240201_1240633_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ37398.1|1240523_1240790_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37399.1|1241110_1243048_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
AWJ37400.1|1243183_1243363_+	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
AWJ37401.1|1243403_1243649_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWJ37402.1|1243726_1243942_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ37403.1|1243946_1244480_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
AWJ37404.1|1244754_1245324_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
AWJ37405.1|1245480_1245948_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
AWJ37406.1|1246030_1246171_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37407.1|1246411_1246726_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37408.1|1246807_1247032_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
AWJ37409.1|1247073_1247439_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	5.4e-63
AWJ37410.1|1247729_1248293_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ37411.1|1248289_1249951_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
AWJ37412.1|1250014_1251952_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
AWJ41669.1|1251996_1252218_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ37413.1|1254743_1255070_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ37414.1|1255080_1255431_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
AWJ37415.1|1255427_1255874_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ37416.1|1255870_1256215_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ37417.1|1256280_1256997_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
AWJ37418.1|1257002_1257377_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AWJ37419.1|1257400_1257682_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
AWJ37420.1|1257729_1260972_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.2	0.0e+00
AWJ37421.1|1260964_1261306_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ37422.1|1261305_1262004_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.1	1.6e-132
AWJ41670.1|1262020_1262341_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AWJ37423.1|1262448_1262622_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AWJ41671.1|1262692_1263616_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
AWJ37424.1|1263670_1264408_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
AWJ37425.1|1264305_1264986_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.3e-114
AWJ37426.1|1265231_1268708_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
AWJ37427.1|1268774_1269374_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
AWJ37428.1|1270751_1271021_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
AWJ37429.1|1271982_1272210_+	hypothetical protein	NA	Q7Y2P9	Escherichia_phage	92.7	2.0e-23
AWJ37430.1|1272413_1272644_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37431.1|1272576_1272750_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AWJ37432.1|1272832_1274161_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
AWJ37433.1|1274181_1274676_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
AWJ37434.1|1274686_1275277_-	nitroreductase family protein	NA	NA	NA	NA	NA
AWJ37435.1|1275286_1276087_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
AWJ37436.1|1276094_1276481_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
AWJ41672.1|1276492_1277185_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
AWJ37437.1|1277184_1278333_-	pyrimidine monooxygenase RutA	NA	NA	NA	NA	NA
AWJ37438.1|1278563_1279202_+	pyrimidine utilization regulatory protein R	NA	NA	NA	NA	NA
AWJ37439.1|1279241_1283204_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ37440.1|1283258_1283468_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37441.1|1283355_1283547_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37442.1|1283626_1285135_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWJ37443.1|1285209_1285467_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37444.1|1285800_1286631_+	ferrous iron permease EfeU	NA	NA	NA	NA	NA
AWJ37445.1|1286688_1287816_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
AWJ37446.1|1287821_1289093_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AWJ37447.1|1289576_1290500_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
AWJ37448.1|1291080_1291767_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWJ37449.1|1292391_1293594_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
1307022:1307038	attR	AAGAGCTGACAGGTAAA	NA	NA	NA	NA
>prophage 4
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1474492	1530989	5648177	transposase,holin,tail,lysis,integrase,head,terminase,protease,capsid	Stx2-converting_phage(29.63%)	73	1469263:1469277	1476611:1476625
1469263:1469277	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AWJ37634.1|1474492_1474960_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
AWJ37635.1|1475036_1476155_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
AWJ37636.1|1476123_1476393_-	excisionase	NA	NA	NA	NA	NA
AWJ37637.1|1476454_1478926_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1476611:1476625	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AWJ37638.1|1479018_1479210_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ37639.1|1479206_1479395_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ37640.1|1479748_1480904_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ37641.1|1481151_1481304_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
AWJ37642.1|1481579_1482227_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
AWJ37643.1|1482321_1482549_+	cell division protein	NA	NA	NA	NA	NA
AWJ37644.1|1482545_1482971_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37645.1|1482981_1483182_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37646.1|1483868_1484531_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	95.4	2.3e-83
AWJ37647.1|1484565_1485264_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
AWJ37648.1|1485285_1485510_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
AWJ37649.1|1485506_1485863_+	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
AWJ37650.1|1485859_1486048_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	45.3	1.7e-07
AWJ37651.1|1486044_1486356_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
AWJ37652.1|1486482_1487046_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
AWJ37653.1|1487155_1487260_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37654.1|1487446_1487659_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
AWJ41688.1|1487826_1488105_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AWJ37655.1|1488106_1489162_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.5e-89
AWJ37656.1|1489162_1489528_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
AWJ37657.1|1489536_1490079_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
AWJ37658.1|1490391_1490589_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AWJ37659.1|1490739_1491789_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
AWJ37660.1|1492260_1492692_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ37661.1|1492582_1492849_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37662.1|1493262_1495113_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AWJ37663.1|1495394_1495610_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AWJ37664.1|1495572_1495917_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37665.1|1495865_1496102_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37666.1|1496070_1496265_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37667.1|1496297_1496831_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
AWJ37668.1|1496908_1497100_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	63.9	7.8e-05
AWJ41689.1|1497257_1497725_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.2e-68
AWJ37669.1|1497748_1497973_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ41690.1|1497969_1498188_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AWJ37670.1|1498329_1498470_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37671.1|1498599_1498785_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
AWJ37672.1|1498826_1499192_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AWJ37673.1|1499481_1500045_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ37674.1|1500041_1501703_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ37675.1|1501766_1503704_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
AWJ41691.1|1503748_1503970_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ37676.1|1506496_1506823_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ37677.1|1506833_1507184_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
AWJ37678.1|1507180_1507627_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ37679.1|1507623_1507968_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ37680.1|1508033_1508750_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
AWJ37681.1|1508755_1509130_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ37682.1|1509153_1509435_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ37683.1|1509482_1512725_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
AWJ37684.1|1512717_1513059_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWJ37685.1|1513058_1513757_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AWJ37686.1|1513767_1514511_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWJ37687.1|1514408_1515089_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.3e-113
AWJ37688.1|1515334_1518808_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
AWJ37689.1|1518874_1519474_+	Ail/Lom family protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
AWJ37690.1|1519538_1520852_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
AWJ37691.1|1520802_1520946_-	copper resistance protein	NA	NA	NA	NA	NA
AWJ37692.1|1520907_1521585_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ37693.1|1521584_1521932_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ37694.1|1521951_1523523_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
AWJ37695.1|1523560_1523830_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
AWJ37696.1|1523946_1524222_-	secretion protein EspO	NA	NA	NA	NA	NA
AWJ37697.1|1524284_1525646_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
AWJ37698.1|1526022_1526175_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
AWJ37699.1|1526770_1527889_+	hydrogenase-1 small chain	NA	NA	NA	NA	NA
AWJ37700.1|1527885_1529679_+	hydrogenase-1 large chain	NA	NA	NA	NA	NA
AWJ37701.1|1529697_1530405_+	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
AWJ37702.1|1530401_1530989_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1561483	1639742	5648177	transposase,holin,tail,lysis,tRNA,head,terminase,capsid	Escherichia_phage(31.76%)	108	NA	NA
AWJ37731.1|1561483_1562794_-	DUF3596 domain-containing protein	NA	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
AWJ37732.1|1562846_1563131_-	DNA-binding protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
AWJ37733.1|1563176_1563428_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
AWJ37734.1|1563415_1563649_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
AWJ37735.1|1563792_1564155_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	96.7	1.7e-56
AWJ37736.1|1564190_1564406_-	DUF1382 domain-containing protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
AWJ37737.1|1564338_1565250_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
AWJ41694.1|1565246_1565534_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	100.0	9.5e-55
AWJ41695.1|1565763_1565961_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
AWJ37738.1|1565966_1566425_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
AWJ37739.1|1566427_1566619_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
AWJ37740.1|1566620_1567028_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
AWJ37741.1|1567024_1567654_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
AWJ37742.1|1567650_1567815_-	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
AWJ37743.1|1567825_1568122_-	RecBCD nuclease inhibitor	NA	G9L665	Escherichia_phage	98.0	2.3e-48
AWJ37744.1|1568145_1568733_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
AWJ37745.1|1568729_1569410_-	ATP-binding protein	NA	G9L667	Escherichia_phage	100.0	3.4e-127
AWJ37746.1|1569418_1569607_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AWJ37747.1|1569603_1569843_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.6e-37
AWJ37748.1|1570043_1570514_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AWJ37749.1|1570572_1570956_-	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AWJ37750.1|1571463_1571868_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
AWJ37751.1|1571864_1572521_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
AWJ37752.1|1572517_1572805_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
AWJ37753.1|1572941_1573646_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AWJ37754.1|1573759_1573993_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
AWJ37755.1|1574131_1574428_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
AWJ37756.1|1575394_1576096_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
AWJ37757.1|1576092_1576383_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
AWJ37758.1|1576453_1576732_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
AWJ37759.1|1576864_1577080_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
AWJ37760.1|1577090_1577327_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
AWJ37761.1|1577283_1577730_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
AWJ37762.1|1577726_1578254_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AWJ37763.1|1578250_1578433_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AWJ37764.1|1578707_1579442_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
AWJ37765.1|1579516_1580239_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
AWJ37766.1|1580238_1580844_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
AWJ37767.1|1580840_1581035_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
AWJ37768.1|1581353_1582509_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ37769.1|1582537_1582729_+	Q protein	NA	Q777W5	Enterobacteria_phage	93.7	4.3e-27
AWJ37770.1|1582717_1582963_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
AWJ37771.1|1583235_1584183_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
AWJ37772.1|1584192_1584462_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWJ37773.1|1584612_1584840_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
AWJ37774.1|1584961_1586899_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
AWJ37775.1|1587034_1587214_+	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ37776.1|1587254_1587527_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
AWJ37777.1|1587603_1587819_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AWJ37778.1|1587823_1588168_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ37779.1|1588218_1588752_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
AWJ37780.1|1589022_1589592_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ37781.1|1589745_1590213_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	100.0	6.9e-79
AWJ37782.1|1590575_1590803_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
AWJ37783.1|1590844_1591210_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
AWJ37784.1|1591499_1592063_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ37785.1|1592059_1593721_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ37786.1|1593784_1595722_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
AWJ41696.1|1595766_1595988_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ37787.1|1598514_1598841_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ37788.1|1598851_1599202_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
AWJ37789.1|1599198_1599645_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ37790.1|1599641_1599986_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ37791.1|1600051_1600768_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
AWJ37792.1|1600773_1601148_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
AWJ37793.1|1601171_1601453_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ37794.1|1601500_1604743_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
AWJ37795.1|1604735_1605077_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWJ37796.1|1605784_1606528_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
AWJ37797.1|1606425_1607106_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.3e-113
AWJ41697.1|1610895_1611519_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
AWJ37798.1|1611584_1612898_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
AWJ37799.1|1612899_1613169_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
AWJ37800.1|1613348_1613858_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
AWJ37801.1|1614148_1614730_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
AWJ37802.1|1614797_1615433_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
AWJ37803.1|1615560_1616619_-	type III effector	NA	NA	NA	NA	NA
AWJ37804.1|1616693_1617344_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AWJ37805.1|1617526_1618117_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWJ37806.1|1618390_1619254_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWJ37807.1|1619237_1620374_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
AWJ41698.1|1620352_1620568_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37808.1|1620623_1621853_+	peptidase T	NA	NA	NA	NA	NA
AWJ37809.1|1621998_1623120_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWJ37810.1|1623368_1624598_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
AWJ37811.1|1624963_1625152_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AWJ37812.1|1625209_1626238_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AWJ37813.1|1626227_1626692_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37814.1|1626684_1626918_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37815.1|1626923_1627223_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWJ37816.1|1627219_1628620_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
AWJ37817.1|1628820_1629072_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37818.1|1629068_1629479_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ37819.1|1629489_1629762_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ37820.1|1629718_1629847_+	trigger factor	NA	NA	NA	NA	NA
AWJ37821.1|1629888_1630113_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37822.1|1630364_1630571_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37823.1|1630570_1631626_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
AWJ37824.1|1631638_1631974_+|head	head decoration protein	head	NA	NA	NA	NA
AWJ37825.1|1631986_1632400_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AWJ37826.1|1632604_1633147_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
AWJ37827.1|1633126_1633351_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ37828.1|1633402_1633684_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37829.1|1634285_1635746_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AWJ37830.1|1635745_1636417_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWJ37831.1|1636584_1637955_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWJ41699.1|1637958_1638600_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWJ37832.1|1638635_1639742_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1752290	1766504	5648177	holin,transposase,tail	Escherichia_phage(42.86%)	19	NA	NA
AWJ37945.1|1752290_1752956_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWJ37946.1|1754582_1755341_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWJ37947.1|1755619_1755832_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWJ37948.1|1756052_1756310_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37949.1|1756379_1756658_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
AWJ37950.1|1756659_1757715_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
AWJ37951.1|1757715_1758081_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWJ37952.1|1758077_1758767_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWJ37953.1|1758797_1758944_+	antiterminator	NA	NA	NA	NA	NA
AWJ37954.1|1759703_1759970_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37955.1|1760114_1760243_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ37956.1|1760291_1762145_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
AWJ37957.1|1762294_1762510_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWJ37958.1|1762514_1762859_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWJ37959.1|1762909_1763443_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
AWJ37960.1|1763713_1764232_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
AWJ37961.1|1764288_1765444_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ37962.1|1765547_1765817_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
AWJ37963.1|1765961_1766504_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
>prophage 7
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	1868767	1924958	5648177	transposase,holin,tail,lysis,tRNA,head,terminase,capsid,portal	Escherichia_phage(43.94%)	75	NA	NA
AWJ41714.1|1868767_1870000_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AWJ38060.1|1870254_1871238_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWJ38061.1|1871512_1871686_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38062.1|1871715_1873089_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWJ38063.1|1873217_1874153_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AWJ38064.1|1874204_1875440_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
AWJ38065.1|1875441_1875657_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWJ41716.1|1875756_1875945_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWJ41715.1|1875982_1876132_-	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWJ38066.1|1876187_1876997_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWJ38067.1|1876989_1879590_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	2.6e-247
AWJ38068.1|1879691_1879967_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AWJ41717.1|1880041_1880212_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWJ38069.1|1880211_1880433_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWJ41718.1|1880853_1881006_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
AWJ38070.1|1881064_1881268_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38071.1|1881304_1881724_-	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AWJ38072.1|1881803_1882058_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWJ38073.1|1882054_1882477_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
AWJ41719.1|1882540_1883020_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
AWJ38074.1|1883022_1884236_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ38075.1|1884666_1885413_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
AWJ38076.1|1885384_1886197_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.1e-119
AWJ38077.1|1886212_1886635_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
AWJ38078.1|1886631_1886928_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
AWJ38079.1|1886924_1887386_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ38080.1|1887363_1887720_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWJ38081.1|1887770_1887983_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ38082.1|1888068_1888233_+	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ38083.1|1888234_1888498_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ38084.1|1888508_1889378_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWJ38085.1|1889493_1889598_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38086.1|1889787_1890000_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
AWJ38087.1|1890446_1891496_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
AWJ38088.1|1891508_1891883_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
AWJ38089.1|1891879_1892701_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ38090.1|1893190_1893457_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38091.1|1893870_1895721_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWJ38092.1|1895999_1896161_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38093.1|1896159_1896375_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ38094.1|1896374_1896872_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ38095.1|1896868_1897306_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ38096.1|1897455_1898073_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ38097.1|1898040_1898181_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38098.1|1898260_1898455_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ38099.1|1898602_1898704_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38100.1|1898843_1899389_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ38101.1|1899363_1901289_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ38102.1|1901285_1901492_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ38103.1|1901488_1903090_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
AWJ38104.1|1903070_1904390_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ38105.1|1904399_1904732_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ38106.1|1904787_1905813_+|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ38107.1|1905854_1906250_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ38108.1|1906261_1906615_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ38109.1|1906626_1907205_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
AWJ38110.1|1907201_1907597_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ38111.1|1907604_1908357_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
AWJ38112.1|1908370_1908802_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ38113.1|1908828_1909242_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
AWJ38114.1|1909222_1911802_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
AWJ38115.1|1911798_1912128_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ38116.1|1912127_1912826_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
AWJ38117.1|1912836_1913580_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
AWJ38118.1|1913477_1914158_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	91.6	1.1e-104
AWJ38119.1|1914403_1917880_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AWJ38120.1|1917947_1918547_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
AWJ38121.1|1918611_1919925_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
AWJ38122.1|1919887_1920196_+|tail	phage tail protein	tail	B6ETG7	Enterobacteria_phage	96.1	9.9e-50
AWJ38123.1|1920308_1920884_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
AWJ38124.1|1920956_1921586_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWJ38125.1|1921667_1922309_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWJ38126.1|1922339_1922507_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AWJ38127.1|1923249_1923684_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWJ38128.1|1923824_1924958_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 8
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2126500	2226097	5648177	tail,transposase,holin,lysis,head,terminase,capsid,portal	Enterobacteria_phage(46.88%)	130	NA	NA
AWJ38293.1|2126500_2126734_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWJ38294.1|2127050_2127641_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
AWJ38295.1|2127738_2128314_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AWJ38296.1|2128313_2131274_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
AWJ38297.1|2131338_2131938_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
AWJ38298.1|2132008_2135422_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
AWJ38299.1|2135482_2136130_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AWJ38300.1|2136027_2136771_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
AWJ38301.1|2136775_2137474_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
AWJ38302.1|2137483_2137813_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
AWJ38303.1|2137812_2140878_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
AWJ38304.1|2140849_2141179_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AWJ41727.1|2141187_2141574_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
AWJ38305.1|2141634_2142378_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
AWJ41728.1|2142388_2142790_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AWJ38306.1|2142786_2143365_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
AWJ38307.1|2143376_2143652_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
AWJ38308.1|2143644_2144013_-	DUF2190 domain-containing protein	NA	K7PLV6	Enterobacteria_phage	98.1	6.3e-51
AWJ38309.1|2144054_2146082_-	peptidase S14	NA	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AWJ38310.1|2146026_2147535_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
AWJ38311.1|2147534_2147747_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWJ38312.1|2147743_2149843_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
AWJ38313.1|2149851_2150391_-	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AWJ38314.1|2150951_2151158_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
AWJ38315.1|2151312_2151513_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	68.0	2.9e-10
AWJ38316.1|2151458_2151869_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
AWJ41729.1|2152020_2152194_-	protein GnsB	NA	NA	NA	NA	NA
AWJ38317.1|2152365_2152638_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38318.1|2152668_2152857_-	cold-shock protein	NA	NA	NA	NA	NA
AWJ38319.1|2152867_2153080_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWJ38320.1|2153442_2153940_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWJ38321.1|2153936_2154470_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWJ38322.1|2154466_2154778_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWJ38323.1|2154782_2154998_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWJ38324.1|2155751_2155967_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
AWJ38325.1|2156267_2156480_+	cold-shock protein	NA	NA	NA	NA	NA
AWJ38326.1|2156901_2157654_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
AWJ38327.1|2157667_2158717_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AWJ38328.1|2158718_2158997_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38329.1|2159063_2159315_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38330.1|2159531_2159687_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWJ38331.1|2159758_2160046_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWJ38332.1|2160045_2160285_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWJ38333.1|2160309_2160615_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38334.1|2160817_2161150_+	protein flxA	NA	NA	NA	NA	NA
AWJ38335.1|2161586_2162927_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWJ38336.1|2162960_2163380_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
AWJ38337.1|2163420_2164440_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.8e-55
AWJ38338.1|2164366_2164888_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38339.1|2164871_2165099_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ38340.1|2165125_2165584_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AWJ38341.1|2165776_2165932_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AWJ38342.1|2165891_2166509_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38343.1|2166995_2167184_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ38344.1|2167180_2167372_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ38345.1|2167465_2169937_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AWJ38346.1|2170132_2171704_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ38347.1|2171723_2172071_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ38348.1|2172070_2172748_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ38349.1|2174063_2175220_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ41730.1|2175655_2175970_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
AWJ38350.1|2176340_2177327_-	peptidase M85	NA	NA	NA	NA	NA
AWJ38351.1|2177355_2177547_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38352.1|2177756_2178026_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
AWJ38353.1|2178027_2179341_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
AWJ41731.1|2179405_2180029_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
AWJ38354.1|2180097_2183574_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
AWJ38355.1|2183819_2184500_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	96.0	2.7e-116
AWJ38356.1|2184397_2185141_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
AWJ38357.1|2185151_2185850_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ38358.1|2185849_2186179_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ38359.1|2186175_2188788_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
AWJ38360.1|2188768_2189182_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ38361.1|2189208_2189631_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ38362.1|2189644_2190397_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
AWJ38363.1|2190795_2191329_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
AWJ38364.1|2191343_2191697_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
AWJ38365.1|2191708_2192104_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
AWJ38366.1|2192145_2193171_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ38367.1|2193226_2193559_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWJ38368.1|2193568_2194888_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
AWJ38369.1|2194868_2196470_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
AWJ38370.1|2196466_2196673_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ38371.1|2196669_2198595_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
AWJ38372.1|2198569_2199115_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
AWJ38373.1|2199228_2199486_+	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	97.1	5.8e-11
AWJ38374.1|2199501_2199726_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
AWJ38375.1|2199807_2200122_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ38376.1|2200364_2200505_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38377.1|2200587_2201055_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	87.7	1.6e-67
AWJ38378.1|2201386_2201920_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
AWJ38379.1|2202431_2203223_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
AWJ38380.1|2203226_2203442_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWJ38381.1|2203440_2203602_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38382.1|2203880_2205731_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AWJ38383.1|2205779_2205908_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38384.1|2206052_2206319_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38385.1|2206209_2206641_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
AWJ38386.1|2206830_2207040_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
AWJ38387.1|2207092_2207317_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38388.1|2208161_2208914_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
AWJ38389.1|2208927_2209977_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
AWJ38390.1|2209978_2210248_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
AWJ38391.1|2210301_2210529_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38392.1|2210752_2211124_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ38393.1|2211116_2211434_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ38394.1|2211536_2211749_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AWJ38395.1|2211793_2211967_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
AWJ38396.1|2211963_2212515_-	hypothetical protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
AWJ38397.1|2212866_2213052_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38398.1|2213111_2213873_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
AWJ38399.1|2213902_2214643_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
AWJ38400.1|2214649_2215615_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
AWJ38401.1|2215595_2216117_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38402.1|2216100_2216331_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ38403.1|2216414_2216822_+	transcriptional regulator	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
AWJ38404.1|2216988_2217141_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
AWJ38405.1|2217152_2217791_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWJ38406.1|2217791_2217974_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38407.1|2218048_2218309_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38408.1|2218564_2218753_+	cell division inhibitor	NA	NA	NA	NA	NA
AWJ38409.1|2218749_2218938_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ38410.1|2219030_2221493_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
AWJ38411.1|2221565_2221817_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
AWJ38412.1|2221836_2223132_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
AWJ38413.1|2223151_2223262_-	transporter	NA	NA	NA	NA	NA
AWJ38414.1|2223319_2224339_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWJ38415.1|2224350_2225565_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ38416.1|2225545_2225734_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38417.1|2225770_2226097_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 9
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2242382	2255555	5648177	tail,head,protease,terminase,capsid,portal	uncultured_Caudovirales_phage(88.89%)	20	NA	NA
AWJ38430.1|2242382_2243204_+|protease	serine protease	protease	NA	NA	NA	NA
AWJ38431.1|2243242_2243572_-	spermidine export protein MdtI	NA	NA	NA	NA	NA
AWJ38432.1|2243558_2243924_-	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AWJ38433.1|2244030_2244201_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38434.1|2244798_2244981_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38435.1|2245237_2245519_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38436.1|2245532_2247194_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
AWJ38437.1|2247177_2247534_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AWJ38438.1|2247822_2248263_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
AWJ38439.1|2248262_2248559_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
AWJ38440.1|2248555_2248894_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
AWJ38441.1|2248890_2250102_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AWJ38442.1|2250103_2250676_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
AWJ38443.1|2250715_2251873_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
AWJ38444.1|2252164_2252467_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38445.1|2252429_2252558_-	trigger factor	NA	NA	NA	NA	NA
AWJ38446.1|2252514_2252787_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ38447.1|2252797_2253208_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ38448.1|2253204_2253450_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38449.1|2253737_2255555_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
>prophage 10
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2377922	2422782	5648177	tail,holin,integrase,tRNA,terminase,capsid,plate,portal	Enterobacteria_phage(86.05%)	57	2380325:2380349	2415423:2415447
AWJ38564.1|2377922_2378672_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
AWJ38565.1|2378671_2379223_-	glutathione peroxidase	NA	NA	NA	NA	NA
AWJ38566.1|2379285_2380266_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
2380325:2380349	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
AWJ38567.1|2380458_2380896_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AWJ38568.1|2380996_2381497_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38569.1|2381499_2382438_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
AWJ38570.1|2382526_2382838_-	XRE family transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
AWJ38571.1|2382933_2383212_+	DNA-binding protein	NA	NA	NA	NA	NA
AWJ38572.1|2383226_2383565_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
AWJ38573.1|2383575_2383863_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	2.3e-32
AWJ38574.1|2383874_2384117_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AWJ38575.1|2384313_2384517_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
AWJ38576.1|2384513_2384759_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	86.4	1.0e-33
AWJ38577.1|2384900_2385266_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AWJ41739.1|2385410_2388095_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	98.2	0.0e+00
AWJ38578.1|2388171_2389131_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.9e-180
AWJ38579.1|2389135_2389447_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.0e-46
AWJ38580.1|2389545_2389953_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	91.7	4.0e-22
AWJ38581.1|2390512_2391037_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38582.1|2391051_2392098_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AWJ38583.1|2392097_2393849_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	99.5	0.0e+00
AWJ38584.1|2394003_2394840_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AWJ38585.1|2394862_2395915_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	98.3	5.4e-196
AWJ38586.1|2395960_2396761_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
AWJ38587.1|2396862_2397357_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AWJ38588.1|2397356_2397557_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
AWJ38589.1|2397559_2397883_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWJ38590.1|2397879_2398272_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AWJ38591.1|2398268_2398676_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
AWJ41740.1|2398647_2398827_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38592.1|2398813_2399281_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	2.9e-85
AWJ38593.1|2399273_2399909_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AWJ38594.1|2399905_2400487_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
AWJ38595.1|2400483_2400834_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWJ38596.1|2400837_2401734_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
AWJ38597.1|2401726_2402257_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
AWJ38598.1|2402259_2404392_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
AWJ38599.1|2404391_2404970_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	5.9e-96
AWJ41741.1|2405013_2405490_-	serine acetyltransferase	NA	NA	NA	NA	NA
AWJ38600.1|2405742_2406237_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.2	8.9e-85
AWJ38601.1|2406243_2409051_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
AWJ38602.1|2409037_2409274_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWJ38603.1|2409201_2409576_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AWJ38604.1|2409631_2410144_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AWJ38605.1|2410143_2411328_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
AWJ38606.1|2411485_2412595_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	5.7e-204
AWJ38607.1|2412820_2414323_+	DNA-binding protein	NA	NA	NA	NA	NA
AWJ38608.1|2414566_2414827_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38609.1|2415017_2415158_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
AWJ38610.1|2415464_2415764_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2415423:2415447	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
AWJ38611.1|2415768_2418156_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWJ38612.1|2418170_2419154_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWJ41742.1|2419437_2419482_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWJ38613.1|2419604_2419961_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWJ38614.1|2420013_2420211_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWJ38615.1|2420307_2420850_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWJ38616.1|2420853_2422782_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 11
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2491906	2589153	5648177	transposase,tail,holin,lysis,integrase,tRNA,head,protease,terminase,capsid,portal	Escherichia_phage(30.3%)	118	2531470:2531484	2590600:2590614
AWJ38688.1|2491906_2493062_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ38689.1|2493179_2493611_+|transposase	IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
AWJ38690.1|2493626_2493815_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
AWJ38691.1|2493818_2494178_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
AWJ38692.1|2494350_2494989_-	leucine efflux protein	NA	NA	NA	NA	NA
AWJ41744.1|2495115_2496039_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ38693.1|2496141_2497227_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWJ38694.1|2497477_2499088_+	BCCT family transporter	NA	NA	NA	NA	NA
AWJ38695.1|2499119_2500244_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AWJ38696.1|2500299_2501265_+	oxidoreductase	NA	NA	NA	NA	NA
AWJ38697.1|2501318_2502446_-	ribonuclease D	NA	NA	NA	NA	NA
AWJ38698.1|2502515_2504201_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AWJ38699.1|2504405_2504987_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38700.1|2505026_2505722_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWJ38701.1|2505779_2507690_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWJ41745.1|2507821_2508166_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38702.1|2508528_2508888_+	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWJ38703.1|2509007_2509187_-	YoaH family protein	NA	NA	NA	NA	NA
AWJ38704.1|2509260_2510622_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWJ38705.1|2510625_2511204_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AWJ38706.1|2511387_2512752_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWJ38707.1|2512882_2514481_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWJ38708.1|2514484_2516041_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AWJ38709.1|2516028_2516238_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38710.1|2516338_2516533_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38711.1|2516503_2517475_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AWJ38712.1|2517537_2518338_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AWJ38713.1|2518350_2519202_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AWJ38714.1|2519256_2519715_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AWJ41746.1|2519901_2520147_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38715.1|2520089_2520710_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AWJ38716.1|2520706_2521516_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AWJ38717.1|2521681_2521891_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AWJ38718.1|2521903_2522047_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AWJ38719.1|2522008_2522215_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38720.1|2522715_2523003_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38721.1|2523077_2523221_-	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
AWJ38722.1|2523379_2523619_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38723.1|2523761_2524553_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AWJ38724.1|2524729_2526103_+	MFS transporter	NA	NA	NA	NA	NA
AWJ38725.1|2526148_2527030_-|protease	protease HtpX	protease	NA	NA	NA	NA
AWJ38726.1|2527221_2529270_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
AWJ38727.1|2529289_2529988_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWJ38728.1|2530084_2530582_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AWJ38729.1|2530711_2531995_+	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
2531470:2531484	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
AWJ38730.1|2531963_2534597_+	MCE family protein	NA	NA	NA	NA	NA
AWJ41747.1|2534676_2536116_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWJ38731.1|2536233_2536470_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AWJ41748.1|2536574_2536766_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ38732.1|2536766_2537423_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AWJ41749.1|2538656_2539028_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ38733.1|2539252_2540128_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
AWJ38734.1|2540268_2540538_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
AWJ38735.1|2540539_2541853_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
AWJ38736.1|2542571_2544110_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ38737.1|2544158_2544506_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ38738.1|2544502_2544907_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
AWJ38739.1|2545045_2548441_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.6	0.0e+00
AWJ38740.1|2548783_2549464_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.3	6.5e-110
AWJ38741.1|2549361_2550105_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AWJ38742.1|2550115_2550814_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ38743.1|2550813_2551143_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWJ38744.1|2551139_2553752_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
AWJ38745.1|2553732_2554146_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ38746.1|2554172_2554595_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ38747.1|2554608_2555361_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ38748.1|2555368_2555764_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ38749.1|2555760_2556339_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWJ38750.1|2556350_2556704_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ38751.1|2556715_2557111_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ38752.1|2557152_2558178_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ38753.1|2558233_2558566_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ38754.1|2558575_2559895_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ38755.1|2559875_2561477_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
AWJ38756.1|2561473_2561680_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ38757.1|2561676_2563602_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ38758.1|2563576_2564122_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ38759.1|2564261_2564363_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38760.1|2564510_2564705_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ38761.1|2564784_2564925_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38762.1|2564892_2565510_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ38763.1|2565659_2566097_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ38764.1|2566093_2566591_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ38765.1|2566590_2566806_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ38766.1|2566804_2566966_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38767.1|2567244_2569095_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWJ38768.1|2569508_2569775_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38769.1|2570265_2571087_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ38770.1|2571083_2571458_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
AWJ38771.1|2571470_2572520_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
AWJ38772.1|2572521_2572794_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWJ38773.1|2572915_2573260_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWJ38774.1|2573379_2573592_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWJ38775.1|2573825_2574383_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWJ38776.1|2574384_2574603_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AWJ38777.1|2574730_2575042_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AWJ38778.1|2575034_2575262_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWJ41750.1|2575258_2575540_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWJ41751.1|2577106_2578069_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
AWJ38779.1|2578091_2578517_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ38780.1|2578513_2578816_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
AWJ38781.1|2578850_2579285_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38782.1|2579269_2579497_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38783.1|2579498_2579777_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ41752.1|2580063_2580216_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
AWJ38784.1|2580636_2580858_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
AWJ41753.1|2580857_2581028_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AWJ38785.1|2581101_2581377_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
AWJ38786.1|2581475_2584127_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
AWJ38787.1|2584119_2584929_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
AWJ41754.1|2584985_2585180_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
AWJ38788.1|2585172_2585361_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
AWJ38789.1|2585467_2585749_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
AWJ38790.1|2585714_2586830_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.8	4.6e-97
AWJ38791.1|2587182_2587524_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ38792.1|2587536_2588406_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ38793.1|2588409_2588784_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWJ38794.1|2588922_2589153_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
2590600:2590614	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 12
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2791739	2797057	5648177	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
AWJ38965.1|2791739_2793278_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
AWJ38966.1|2793326_2793674_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ38967.1|2793670_2794075_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWJ38968.1|2794073_2794505_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38969.1|2794583_2794817_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWJ38970.1|2794761_2794896_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWJ38971.1|2794916_2795735_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
AWJ38972.1|2795789_2796275_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
AWJ41762.1|2796320_2796767_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ38973.1|2796835_2797057_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 13
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2830693	2836995	5648177		Enterobacteria_phage(50.0%)	7	NA	NA
AWJ39007.1|2830693_2831236_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
AWJ39008.1|2831240_2832119_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
AWJ39009.1|2832176_2833076_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
AWJ39010.1|2833075_2834161_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
AWJ39011.1|2834232_2834496_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39012.1|2834532_2835426_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
AWJ39013.1|2835600_2836995_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 14
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	2928437	2938365	5648177	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
AWJ39081.1|2928437_2929574_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
AWJ39082.1|2929570_2931571_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWJ41773.1|2931902_2932283_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AWJ39083.1|2932279_2932627_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ39084.1|2932676_2934062_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWJ39085.1|2934493_2934964_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
AWJ39086.1|2935010_2935730_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ39087.1|2935726_2937412_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ39088.1|2937633_2938365_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
>prophage 15
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3015806	3111372	5648177	tail,transposase,holin,lysis,integrase,head,terminase,capsid	Enterobacteria_phage(37.84%)	105	3046338:3046356	3120588:3120606
AWJ39167.1|3015806_3016295_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
AWJ39168.1|3016457_3017381_+|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
AWJ39169.1|3017848_3018073_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWJ39170.1|3020468_3020726_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39171.1|3020757_3021405_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ39172.1|3021439_3022492_-	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWJ39173.1|3022488_3023046_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWJ39174.1|3023042_3024986_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWJ39175.1|3024982_3025462_-	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWJ39176.1|3025458_3025668_-	heme exporter protein D	NA	NA	NA	NA	NA
AWJ39177.1|3025664_3026402_-	heme exporter protein C	NA	NA	NA	NA	NA
AWJ39178.1|3026443_3027106_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWJ39179.1|3027102_3027726_-	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWJ39180.1|3027738_3028341_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWJ39181.1|3028350_3028800_-	nitrate reductase	NA	NA	NA	NA	NA
AWJ39182.1|3028796_3029660_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWJ39183.1|3029646_3030342_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWJ39184.1|3030348_3032835_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWJ39185.1|3032831_3033095_-	protein NapD	NA	NA	NA	NA	NA
AWJ39186.1|3033084_3033579_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWJ39187.1|3033678_3033852_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39188.1|3033987_3034476_+	ecotin	NA	NA	NA	NA	NA
AWJ39189.1|3034624_3036271_-	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AWJ39190.1|3036488_3038132_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWJ39191.1|3038207_3038858_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWJ39192.1|3038857_3039922_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWJ39193.1|3039995_3041051_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWJ39194.1|3041162_3042254_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWJ39195.1|3042534_3042762_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39196.1|3042736_3042976_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39197.1|3042992_3045665_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWJ39198.1|3045681_3046332_+	DNA-binding response regulator	NA	NA	NA	NA	NA
3046338:3046356	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
AWJ39199.1|3046417_3049267_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
AWJ39200.1|3049541_3050318_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWJ39201.1|3050322_3051972_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWJ39202.1|3051972_3056487_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
AWJ39203.1|3057168_3058491_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
AWJ39204.1|3059184_3059832_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
AWJ39205.1|3060041_3060311_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
AWJ39206.1|3060312_3061626_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
AWJ39207.1|3061690_3062290_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
AWJ39208.1|3062357_3062639_-	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	97.5	3.9e-37
AWJ39209.1|3062635_3064174_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ39210.1|3064222_3064570_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ39211.1|3064566_3064971_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
AWJ39212.1|3064999_3068299_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
AWJ39213.1|3068359_3069031_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.1	1.2e-103
AWJ39214.1|3068928_3069672_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
AWJ39215.1|3069677_3070376_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AWJ39216.1|3070375_3070705_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
AWJ39217.1|3070701_3073263_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
AWJ39218.1|3073243_3073657_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWJ39219.1|3073683_3074115_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ39220.1|3074887_3075283_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
AWJ39221.1|3075279_3075855_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
AWJ39222.1|3075869_3076223_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
AWJ39223.1|3076215_3076638_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39224.1|3076641_3077526_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
AWJ39225.1|3077583_3077931_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
AWJ39226.1|3077967_3079473_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
AWJ39227.1|3081050_3081257_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
AWJ39228.1|3081240_3081447_-	hypothetical protein	NA	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
AWJ39229.1|3081459_3083169_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
AWJ39230.1|3083140_3083650_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWJ39231.1|3084044_3084239_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ39232.1|3084598_3084892_+	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ39233.1|3084923_3085385_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AWJ39234.1|3085381_3085879_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
AWJ41777.1|3085878_3086094_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWJ39235.1|3087954_3088578_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWJ39236.1|3088574_3089240_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWJ39237.1|3089236_3089839_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWJ39238.1|3089813_3090380_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWJ39239.1|3090909_3092745_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
AWJ39240.1|3093248_3093431_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWJ39241.1|3093427_3093955_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
AWJ39242.1|3093951_3094398_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
AWJ39243.1|3094684_3094975_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ39244.1|3094971_3095673_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
AWJ39245.1|3095669_3096608_-	Replication protein O	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
AWJ39246.1|3096640_3096937_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
AWJ39247.1|3097046_3097232_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AWJ39248.1|3097312_3097963_+	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
AWJ39249.1|3098277_3098583_+	regulator	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
AWJ39250.1|3098585_3098924_+	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
AWJ39251.1|3099057_3099528_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AWJ39252.1|3099677_3100046_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
AWJ41779.1|3100125_3100416_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	1.3e-40
AWJ39253.1|3100349_3100502_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
AWJ39254.1|3100470_3100767_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ39255.1|3100772_3101558_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ39256.1|3101554_3102232_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
AWJ41780.1|3102231_3102414_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
AWJ39257.1|3102386_3102578_+	DUF1382 domain-containing protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
AWJ39258.1|3102588_3102870_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
AWJ39259.1|3102968_3103190_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
AWJ41778.1|3103234_3103792_+	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	96.3	2.1e-37
AWJ39260.1|3103788_3104139_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
AWJ39261.1|3104213_3104456_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
AWJ39262.1|3104574_3104919_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWJ39263.1|3105024_3105243_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWJ39264.1|3105220_3106291_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWJ39265.1|3106305_3106911_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
AWJ39266.1|3106907_3108596_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
AWJ39267.1|3108744_3111372_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
3120588:3120606	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 16
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3200045	3273559	5648177	tail,transposase,holin,lysis,tRNA,head,terminase,capsid,portal	Enterobacteria_phage(47.54%)	95	NA	NA
AWJ39347.1|3200045_3200858_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWJ39348.1|3200857_3201871_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ39349.1|3201936_3203073_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
AWJ39350.1|3203171_3204167_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AWJ39351.1|3204163_3205342_-	MFS transporter	NA	NA	NA	NA	NA
AWJ39352.1|3205283_3205505_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39353.1|3205625_3206846_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWJ39354.1|3207004_3209011_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWJ39355.1|3209131_3209410_-	YfcL family protein	NA	NA	NA	NA	NA
AWJ39356.1|3209443_3209992_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWJ39357.1|3209991_3210801_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39358.1|3210800_3211625_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWJ39359.1|3211628_3212714_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
AWJ39360.1|3212748_3213681_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWJ39361.1|3213846_3214398_+	endonuclease SmrB	NA	NA	NA	NA	NA
AWJ39362.1|3214470_3215322_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AWJ39363.1|3215323_3215863_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ39364.1|3215859_3216348_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ39365.1|3216344_3216854_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39366.1|3216869_3217622_-	fimbrial protein	NA	NA	NA	NA	NA
AWJ39367.1|3217641_3220287_-	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ39368.1|3220368_3220932_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWJ39369.1|3221615_3222101_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AWJ39370.1|3222303_3224448_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWJ39371.1|3224447_3225758_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWJ39372.1|3225937_3226222_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AWJ39373.1|3226306_3226558_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39374.1|3226593_3227934_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AWJ39375.1|3228298_3229357_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39376.1|3229538_3230294_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWJ39377.1|3230319_3230490_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39378.1|3230587_3231520_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AWJ39379.1|3231831_3232989_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.2	1.1e-221
AWJ39380.1|3233233_3234376_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
AWJ39381.1|3234446_3236570_-|tail	phage tail protein	tail	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
AWJ39382.1|3236691_3236958_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
AWJ39383.1|3237028_3237514_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39384.1|3237528_3239373_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
AWJ39385.1|3239372_3240779_-	acyltransferase	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
AWJ39386.1|3240788_3241481_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
AWJ39387.1|3241483_3241939_-	hypothetical protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
AWJ39388.1|3241938_3242787_-	hypothetical protein	NA	Q716G6	Shigella_phage	97.9	1.5e-100
AWJ39389.1|3242786_3244205_-	hypothetical protein	NA	Q716G7	Shigella_phage	99.2	2.3e-274
AWJ39390.1|3244213_3244696_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AWJ39391.1|3244670_3244856_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
AWJ39392.1|3244898_3246170_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
AWJ39393.1|3246181_3247066_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	98.3	9.9e-143
AWJ39394.1|3247079_3249206_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
AWJ39395.1|3249208_3250621_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
AWJ39396.1|3250617_3251043_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	87.9	1.8e-65
AWJ39397.1|3251122_3251365_-	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AWJ39398.1|3251468_3251840_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
AWJ39399.1|3252229_3253443_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
AWJ39400.1|3253448_3253955_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	1.1e-82
AWJ39401.1|3254160_3254598_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
AWJ39402.1|3254594_3255071_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AWJ39403.1|3255054_3255378_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AWJ39404.1|3255865_3256084_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39405.1|3256294_3256489_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39406.1|3256450_3257074_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	2.0e-113
AWJ39407.1|3257070_3257736_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
AWJ39408.1|3257713_3257920_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AWJ39409.1|3257916_3258522_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
AWJ39410.1|3258514_3258724_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
AWJ39411.1|3258683_3259085_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
AWJ39412.1|3259087_3259264_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWJ39413.1|3259260_3259671_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AWJ39414.1|3259642_3259999_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AWJ39415.1|3260268_3260454_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39416.1|3260464_3260680_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
AWJ39417.1|3260766_3262143_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
AWJ39418.1|3262139_3262961_-	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
AWJ41785.1|3263144_3263423_-	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
AWJ39419.1|3263532_3263757_-	transcriptional regulator	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
AWJ39420.1|3263901_3264576_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
AWJ39421.1|3264616_3264913_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39422.1|3265346_3265619_+	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
AWJ39423.1|3265621_3265984_+	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
AWJ39424.1|3266014_3266509_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
AWJ39425.1|3266709_3267180_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
AWJ39426.1|3267323_3267635_+	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
AWJ39427.1|3267829_3267982_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AWJ39428.1|3268238_3268844_+	recombinase	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
AWJ39429.1|3268843_3269227_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
AWJ39430.1|3269250_3269544_+	RecBCD nuclease inhibitor	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
AWJ39431.1|3269715_3270303_+	DUF4752 domain-containing protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
AWJ39432.1|3270299_3270968_+	hypothetical protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
AWJ39433.1|3270969_3271158_+	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
AWJ39434.1|3271161_3271779_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
AWJ39435.1|3271775_3272363_+	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
AWJ39436.1|3272362_3272641_+	DUF4752 domain-containing protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
AWJ39437.1|3272653_3272854_+	hypothetical protein	NA	K7PMC6	Enterobacterial_phage	87.3	9.0e-20
AWJ39438.1|3272786_3273098_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.1e-55
AWJ39439.1|3273133_3273301_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
AWJ39440.1|3273358_3273559_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 17
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3528273	3631832	5648177	tail,holin,lysis,tRNA,head,terminase,capsid	Escherichia_phage(28.57%)	111	NA	NA
AWJ39665.1|3528273_3529011_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWJ39666.1|3529142_3530477_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWJ41792.1|3530685_3531567_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ39667.1|3531669_3532257_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWJ39668.1|3532312_3532696_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWJ39669.1|3533000_3533690_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWJ39670.1|3533737_3534775_-	methyltransferase	NA	NA	NA	NA	NA
AWJ39671.1|3534764_3534968_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39672.1|3534981_3535401_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWJ39673.1|3535469_3536168_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWJ39674.1|3536199_3538860_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWJ39675.1|3538973_3540329_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWJ39676.1|3540374_3540698_+	lipoprotein	NA	NA	NA	NA	NA
AWJ39677.1|3540694_3541993_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWJ39678.1|3541974_3542088_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWJ39679.1|3547846_3550420_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWJ39680.1|3550549_3551281_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWJ39681.1|3551277_3552258_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWJ39682.1|3552392_3553130_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWJ39683.1|3553159_3553366_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39684.1|3553400_3553742_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWJ41793.1|3553845_3553893_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39685.1|3553991_3555152_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWJ39686.1|3555194_3556316_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWJ39687.1|3556326_3557397_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWJ39688.1|3557606_3557972_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39689.1|3558121_3558640_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWJ39690.1|3558629_3559856_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWJ39691.1|3559871_3560354_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39692.1|3560430_3560778_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWJ39693.1|3560819_3561587_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWJ39694.1|3561617_3562166_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWJ39695.1|3562184_3562433_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWJ39696.1|3562681_3564043_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ41794.1|3564209_3565001_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ41795.1|3565066_3566308_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWJ39697.1|3566362_3566956_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWJ39698.1|3566952_3567147_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWJ39699.1|3567078_3567957_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWJ39700.1|3568042_3569704_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWJ39701.1|3569852_3570194_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWJ39702.1|3570255_3570546_-	RnfH family protein	NA	NA	NA	NA	NA
AWJ39703.1|3570535_3571012_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWJ39704.1|3571143_3571626_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ39705.1|3573380_3574742_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.6	1.2e-51
AWJ39706.1|3575118_3578520_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
AWJ39707.1|3579111_3581460_-	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AWJ39708.1|3581675_3581945_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
AWJ39709.1|3581946_3583260_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
AWJ41796.1|3583324_3583924_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
AWJ39710.1|3583991_3587465_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
AWJ39711.1|3587531_3587750_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39712.1|3587703_3588384_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.3	8.2e-113
AWJ39713.1|3588281_3588917_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.1	3.9e-125
AWJ39714.1|3589034_3589733_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
AWJ39715.1|3589732_3590074_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
AWJ39716.1|3590066_3593309_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
AWJ39717.1|3593356_3593638_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	7.9e-46
AWJ39718.1|3593661_3594036_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
AWJ39719.1|3594041_3594758_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
AWJ39720.1|3594823_3595168_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ39721.1|3595164_3595611_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ39722.1|3595607_3595958_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ39723.1|3595968_3596295_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ39724.1|3598821_3599043_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ39725.1|3599087_3601025_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
AWJ39726.1|3601088_3602750_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
AWJ39727.1|3602746_3603310_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
AWJ39728.1|3603425_3603605_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	85.7	2.1e-20
AWJ39729.1|3603601_3603967_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
AWJ39730.1|3604008_3604233_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
AWJ39731.1|3604314_3604629_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ39732.1|3604871_3605012_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39733.1|3605094_3605562_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	79.5	1.5e-57
AWJ39734.1|3605558_3606056_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ39735.1|3606055_3606271_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ39736.1|3606269_3606431_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ39737.1|3606709_3608560_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
AWJ39738.1|3609377_3609530_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
AWJ39739.1|3609544_3609754_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	2.0e-25
AWJ39740.1|3609839_3610592_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
AWJ39741.1|3610605_3611595_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
AWJ39742.1|3611602_3612400_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
AWJ39743.1|3612419_3612809_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
AWJ39744.1|3612805_3613132_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWJ39745.1|3613128_3613782_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
AWJ39746.1|3613781_3614276_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
AWJ39747.1|3614272_3615091_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
AWJ39748.1|3615087_3615312_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AWJ39749.1|3615308_3616460_-	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
AWJ39750.1|3616456_3617008_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AWJ39751.1|3617051_3617252_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWJ39752.1|3617342_3618017_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AWJ39753.1|3618416_3618611_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	1.7e-31
AWJ39754.1|3618683_3619046_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ39755.1|3619111_3619936_+	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
AWJ39756.1|3620064_3620601_+	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
AWJ39757.1|3620591_3621470_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
AWJ39758.1|3621466_3621670_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
AWJ39759.1|3621662_3621902_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
AWJ39760.1|3621898_3622228_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
AWJ39761.1|3622229_3623093_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
AWJ39762.1|3623177_3623420_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
AWJ39763.1|3623423_3623570_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
AWJ39764.1|3623578_3623788_+	excisionase	NA	I6PBM8	Cronobacter_phage	88.2	1.6e-30
AWJ39765.1|3623742_3624918_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
AWJ41797.1|3625400_3626309_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
AWJ41798.1|3626607_3627837_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
AWJ39766.1|3627875_3628292_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWJ39767.1|3628363_3630112_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
AWJ39768.1|3630113_3631832_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 18
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3704623	3711763	5648177		Escherichia_phage(83.33%)	6	NA	NA
AWJ39836.1|3704623_3707185_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWJ39837.1|3707290_3707947_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWJ39838.1|3707997_3708765_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ39839.1|3708960_3709869_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ39840.1|3709865_3711128_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWJ39841.1|3711124_3711763_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 19
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	3863817	3871766	5648177	integrase,transposase	Stx2-converting_phage(42.86%)	9	3861774:3861790	3870859:3870875
3861774:3861790	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AWJ39979.1|3863817_3865389_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ39980.1|3865408_3865756_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ39981.1|3865755_3866433_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ39982.1|3866394_3866520_+	copper resistance protein	NA	NA	NA	NA	NA
AWJ39983.1|3866625_3866826_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ39984.1|3866827_3867556_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
AWJ39985.1|3868464_3869124_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
AWJ39986.1|3869116_3870724_-|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
AWJ39987.1|3871010_3871766_-	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3870859:3870875	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 20
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	4920371	4933704	5648177	transposase	Enterobacteria_phage(66.67%)	17	NA	NA
AWJ40964.1|4920371_4922705_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AWJ40965.1|4922719_4923040_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ40966.1|4923036_4923219_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ40967.1|4923195_4923873_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ40968.1|4923872_4924220_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ40969.1|4924239_4925811_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ40970.1|4925886_4926342_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
AWJ40971.1|4926334_4926622_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWJ40972.1|4926614_4927214_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
AWJ40973.1|4927210_4927477_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWJ40974.1|4927489_4927681_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ40975.1|4928028_4928763_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
AWJ40976.1|4928759_4929260_+	transactivation protein	NA	NA	NA	NA	NA
AWJ40977.1|4929333_4929906_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AWJ40978.1|4930233_4930659_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ40979.1|4930655_4932515_-	helicase	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
AWJ40980.1|4932534_4933704_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.1	1.7e-198
>prophage 21
CP028116	Escherichia coli O26 str. RM8426 chromosome, complete genome	5648177	5495778	5508342	5648177	transposase	Enterobacteria_phage(40.0%)	14	NA	NA
AWJ41482.1|5495778_5496456_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ41483.1|5496455_5496803_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ41484.1|5496822_5498394_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ41485.1|5498703_5498976_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
AWJ41486.1|5498977_5499532_-	phage polarity suppression protein	NA	NA	NA	NA	NA
AWJ41487.1|5499528_5500281_-	septation initiation protein	NA	NA	NA	NA	NA
AWJ41488.1|5501195_5501456_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
AWJ41489.1|5501452_5502001_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
AWJ41490.1|5502000_5502225_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ41491.1|5502221_5502545_+	DNA replication protein	NA	NA	NA	NA	NA
AWJ41492.1|5502559_5504893_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
AWJ41493.1|5505798_5506623_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
AWJ41494.1|5506671_5507052_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	60.8	1.1e-37
AWJ41495.1|5507185_5508342_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 1
CP028115	Escherichia coli O26 str. RM8426 plasmid pRM8426, complete sequence	90123	7193	61172	90123	integrase,transposase,bacteriocin	Stx2-converting_phage(38.89%)	52	2429:2443	47965:47979
2429:2443	attL	ATTGATGCAACAGGA	NA	NA	NA	NA
AWJ36147.1|7193_7532_+|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
AWJ36148.1|7539_7920_-	colicin M immunity protein	NA	NA	NA	NA	NA
AWJ36149.1|8065_8848_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
AWJ36150.1|8849_9263_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36151.1|9376_9571_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36216.1|9531_9735_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36152.1|9707_9845_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
AWJ36153.1|9822_10053_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWJ36154.1|10049_10466_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AWJ36155.1|10627_11173_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36156.1|11240_12396_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
AWJ36157.1|13201_14062_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
AWJ36158.1|14189_14576_+	recombinase	NA	NA	NA	NA	NA
AWJ36159.1|14629_15304_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ36160.1|15300_15648_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ36161.1|15651_17220_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWJ36162.1|17766_17916_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWJ36163.1|17879_18545_-	traC	NA	NA	NA	NA	NA
AWJ36164.1|18685_19327_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AWJ36165.1|19620_19851_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36166.1|19958_20048_+	positive regulator for repZ translation	NA	NA	NA	NA	NA
AWJ36167.1|20035_21067_+	replication initiation protein	NA	NA	NA	NA	NA
AWJ36168.1|22026_31527_-	toxin B	NA	NA	NA	NA	NA
AWJ36169.1|31641_31872_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36170.1|34998_35475_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
AWJ36171.1|39454_40642_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ36172.1|40641_41007_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36173.1|40934_41318_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36174.1|41830_43399_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWJ36175.1|43402_43750_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ36176.1|43746_44421_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ36177.1|44474_44702_-	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
AWJ36178.1|44864_45842_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWJ36179.1|46647_47860_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
AWJ36180.1|47826_47925_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
AWJ36181.1|48033_48246_+	hypothetical protein	NA	NA	NA	NA	NA
47965:47979	attR	TCCTGTTGCATCAAT	NA	NA	NA	NA
AWJ36182.1|48233_50243_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AWJ36183.1|50286_50676_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
AWJ36184.1|51636_52032_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AWJ36185.1|52031_52991_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
AWJ36217.1|53263_54166_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWJ36186.1|54549_55233_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
AWJ36218.1|55232_55451_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36187.1|55462_55897_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWJ36188.1|55941_56424_+	recombinase	NA	NA	NA	NA	NA
AWJ36189.1|56420_57140_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWJ36219.1|57416_57734_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
AWJ36190.1|58195_58696_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
AWJ36191.1|59211_59427_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36192.1|59423_59858_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AWJ36193.1|59950_60217_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36194.1|60281_61172_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
>prophage 2
CP028115	Escherichia coli O26 str. RM8426 plasmid pRM8426, complete sequence	90123	70580	82357	90123	transposase,protease	Stx2-converting_phage(83.33%)	8	NA	NA
AWJ36203.1|70580_74483_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
AWJ36204.1|75770_76445_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ36205.1|76441_76789_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ36206.1|76792_78361_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
AWJ36207.1|78639_79827_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ36208.1|79777_80191_-|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36209.1|80427_80775_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ36210.1|80824_82357_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
