The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	601746	639397	5631913	tRNA,head,lysis,integrase,terminase,portal,tail,transposase	Enterobacteria_phage(55.0%)	54	597550:597565	632964:632979
597550:597565	attL	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
AWJ30979.1|601746_603132_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWJ30980.1|603167_603689_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ30981.1|603796_604009_-	ribosome-associated protein	NA	NA	NA	NA	NA
AWJ30982.1|604010_604877_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AWJ30983.1|605357_605900_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWJ30984.1|606119_606812_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AWJ30985.1|606842_609452_+	outer membrane usher protein	NA	NA	NA	NA	NA
AWJ30986.1|609430_610471_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWJ30987.1|610481_610997_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AWJ30988.1|610999_611632_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ30989.1|611966_613130_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
AWJ30990.1|612985_613357_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AWJ30991.1|613328_613607_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWJ30992.1|613654_613873_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
AWJ30993.1|613971_614253_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
AWJ30994.1|614263_614455_-	DUF1382 domain-containing protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AWJ30995.1|614427_614610_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AWJ30996.1|614606_615287_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
AWJ30997.1|615283_616069_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
AWJ30998.1|616074_616371_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ30999.1|616446_616653_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	82.4	1.8e-26
AWJ31000.1|617203_617524_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31001.1|617659_617923_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
AWJ31002.1|618004_618760_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWJ31003.1|618798_619029_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWJ31004.1|619098_619638_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
AWJ31005.1|619634_620654_+	Replication protein O	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
AWJ31006.1|620650_621352_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
AWJ31007.1|621556_621904_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31008.1|622656_623265_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
AWJ31009.1|623564_623981_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
AWJ31010.1|623959_624361_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31011.1|624484_624586_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31012.1|624582_625038_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
AWJ31013.1|625037_625208_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWJ31014.1|625200_625491_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
AWJ31015.1|625487_625850_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AWJ31016.1|625846_625987_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AWJ31017.1|626072_626456_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AWJ31018.1|626644_627727_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
AWJ31019.1|628315_628531_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AWJ31020.1|628530_629028_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AWJ31021.1|629024_629486_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AWJ31022.1|629517_629811_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ31023.1|630151_631362_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.2e-167
AWJ31024.1|631479_631674_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ31025.1|631821_631923_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31026.1|632062_632608_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWJ31027.1|632582_634508_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
632964:632979	attR	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
AWJ31028.1|634504_634711_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWJ31029.1|634707_636309_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
AWJ31030.1|636781_638353_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ31031.1|638372_638720_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ31032.1|638719_639397_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 2
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	773367	863204	5631913	head,holin,lysis,integrase,terminase,portal,tail,capsid,transposase	Enterobacteria_phage(41.67%)	104	759053:759071	833304:833322
759053:759071	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
AWJ31146.1|773367_774438_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
AWJ31147.1|774415_774634_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
AWJ31148.1|774739_775084_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
AWJ31149.1|775028_775226_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31150.1|775202_775445_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
AWJ31151.1|775519_775870_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
AWJ35839.1|775866_776424_-	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	96.3	2.1e-37
AWJ31152.1|776468_776690_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
AWJ31153.1|776788_777070_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
AWJ31154.1|777080_777272_-	DUF1382 domain-containing protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
AWJ35840.1|777244_777427_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
AWJ31155.1|777426_778104_-	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
AWJ31156.1|778100_778886_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ31157.1|778891_779188_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWJ31158.1|779156_779309_-	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
AWJ35841.1|779242_779533_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	95.5	1.3e-40
AWJ31159.1|779612_779981_-	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
AWJ31160.1|780130_780601_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AWJ31161.1|780734_781073_-	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
AWJ31162.1|781075_781381_-	regulator	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
AWJ31163.1|781694_782345_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
AWJ31164.1|782425_782611_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AWJ31165.1|782720_783017_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
AWJ31166.1|783049_783988_+	Replication protein O	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
AWJ31167.1|783984_784686_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
AWJ31168.1|784682_784973_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ31169.1|785259_785706_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
AWJ31170.1|785702_786230_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
AWJ31171.1|786226_786409_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
AWJ31172.1|786912_788748_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
AWJ31173.1|789271_789838_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
AWJ31174.1|789812_790415_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
AWJ31175.1|790411_791077_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AWJ31176.1|791073_791697_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
AWJ31177.1|791976_792693_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35842.1|793558_793774_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AWJ31178.1|793773_794271_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
AWJ31179.1|794267_794729_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.7	9.2e-76
AWJ31180.1|794760_795054_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWJ31181.1|795413_795608_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
AWJ31182.1|796002_796512_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWJ31183.1|796483_798193_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.9e-239
AWJ31184.1|798205_798412_+	hypothetical protein	NA	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
AWJ31185.1|798395_798602_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
AWJ31186.1|798598_800191_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
AWJ31187.1|800180_801686_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
AWJ31188.1|801722_802070_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
AWJ31189.1|802127_803012_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
AWJ31190.1|803015_803438_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31191.1|803430_803784_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
AWJ31192.1|803798_804374_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
AWJ31193.1|804370_804766_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
AWJ31194.1|804773_805526_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
AWJ31195.1|805539_805971_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ31196.1|805997_806411_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWJ31197.1|806391_808953_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
AWJ31198.1|808949_809279_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
AWJ31199.1|809278_809977_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
AWJ31200.1|809982_810726_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
AWJ31201.1|811354_814654_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
AWJ31202.1|815082_815430_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
AWJ31203.1|815478_817017_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ31204.1|817013_817295_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	97.5	3.9e-37
AWJ31205.1|817362_817962_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
AWJ31206.1|818026_819340_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
AWJ31207.1|819341_819611_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
AWJ31208.1|819942_820476_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	42.0	6.4e-28
AWJ31209.1|821169_822492_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
AWJ31210.1|823250_827687_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31211.1|827687_829337_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
AWJ31212.1|829341_830118_+	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
AWJ31213.1|830392_833242_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
AWJ31214.1|833327_833978_-	DNA-binding response regulator	NA	NA	NA	NA	NA
833304:833322	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
AWJ31215.1|833994_836667_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
AWJ31216.1|836683_836923_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31217.1|836897_837125_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31218.1|837405_838497_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
AWJ31219.1|838608_839664_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWJ31220.1|839737_840802_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWJ31221.1|840801_841452_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AWJ31222.1|841527_843171_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
AWJ31223.1|843388_845035_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
AWJ31224.1|845183_845672_-	ecotin	NA	NA	NA	NA	NA
AWJ31225.1|845807_845981_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31226.1|846080_846575_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
AWJ31227.1|846564_846828_+	protein NapD	NA	NA	NA	NA	NA
AWJ31228.1|846824_849311_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
AWJ31229.1|849317_850013_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
AWJ31230.1|849999_850863_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
AWJ31231.1|850859_851309_+	nitrate reductase	NA	NA	NA	NA	NA
AWJ31232.1|851318_851921_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
AWJ31233.1|851933_852557_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
AWJ31234.1|852553_853216_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
AWJ31235.1|853257_853995_+	heme exporter protein C	NA	NA	NA	NA	NA
AWJ31236.1|853991_854201_+	heme exporter protein D	NA	NA	NA	NA	NA
AWJ31237.1|854197_854677_+	cytochrome c-type biogenesis protein CcmE	NA	NA	NA	NA	NA
AWJ31238.1|854673_856617_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
AWJ31239.1|856613_857171_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWJ31240.1|857167_858220_+	cytochrome c biogenesis protein CcmH	NA	NA	NA	NA	NA
AWJ31241.1|858254_858902_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ31242.1|858933_859191_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31243.1|859302_861588_+	outer membrane autotransporter barrel domain-containing protein	NA	NA	NA	NA	NA
AWJ31244.1|861588_861813_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWJ35843.1|862280_863204_-|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
>prophage 3
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	941301	951229	5631913	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
AWJ31326.1|941301_942033_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWJ31327.1|942254_943940_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ31328.1|943936_944656_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ31329.1|944702_945173_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
AWJ31330.1|945604_946990_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWJ31331.1|947039_947387_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWJ35846.1|947383_947764_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	7.9e-65
AWJ31332.1|948095_950096_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWJ31333.1|950092_951229_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1182098	1238215	5631913	holin,integrase,terminase,capsid,tail,portal,plate	Enterobacteria_phage(82.93%)	68	1200988:1201047	1238322:1238442
AWJ31521.1|1182098_1182293_-|integrase	integrase	integrase	NA	NA	NA	NA
AWJ31522.1|1182573_1183242_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
AWJ31523.1|1183348_1183582_-	SirA-like protein	NA	NA	NA	NA	NA
AWJ31524.1|1183578_1184784_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AWJ31525.1|1184970_1185384_+	lipoprotein	NA	NA	NA	NA	NA
AWJ31526.1|1185417_1186905_-	alpha-amylase	NA	NA	NA	NA	NA
AWJ31527.1|1186982_1187348_-	flagellar protein FliT	NA	NA	NA	NA	NA
AWJ31528.1|1187347_1187758_-	flagella export chaperone FliS	NA	NA	NA	NA	NA
AWJ31529.1|1187772_1189185_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
AWJ31530.1|1189439_1190903_+	flagellin FliC	NA	NA	NA	NA	NA
AWJ31531.1|1191067_1191787_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
AWJ31532.1|1191832_1192384_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
AWJ31533.1|1192471_1193272_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ31534.1|1193376_1194363_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AWJ31535.1|1194377_1195046_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWJ31536.1|1195042_1195795_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
AWJ31537.1|1196024_1196747_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AWJ31538.1|1196814_1197039_-	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AWJ31539.1|1197239_1197356_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ31540.1|1197497_1198154_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ31541.1|1198150_1199983_+	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWJ31542.1|1200039_1200588_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
1200988:1201047	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
AWJ31543.1|1202050_1202191_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
AWJ31544.1|1202381_1202642_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31545.1|1202931_1204071_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31546.1|1204470_1205571_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
AWJ31547.1|1205728_1206913_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
AWJ31548.1|1206912_1207425_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AWJ31549.1|1207479_1207845_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AWJ31550.1|1207772_1208009_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
AWJ31551.1|1207995_1210803_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.6	0.0e+00
AWJ31552.1|1210809_1211304_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.1e-85
AWJ35861.1|1211556_1212033_+	serine acetyltransferase	NA	NA	NA	NA	NA
AWJ31553.1|1212076_1212655_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
AWJ31554.1|1212654_1214787_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
AWJ31555.1|1214789_1215320_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
AWJ31556.1|1215312_1216209_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
AWJ31557.1|1216212_1216563_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AWJ31558.1|1216559_1217141_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
AWJ31559.1|1217137_1217773_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AWJ31560.1|1217765_1218233_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
AWJ31561.1|1218256_1220134_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
AWJ31562.1|1220272_1220680_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
AWJ31563.1|1220676_1221069_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
AWJ31564.1|1221065_1221389_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AWJ31565.1|1221391_1221592_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
AWJ31566.1|1221591_1222086_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AWJ31567.1|1222187_1222988_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
AWJ31568.1|1223033_1224086_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
AWJ31569.1|1224109_1224946_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.3e-149
AWJ31570.1|1225100_1226852_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
AWJ31571.1|1226851_1227898_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AWJ31572.1|1228387_1228978_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	50.0	6.8e-31
AWJ31573.1|1229041_1229353_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
AWJ31574.1|1229357_1230317_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
AWJ31575.1|1230393_1233234_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.5	0.0e+00
AWJ31576.1|1233230_1233620_-	inositol monophosphatase	NA	NA	NA	NA	NA
AWJ31577.1|1233728_1233947_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	50.8	8.6e-08
AWJ31578.1|1233943_1234147_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
AWJ31579.1|1234343_1234586_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
AWJ31580.1|1234597_1234876_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
AWJ31581.1|1234886_1235237_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
AWJ31582.1|1235258_1235462_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AWJ31583.1|1235478_1235685_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31584.1|1235760_1236165_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
AWJ31585.1|1236180_1236831_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31586.1|1236860_1237208_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ31587.1|1237213_1238215_+|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
1238322:1238442	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 5
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1322250	1412193	5631913	tRNA,head,holin,protease,lysis,integrase,terminase,capsid,tail,transposase	Escherichia_phage(34.78%)	110	1314051:1314065	1355126:1355140
1314051:1314065	attL	TGGTGCGTGAACTGC	NA	NA	NA	NA
AWJ31663.1|1322250_1322481_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWJ31664.1|1322619_1322994_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWJ31665.1|1322997_1323870_+	copper resistance protein D	NA	NA	NA	NA	NA
AWJ31666.1|1323882_1324224_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWJ31667.1|1324616_1325693_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
AWJ31668.1|1325658_1325940_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
AWJ31669.1|1326046_1326235_-	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
AWJ35866.1|1326227_1326422_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
AWJ31670.1|1326478_1327288_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
AWJ31671.1|1327280_1329932_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.7	0.0e+00
AWJ31672.1|1330030_1330306_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
AWJ35867.1|1330379_1330550_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
AWJ31673.1|1330549_1330771_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
AWJ31674.1|1331191_1331344_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
AWJ31675.1|1331650_1332070_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AWJ31676.1|1332166_1332409_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AWJ31677.1|1332405_1332828_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AWJ31678.1|1332905_1333694_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.8	1.8e-42
AWJ31679.1|1333700_1334447_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.1	2.4e-113
AWJ31680.1|1334469_1335240_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.5e-88
AWJ31681.1|1335255_1335687_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	88.4	1.0e-60
AWJ35868.1|1335720_1336761_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.8	3.8e-61
AWJ31682.1|1336784_1338614_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31683.1|1338762_1338915_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.8	6.0e-16
AWJ31684.1|1339150_1339402_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31685.1|1339473_1340073_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	92.0	3.8e-106
AWJ31686.1|1340072_1340363_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
AWJ31687.1|1340359_1340914_+	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	70.5	2.2e-71
AWJ31688.1|1340910_1341162_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31689.1|1341184_1341766_+	hypothetical protein	NA	Q8VNP5	Enterobacteria_phage	83.1	7.4e-54
AWJ31690.1|1342009_1342207_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AWJ31691.1|1342341_1343055_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ31692.1|1343504_1343936_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ31693.1|1343826_1344093_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31694.1|1344493_1346065_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ31695.1|1346084_1346432_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ31696.1|1346431_1347109_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ31697.1|1347070_1347184_+	copper resistance protein	NA	NA	NA	NA	NA
AWJ31698.1|1347214_1349152_+	sialate O-acetylesterase	NA	A0A0P0ZDW4	Stx2-converting_phage	96.7	0.0e+00
AWJ31699.1|1349287_1349467_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWJ31700.1|1349507_1349780_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
AWJ31701.1|1349856_1350072_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ31702.1|1350076_1350610_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
AWJ31703.1|1350883_1351579_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
AWJ35869.1|1351807_1352275_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	8.5e-69
AWJ31704.1|1352451_1353003_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
AWJ31705.1|1353230_1353413_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
AWJ31706.1|1353348_1353675_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
AWJ31707.1|1353806_1354007_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AWJ31708.1|1354048_1354414_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
AWJ31709.1|1354700_1355264_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
1355126:1355140	attR	GCAGTTCACGCACCA	NA	NA	NA	NA
AWJ31710.1|1355260_1356922_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
AWJ31711.1|1356985_1358923_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
AWJ31712.1|1358967_1359189_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	94.5	1.6e-33
AWJ31713.1|1361715_1362042_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ31714.1|1362051_1362402_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ31715.1|1362398_1362845_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ31716.1|1362841_1363186_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ31717.1|1363251_1363968_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
AWJ31718.1|1363973_1364348_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AWJ31719.1|1364371_1364653_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ31720.1|1364704_1367947_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.9	0.0e+00
AWJ31721.1|1367939_1368281_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ31722.1|1368280_1368979_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
AWJ31723.1|1368989_1369733_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.2e-146
AWJ31724.1|1369630_1370311_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	4.8e-113
AWJ31725.1|1370264_1370471_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31726.1|1370501_1371029_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AWJ31727.1|1371162_1374636_+|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
AWJ31728.1|1374703_1375303_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
AWJ31729.1|1375367_1376681_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
AWJ31730.1|1376682_1376952_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
AWJ31731.1|1377092_1377968_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
AWJ35870.1|1378192_1378564_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ31732.1|1379797_1380454_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
AWJ35871.1|1380454_1380646_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ31733.1|1380750_1380987_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AWJ31734.1|1381104_1382544_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWJ31735.1|1382623_1385257_-	MCE family protein	NA	NA	NA	NA	NA
AWJ31736.1|1385225_1386509_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AWJ31737.1|1386638_1387136_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AWJ31738.1|1387232_1387931_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AWJ31739.1|1387950_1389999_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AWJ31740.1|1390190_1391072_+|protease	protease HtpX	protease	NA	NA	NA	NA
AWJ31741.1|1391117_1392491_-	MFS transporter	NA	NA	NA	NA	NA
AWJ31742.1|1392667_1393459_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AWJ31743.1|1393601_1393841_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31744.1|1393999_1394143_+	PhoP regulon feedback inhibition membrane protein MgrB	NA	NA	NA	NA	NA
AWJ31745.1|1394217_1394505_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35872.1|1395005_1395212_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31746.1|1395173_1395317_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AWJ31747.1|1395329_1395539_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AWJ31748.1|1395704_1396514_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AWJ31749.1|1396510_1397131_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
AWJ31750.1|1397073_1397319_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31751.1|1397505_1397964_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AWJ31752.1|1398018_1398870_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AWJ31753.1|1398882_1399683_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AWJ31754.1|1399745_1400717_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AWJ35873.1|1400687_1400882_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31755.1|1400982_1401192_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31756.1|1402738_1404337_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWJ31757.1|1404467_1405832_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWJ31758.1|1406015_1406594_-	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AWJ31759.1|1406597_1407959_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWJ31760.1|1408032_1408212_+	YoaH family protein	NA	NA	NA	NA	NA
AWJ31761.1|1408331_1408691_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWJ31762.1|1409053_1409398_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31763.1|1409529_1411440_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWJ31764.1|1411497_1412193_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1423608	1464172	5631913	head,protease,tail,transposase,plate	Shigella_phage(50.0%)	57	NA	NA
AWJ31775.1|1423608_1424040_-|transposase	IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
AWJ31776.1|1424047_1425256_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
AWJ31777.1|1425483_1425732_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AWJ35876.1|1425790_1425865_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35875.1|1425867_1425966_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ31778.1|1425998_1427024_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWJ31779.1|1427567_1428098_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
AWJ31780.1|1428288_1428537_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
AWJ31781.1|1428538_1430629_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
AWJ31782.1|1430699_1431632_+	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
AWJ31783.1|1431634_1431856_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31784.1|1431868_1432123_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31785.1|1432124_1432406_+	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
AWJ31786.1|1432402_1432675_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31787.1|1432679_1432973_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31788.1|1432984_1433515_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
AWJ31789.1|1433612_1434155_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
AWJ31790.1|1434158_1434692_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
AWJ31791.1|1434691_1435207_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
AWJ31792.1|1435210_1435762_+	AsnC family protein	NA	NA	NA	NA	NA
AWJ31793.1|1435758_1435944_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31794.1|1435940_1436315_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31795.1|1436307_1436505_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
AWJ31796.1|1436494_1436791_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31797.1|1436787_1437297_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
AWJ31798.1|1437366_1437792_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ31799.1|1437863_1438364_+	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
AWJ35877.1|1438582_1439029_+	lysozyme	NA	B6SD19	Bacteriophage	48.0	1.2e-11
AWJ31800.1|1439038_1439266_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWJ31801.1|1439246_1439555_+	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
AWJ31802.1|1439551_1439842_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
AWJ31803.1|1439844_1440426_+	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
AWJ31804.1|1440425_1442090_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
AWJ35878.1|1442089_1443679_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
AWJ31805.1|1443662_1444988_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
AWJ31806.1|1445106_1445580_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
AWJ31807.1|1445756_1446881_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
AWJ31808.1|1446880_1447828_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
AWJ31809.1|1447871_1448276_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ31810.1|1448272_1448692_+	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
AWJ31811.1|1448688_1449249_+	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
AWJ31812.1|1449249_1449495_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
AWJ31813.1|1449491_1450994_+|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
AWJ31814.1|1451002_1451368_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
AWJ31815.1|1451382_1451859_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
AWJ31816.1|1454025_1455396_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	3.0e-53
AWJ31817.1|1455379_1456504_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
AWJ31818.1|1456493_1457108_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
AWJ31819.1|1457100_1457538_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
AWJ31820.1|1457534_1458620_+	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
AWJ31821.1|1458610_1459171_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
AWJ31822.1|1459170_1460082_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
AWJ35879.1|1460116_1460638_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
AWJ35880.1|1460717_1460921_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWJ31823.1|1461143_1461704_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
AWJ31824.1|1461803_1463843_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
AWJ31825.1|1463989_1464172_+	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
>prophage 7
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1665352	1748047	5631913	head,holin,protease,tail,lysis,terminase,portal,capsid,transposase	Enterobacteria_phage(33.33%)	104	NA	NA
AWJ32019.1|1665352_1667170_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
AWJ32020.1|1667457_1667703_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32021.1|1667699_1668110_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ32022.1|1668120_1668393_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32023.1|1668349_1668535_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32024.1|1668440_1668743_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32025.1|1669034_1670192_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
AWJ32026.1|1670231_1670804_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
AWJ32027.1|1670805_1672017_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AWJ32028.1|1672013_1672352_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
AWJ32029.1|1672348_1672645_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
AWJ32030.1|1672644_1673085_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
AWJ35888.1|1673077_1673251_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32031.1|1673374_1673731_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
AWJ32032.1|1673714_1675376_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	5.7e-277
AWJ32033.1|1675389_1675671_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32034.1|1675927_1676110_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32035.1|1676707_1676878_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32036.1|1676984_1677350_+	multidrug transporter subunit MdtJ	NA	NA	NA	NA	NA
AWJ32037.1|1677336_1677666_+	spermidine export protein MdtI	NA	NA	NA	NA	NA
AWJ32038.1|1677704_1678526_-|protease	serine protease	protease	NA	NA	NA	NA
AWJ32039.1|1678625_1678709_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32040.1|1678801_1679137_-	acid shock protein	NA	NA	NA	NA	NA
AWJ32041.1|1679533_1680787_-	MFS transporter	NA	NA	NA	NA	NA
AWJ32042.1|1680893_1681787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32043.1|1681921_1683142_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32044.1|1683266_1683962_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AWJ35889.1|1683914_1685207_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWJ32045.1|1686021_1686876_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWJ32046.1|1686877_1687495_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWJ35890.1|1687505_1689929_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
AWJ32047.1|1692613_1692919_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWJ35891.1|1693026_1693737_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWJ32048.1|1693739_1694300_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWJ32049.1|1694334_1694676_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWJ32050.1|1694810_1695137_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWJ32051.1|1695173_1695362_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32052.1|1695342_1696557_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWJ32053.1|1696568_1697588_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWJ32054.1|1697645_1697756_+	transporter	NA	NA	NA	NA	NA
AWJ32055.1|1697775_1699071_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
AWJ32056.1|1699090_1699342_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
AWJ32057.1|1699411_1701883_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
AWJ32058.1|1701976_1702168_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ32059.1|1702164_1702353_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ35892.1|1702920_1703130_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32060.1|1703130_1703769_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AWJ35893.1|1703780_1703933_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
AWJ32061.1|1704198_1704618_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AWJ32062.1|1704718_1705000_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
AWJ32063.1|1704983_1705409_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ35894.1|1705431_1706400_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
AWJ32064.1|1706406_1707147_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
AWJ32065.1|1707176_1707947_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
AWJ32066.1|1707947_1708355_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AWJ32067.1|1708351_1708648_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
AWJ32068.1|1708644_1708926_+	DUF4752 domain-containing protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
AWJ32069.1|1708918_1709173_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	96.4	3.3e-43
AWJ32070.1|1709165_1709477_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
AWJ32071.1|1709604_1709823_+	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
AWJ32072.1|1709824_1710370_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	55.2	2.2e-60
AWJ32073.1|1710359_1710755_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
AWJ32074.1|1710989_1711202_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
AWJ32075.1|1711369_1711648_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ32076.1|1711649_1712699_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
AWJ32077.1|1712711_1713071_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
AWJ32078.1|1713067_1713736_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
AWJ32079.1|1714439_1716290_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AWJ32080.1|1716568_1716730_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32081.1|1716728_1716944_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ32082.1|1717818_1718352_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
AWJ32083.1|1718572_1718686_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AWJ32084.1|1718687_1719155_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AWJ32085.1|1719237_1719378_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32086.1|1719620_1719935_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32087.1|1720016_1720241_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AWJ32088.1|1720635_1721181_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	2.8e-79
AWJ32089.1|1721155_1723081_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
AWJ32090.1|1723077_1723284_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ32091.1|1723280_1724882_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
AWJ32092.1|1724862_1726182_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AWJ32093.1|1726191_1726524_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
AWJ32094.1|1727329_1728310_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AWJ32095.1|1728925_1729321_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
AWJ32096.1|1729332_1729686_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ32097.1|1730271_1730667_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
AWJ32098.1|1730674_1731427_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
AWJ32099.1|1731440_1731863_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
AWJ32100.1|1731889_1732303_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
AWJ32101.1|1732283_1734896_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
AWJ32102.1|1734892_1735222_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
AWJ32103.1|1735221_1735920_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
AWJ32104.1|1735925_1736669_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AWJ32105.1|1736566_1737247_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	4.1e-112
AWJ32106.1|1737492_1740969_+|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWJ32107.1|1741036_1741636_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
AWJ32108.1|1741700_1743014_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
AWJ32109.1|1742976_1743285_+|tail	phage tail protein	tail	B6ETG7	Enterobacteria_phage	96.1	9.9e-50
AWJ32110.1|1743397_1743973_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
AWJ32111.1|1744045_1744675_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
AWJ32112.1|1744756_1745398_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
AWJ32113.1|1745428_1745596_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AWJ32114.1|1746338_1746773_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AWJ32115.1|1746913_1748047_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 8
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	1950501	2003638	5631913	tRNA,head,holin,tail,lysis,terminase,portal,capsid,transposase	Escherichia_phage(44.26%)	71	NA	NA
AWJ32277.1|1950501_1951657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
AWJ32278.1|1952111_1953098_-	peptidase M85	NA	NA	NA	NA	NA
AWJ32279.1|1953126_1953318_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32280.1|1953527_1953836_-|tail	phage tail protein	tail	B6ETG7	Enterobacteria_phage	95.1	3.4e-50
AWJ32281.1|1953798_1955112_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
AWJ32282.1|1955176_1955776_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
AWJ32283.1|1955843_1959320_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWJ32284.1|1959565_1960246_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	4.1e-112
AWJ32285.1|1960143_1960887_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AWJ32286.1|1960892_1961591_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
AWJ32287.1|1961590_1961920_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ32288.1|1961916_1964496_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
AWJ32289.1|1964476_1964890_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
AWJ32290.1|1964916_1965348_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ32291.1|1965361_1966114_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
AWJ32292.1|1966121_1966517_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
AWJ32293.1|1966513_1967092_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AWJ32294.1|1967103_1967457_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AWJ32295.1|1967468_1967864_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
AWJ32296.1|1967905_1968931_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
AWJ32297.1|1968986_1969319_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
AWJ32298.1|1969328_1970648_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
AWJ32299.1|1970628_1972230_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
AWJ32300.1|1972226_1972433_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AWJ32301.1|1972429_1974355_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AWJ32302.1|1974329_1974875_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWJ32303.1|1975014_1975116_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32304.1|1975263_1975458_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ32305.1|1975537_1975678_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32306.1|1975645_1976263_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ32307.1|1976412_1976850_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ32308.1|1976846_1977344_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ32309.1|1977343_1977559_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ32310.1|1977557_1977719_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32311.1|1977997_1979848_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AWJ32312.1|1980261_1980528_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32313.1|1981018_1981840_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ32314.1|1981836_1982211_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
AWJ32315.1|1982223_1983273_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	6.9e-111
AWJ32316.1|1983274_1983553_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AWJ32317.1|1983720_1983933_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
AWJ32318.1|1984122_1984227_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32319.1|1984342_1985212_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
AWJ32320.1|1985222_1985486_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AWJ32321.1|1985487_1985652_-	O-polysaccharide acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
AWJ32322.1|1985737_1985950_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AWJ32323.1|1986000_1986357_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
AWJ32324.1|1986334_1986796_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ32325.1|1986792_1987089_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
AWJ32326.1|1987085_1987508_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
AWJ32327.1|1987523_1988336_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	5.7e-121
AWJ32328.1|1988307_1989054_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
AWJ32329.1|1989928_1990351_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
AWJ32330.1|1990347_1990602_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWJ32331.1|1990681_1991101_+	transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AWJ32332.1|1991137_1991341_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35903.1|1991399_1991552_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
AWJ32333.1|1991972_1992194_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AWJ35904.1|1992193_1992364_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AWJ32334.1|1992438_1992714_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AWJ32335.1|1992815_1995416_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
AWJ32336.1|1995408_1996218_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWJ32337.1|1996273_1996423_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
AWJ35905.1|1996460_1996649_+	DUF1187 domain-containing protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
AWJ32338.1|1996748_1996964_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWJ32339.1|1996965_1998201_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
AWJ32340.1|1998252_1999188_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
AWJ32341.1|1999316_2000690_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWJ32342.1|2000719_2000893_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32343.1|2001167_2002151_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWJ35906.1|2002405_2003638_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 9
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2080179	2156267	5631913	head,holin,protease,lysis,integrase,terminase,capsid,tail,transposase	Enterobacteria_phage(30.19%)	85	2093958:2093985	2156404:2156431
AWJ32419.1|2080179_2081229_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWJ32420.1|2081448_2082207_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
AWJ32421.1|2082203_2082794_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWJ32422.1|2082833_2083706_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AWJ32423.1|2083806_2084427_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AWJ32424.1|2084423_2085305_-	phosphatase	NA	NA	NA	NA	NA
AWJ35909.1|2085442_2085487_+	trp operon leader peptide	NA	NA	NA	NA	NA
AWJ32425.1|2085578_2087141_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AWJ32426.1|2087140_2088736_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWJ35910.1|2088739_2090098_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
AWJ32427.1|2090109_2091303_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AWJ32428.1|2091302_2092109_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AWJ32429.1|2092489_2092669_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32430.1|2092754_2093255_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AWJ32431.1|2093300_2093807_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2093958:2093985	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
AWJ35911.1|2094308_2094527_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35912.1|2095132_2095561_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
AWJ32432.1|2097289_2097880_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AWJ32433.1|2098063_2098711_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
AWJ32434.1|2098847_2099033_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32435.1|2099421_2099700_+	secretion protein EspO	NA	NA	NA	NA	NA
AWJ32436.1|2100867_2101437_-	effector protein NleF	NA	NA	NA	NA	NA
AWJ32437.1|2101502_2102414_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
AWJ32438.1|2103783_2103972_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32439.1|2105901_2106444_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
AWJ32440.1|2106588_2106858_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
AWJ32441.1|2106918_2107596_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ32442.1|2107595_2107943_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ32443.1|2107962_2109534_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ32444.1|2109566_2110880_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	2.0e-75
AWJ32445.1|2111031_2111631_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
AWJ32446.1|2111698_2112748_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
AWJ32447.1|2112770_2114309_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ32448.1|2114357_2114705_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ32449.1|2115182_2117633_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
AWJ32450.1|2117975_2118656_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.2	7.7e-111
AWJ32451.1|2118553_2119297_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.6e-149
AWJ32452.1|2119307_2120006_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
AWJ32453.1|2120005_2120347_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
AWJ32454.1|2120339_2123582_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.0	0.0e+00
AWJ32455.1|2123629_2123911_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ32456.1|2123934_2124309_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWJ32457.1|2124323_2125040_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
AWJ32458.1|2125105_2125450_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWJ32459.1|2125446_2125893_-	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AWJ32460.1|2125889_2126240_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ32461.1|2126250_2126577_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
AWJ32462.1|2129103_2129325_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
AWJ32463.1|2129369_2131148_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.6	0.0e+00
AWJ32464.1|2131211_2132873_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
AWJ32465.1|2132869_2133433_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ32466.1|2133721_2134087_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
AWJ32467.1|2134128_2134314_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
AWJ32468.1|2134443_2134584_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35913.1|2134725_2134944_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
AWJ32469.1|2134940_2135165_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32470.1|2135188_2135656_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
AWJ32471.1|2135809_2136379_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AWJ32472.1|2136649_2137183_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
AWJ32473.1|2137233_2137578_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
AWJ32474.1|2137582_2137798_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
AWJ32475.1|2137947_2139801_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
AWJ32476.1|2139849_2139978_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32477.1|2140122_2140389_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32478.1|2141148_2141295_-	antiterminator	NA	NA	NA	NA	NA
AWJ32479.1|2141325_2142015_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AWJ32480.1|2142011_2142377_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
AWJ32481.1|2142377_2143433_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
AWJ32482.1|2143434_2143713_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
AWJ32483.1|2143782_2144040_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32484.1|2144260_2144473_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AWJ32485.1|2144751_2145510_-	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AWJ32486.1|2147136_2147802_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AWJ32487.1|2148602_2149154_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32488.1|2149137_2149365_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ32489.1|2149441_2149849_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWJ35914.1|2150113_2150413_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32490.1|2150485_2150704_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32491.1|2150726_2151134_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AWJ32492.1|2151111_2151345_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32493.1|2151905_2152094_+	cell division inhibitor	NA	NA	NA	NA	NA
AWJ32494.1|2152090_2152279_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ32495.1|2152374_2154846_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
AWJ32496.1|2154910_2155159_+	excisionase	NA	NA	NA	NA	NA
AWJ32497.1|2155136_2156267_+|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2156404:2156431	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2260336	2276544	5631913	tRNA,head,protease,terminase,portal,tail,capsid	uncultured_Caudovirales_phage(90.0%)	22	NA	NA
AWJ32597.1|2260336_2261443_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWJ35922.1|2261478_2262120_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AWJ32598.1|2262123_2263494_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AWJ32599.1|2263661_2264333_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWJ32600.1|2264332_2265793_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AWJ32601.1|2266408_2266690_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32602.1|2266703_2268365_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
AWJ32603.1|2268348_2268705_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
AWJ35923.1|2268827_2269001_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32604.1|2268993_2269434_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
AWJ32605.1|2269433_2269730_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
AWJ32606.1|2269726_2270065_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
AWJ32607.1|2270061_2271273_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
AWJ32608.1|2271274_2271847_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
AWJ32609.1|2271886_2273044_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
AWJ32610.1|2273335_2273638_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32611.1|2273600_2273729_-	trigger factor	NA	NA	NA	NA	NA
AWJ32612.1|2273685_2273958_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32613.1|2273970_2274381_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWJ35924.1|2274390_2274579_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32614.1|2274692_2274944_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32615.1|2275146_2276544_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
>prophage 11
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2294222	2341012	5631913	head,holin,lysis,integrase,terminase,capsid,tail	Escherichia_phage(28.3%)	74	2325126:2325144	2341337:2341355
AWJ32634.1|2294222_2294504_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ32635.1|2294527_2294902_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
AWJ32636.1|2294907_2295624_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AWJ32637.1|2295690_2296035_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ32638.1|2296031_2296478_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ32639.1|2296474_2296825_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ32640.1|2296834_2297161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ32641.1|2299687_2299909_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWJ32642.1|2299953_2301891_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
AWJ32643.1|2301954_2303616_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
AWJ32644.1|2303612_2304176_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ32645.1|2304291_2304471_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	85.7	2.1e-20
AWJ32646.1|2304467_2304833_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
AWJ32647.1|2304874_2305102_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWJ32648.1|2305470_2305695_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32649.1|2305691_2306186_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
AWJ35926.1|2306187_2306274_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32650.1|2306538_2306751_-	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AWJ32651.1|2306828_2307362_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
AWJ32652.1|2307406_2307589_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32653.1|2307557_2307794_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32654.1|2307742_2308087_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32655.1|2308049_2308265_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
AWJ32656.1|2308263_2308425_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32657.1|2308703_2310554_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
AWJ32658.1|2310671_2310875_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AWJ32659.1|2311321_2311720_-	envelope protein	NA	NA	NA	NA	NA
AWJ32660.1|2312129_2312369_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
AWJ32661.1|2313624_2313996_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
AWJ32662.1|2313985_2314357_-	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AWJ32663.1|2314369_2315419_-	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	1.3e-109
AWJ32664.1|2315420_2315699_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AWJ32665.1|2315866_2316079_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
AWJ32666.1|2316626_2317400_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ32667.1|2317751_2318165_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AWJ32668.1|2318180_2318951_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AWJ32669.1|2318972_2319719_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AWJ32670.1|2319725_2320817_-	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	3.9e-133
AWJ32671.1|2320895_2321351_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32672.1|2321556_2321982_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32673.1|2321965_2322238_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AWJ32674.1|2322346_2322748_+	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AWJ32675.1|2322775_2322967_+	antitoxin	NA	NA	NA	NA	NA
AWJ32676.1|2322966_2323254_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWJ32677.1|2323529_2323685_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWJ32678.1|2323686_2323815_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32679.1|2323826_2324216_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ32680.1|2324402_2324588_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35927.1|2324589_2324895_-	hypothetical protein	NA	NA	NA	NA	NA
2325126:2325144	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
AWJ32681.1|2325161_2325350_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AWJ32682.1|2325346_2325538_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ32683.1|2325631_2328103_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	3.4e-55
AWJ32684.1|2328170_2328413_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ32685.1|2328390_2329410_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWJ32686.1|2330069_2330336_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32687.1|2330226_2330658_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
AWJ32688.1|2331223_2332045_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AWJ32689.1|2332041_2332416_-	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	2.1e-33
AWJ32690.1|2332428_2333478_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.2e-109
AWJ32691.1|2333479_2333752_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AWJ32692.1|2333873_2334218_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AWJ32693.1|2334337_2334550_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AWJ32694.1|2334783_2335341_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AWJ32695.1|2335342_2335561_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
AWJ32696.1|2335663_2335999_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
AWJ32697.1|2335991_2336219_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AWJ35928.1|2336215_2336497_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AWJ32698.1|2336529_2337291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	4.9e-74
AWJ32699.1|2337312_2338059_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
AWJ32700.1|2338065_2339136_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
AWJ32701.1|2339207_2339633_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32702.1|2339616_2339940_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AWJ32703.1|2340064_2340541_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AWJ32704.1|2340859_2341012_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
2341337:2341355	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
>prophage 12
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2574700	2638694	5631913	head,holin,lysis,integrase,terminase,capsid,tail,transposase	Escherichia_phage(37.1%)	83	2584650:2584709	2637769:2637833
AWJ32937.1|2574700_2575681_+|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AWJ32938.1|2575795_2575888_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AWJ32939.1|2575900_2577037_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWJ32940.1|2578727_2579585_-	hydrogenase-1 operon protein HyaF	NA	NA	NA	NA	NA
AWJ32941.1|2579581_2579980_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AWJ32942.1|2579976_2580564_-	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
AWJ32943.1|2580560_2581268_-	Ni/Fe-hydrogenase, b-type cytochrome subunit	NA	NA	NA	NA	NA
AWJ32944.1|2581286_2583080_-	hydrogenase-1 large chain	NA	NA	NA	NA	NA
AWJ32945.1|2583076_2584195_-	hydrogenase-1 small chain	NA	NA	NA	NA	NA
2584650:2584709	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
AWJ32946.1|2584790_2584943_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
AWJ32947.1|2585319_2586681_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
AWJ32948.1|2586743_2587019_+	secretion protein EspO	NA	NA	NA	NA	NA
AWJ32949.1|2587135_2587405_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
AWJ32950.1|2587442_2589014_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ32951.1|2589033_2589381_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ32952.1|2589380_2590058_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ32953.1|2590019_2590163_+	copper resistance protein	NA	NA	NA	NA	NA
AWJ32954.1|2590113_2591427_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
AWJ32955.1|2591491_2592091_-	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
AWJ32956.1|2592157_2595634_-|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	96.4	0.0e+00
AWJ32957.1|2595879_2596557_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	5.3e-112
AWJ32958.1|2596454_2597198_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
AWJ32959.1|2597203_2597902_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ32960.1|2597901_2598243_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ32961.1|2598235_2601478_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
AWJ32962.1|2601525_2601807_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ32963.1|2601830_2602205_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AWJ32964.1|2602219_2602936_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
AWJ32965.1|2603001_2603346_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
AWJ32966.1|2603342_2603789_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ32967.1|2603785_2604136_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ32968.1|2604145_2604472_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ32969.1|2606997_2607219_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWJ32970.1|2607263_2609201_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
AWJ32971.1|2609264_2610926_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
AWJ32972.1|2610922_2611486_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ32973.1|2611778_2612144_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
AWJ32974.1|2612185_2612410_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
AWJ32975.1|2612491_2612806_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32976.1|2613046_2613187_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32977.1|2613269_2613737_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	2.1e-67
AWJ32978.1|2613893_2614463_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	4.4e-104
AWJ32979.1|2614737_2615271_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
AWJ32980.1|2615275_2615491_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ32981.1|2615568_2615814_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AWJ32982.1|2615854_2616034_-	DUF1378 domain-containing protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
AWJ32983.1|2616169_2618107_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
AWJ32984.1|2618427_2618694_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ32985.1|2618584_2619016_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
AWJ32986.1|2619465_2620179_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWJ32987.1|2620313_2620634_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.1	2.7e-34
AWJ35946.1|2620752_2621283_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AWJ32988.1|2621291_2621651_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
AWJ32989.1|2621663_2622710_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.6e-107
AWJ32990.1|2622711_2622984_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
AWJ32991.1|2623119_2623377_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
AWJ32992.1|2623382_2623682_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
AWJ32993.1|2623886_2624231_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
AWJ32994.1|2624227_2624593_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
AWJ32995.1|2624594_2624813_-	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
AWJ32996.1|2624900_2625536_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
AWJ32997.1|2625701_2625884_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
AWJ32998.1|2625917_2626130_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
AWJ32999.1|2626180_2626537_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
AWJ33000.1|2626514_2626976_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
AWJ33001.1|2626972_2627269_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
AWJ33002.1|2627265_2627673_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
AWJ33003.1|2627673_2628399_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
AWJ33004.1|2628432_2629095_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.2e-78
AWJ33005.1|2629983_2630421_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
AWJ33006.1|2630417_2630678_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
AWJ33007.1|2630804_2631197_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
AWJ33008.1|2631243_2631603_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
AWJ33009.1|2631605_2631908_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
AWJ33010.1|2632243_2632543_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33011.1|2632614_2632833_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33012.1|2632836_2633052_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33013.1|2633401_2633590_+	cell division inhibitor	NA	NA	NA	NA	NA
AWJ33014.1|2633586_2633775_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWJ33015.1|2633869_2636320_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
AWJ33016.1|2636387_2636630_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWJ33017.1|2636607_2637627_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
AWJ33018.1|2638034_2638694_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2637769:2637833	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 13
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	2866737	2917812	5631913	holin,protease,lysis,integrase,terminase,portal,tail,transposase	Enterobacteria_phage(49.25%)	72	2914979:2914994	2922050:2922065
AWJ33216.1|2866737_2867313_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
AWJ33217.1|2867373_2868051_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ33218.1|2868050_2868398_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ33219.1|2868417_2869989_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ33220.1|2870463_2870835_+|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	95.1	1.1e-58
AWJ33221.1|2870958_2871792_-	cell division protein	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
AWJ33222.1|2872008_2872890_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
AWJ33223.1|2872995_2873265_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
AWJ33224.1|2873266_2874481_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.8	4.0e-78
AWJ33225.1|2875211_2878688_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AWJ33226.1|2878933_2879614_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	4.1e-112
AWJ33227.1|2879511_2880255_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
AWJ33228.1|2880260_2880959_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
AWJ33229.1|2880958_2881288_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AWJ33230.1|2881284_2883864_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
AWJ33231.1|2883844_2884258_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
AWJ33232.1|2884284_2884716_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
AWJ33233.1|2884729_2885482_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
AWJ33234.1|2885489_2885858_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
AWJ33235.1|2885854_2887393_-|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
AWJ33236.1|2887441_2887789_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
AWJ33237.1|2887785_2888190_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWJ33238.1|2888267_2888444_-|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	56.4	1.1e-08
AWJ33239.1|2888433_2890026_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
AWJ33240.1|2890022_2890229_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AWJ33241.1|2890212_2892141_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
AWJ33242.1|2892112_2892622_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
AWJ33243.1|2893017_2893212_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AWJ33244.1|2893291_2893432_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33245.1|2893399_2894017_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AWJ33246.1|2894166_2894604_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
AWJ33247.1|2894600_2895098_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
AWJ33248.1|2895097_2895313_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AWJ33249.1|2895311_2895473_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33250.1|2898158_2898875_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33251.1|2899086_2899776_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AWJ33252.1|2899790_2899913_-	YlcG family protein	NA	NA	NA	NA	NA
AWJ33253.1|2900251_2901214_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
AWJ33254.1|2901421_2901610_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWJ33255.1|2901606_2901969_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
AWJ33256.1|2901965_2902256_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
AWJ33257.1|2902255_2902978_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
AWJ33258.1|2902970_2903180_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
AWJ33259.1|2903139_2903541_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
AWJ33260.1|2903543_2903720_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWJ33261.1|2903716_2904127_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
AWJ33262.1|2904098_2904455_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
AWJ33263.1|2904751_2905042_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AWJ33264.1|2905038_2905740_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
AWJ33265.1|2905736_2906675_-	Replication protein O	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
AWJ33266.1|2906707_2907007_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
AWJ33267.1|2907145_2907379_-	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
AWJ33268.1|2907492_2908197_+	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
AWJ33269.1|2908465_2908828_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
AWJ33270.1|2909434_2909707_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
AWJ33271.1|2909729_2910269_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
AWJ33272.1|2910632_2911493_+	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
AWJ33273.1|2911517_2911649_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
AWJ33274.1|2911633_2911786_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
AWJ33275.1|2912042_2912648_+	recombinase	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
AWJ33276.1|2912647_2913031_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
AWJ33277.1|2913054_2913348_+	RecBCD nuclease inhibitor	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
AWJ35954.1|2913358_2913523_+	DUF2737 domain-containing protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
AWJ33278.1|2913519_2914077_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
AWJ33279.1|2914073_2914631_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
AWJ33280.1|2914632_2915250_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
2914979:2914994	attL	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
AWJ33281.1|2915246_2915549_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
AWJ33282.1|2915541_2915826_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
AWJ33283.1|2915898_2916066_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AWJ33284.1|2916094_2916439_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
AWJ33285.1|2916545_2916764_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWJ33286.1|2916741_2917812_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
2922050:2922065	attR	CCTGCCGCGCCGCCAT	NA	NA	NA	NA
>prophage 14
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3146452	3171337	5631913	head,protease,capsid,tail,transposase	Enterobacteria_phage(52.38%)	25	NA	NA
AWJ33491.1|3146452_3147406_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AWJ33492.1|3147592_3149032_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ33493.1|3149259_3149565_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AWJ35960.1|3149663_3150290_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ33494.1|3150234_3150372_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWJ33495.1|3150928_3153889_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
AWJ33496.1|3153953_3154553_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
AWJ33497.1|3154623_3158037_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
AWJ33498.1|3158097_3158730_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
AWJ33499.1|3159415_3160114_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
AWJ33500.1|3160113_3160443_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
AWJ33501.1|3160439_3163001_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
AWJ33502.1|3162993_3163428_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWJ33503.1|3163409_3163832_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWJ35961.1|3163847_3164588_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
AWJ33504.1|3164595_3164991_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
AWJ33505.1|3164987_3165566_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
AWJ33506.1|3165556_3165931_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
AWJ33507.1|3165942_3166338_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWJ33508.1|3166379_3167405_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AWJ33509.1|3167460_3167793_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
AWJ33510.1|3167802_3168681_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
AWJ33511.1|3168721_3169399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ33512.1|3169398_3169746_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ33513.1|3169765_3171337_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 15
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3414913	3519911	5631913	tRNA,head,holin,lysis,terminase,capsid,tail	Stx2-converting_phage(32.35%)	109	NA	NA
AWJ33733.1|3414913_3415651_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWJ33734.1|3415782_3417117_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWJ33735.1|3417325_3418207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ33736.1|3418309_3418897_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWJ33737.1|3418952_3419336_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWJ33738.1|3419640_3420330_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWJ33739.1|3420377_3421415_-	methyltransferase	NA	NA	NA	NA	NA
AWJ33740.1|3421404_3421608_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33741.1|3421621_3422041_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWJ33742.1|3422109_3422808_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWJ33743.1|3422839_3425500_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWJ33744.1|3425613_3426969_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWJ33745.1|3427014_3427338_+	lipoprotein	NA	NA	NA	NA	NA
AWJ33746.1|3427334_3428633_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWJ33747.1|3428614_3428728_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWJ33748.1|3434486_3437060_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AWJ33749.1|3437189_3437921_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWJ33750.1|3437917_3438898_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWJ33751.1|3439032_3439770_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWJ33752.1|3439799_3440006_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33753.1|3440040_3440382_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWJ35968.1|3440485_3440533_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33754.1|3440631_3441792_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWJ33755.1|3441834_3442956_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWJ33756.1|3442966_3444037_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
AWJ33757.1|3444246_3444612_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33758.1|3444761_3445280_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWJ33759.1|3445269_3446496_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWJ33760.1|3446511_3446994_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33761.1|3447070_3447418_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWJ33762.1|3447459_3448227_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWJ33763.1|3448257_3448806_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWJ33764.1|3448824_3449073_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWJ33765.1|3449321_3450683_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ35969.1|3450849_3451641_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ35970.1|3451706_3452948_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWJ33766.1|3453002_3453596_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWJ33767.1|3453592_3453787_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWJ33768.1|3453718_3454597_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWJ33769.1|3454682_3456344_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWJ33770.1|3456492_3456834_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWJ33771.1|3456895_3457186_-	RnfH family protein	NA	NA	NA	NA	NA
AWJ33772.1|3457175_3457652_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWJ33773.1|3457783_3458266_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWJ33774.1|3460019_3461381_+	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
AWJ33775.1|3468312_3468582_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
AWJ33776.1|3468583_3469897_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
AWJ33777.1|3469961_3470561_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
AWJ33778.1|3470628_3474102_-|tail	phage tail protein	tail	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
AWJ33779.1|3474347_3475025_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	5.3e-112
AWJ33780.1|3474922_3475666_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
AWJ33781.1|3475671_3476370_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ33782.1|3476369_3476711_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ33783.1|3476703_3479946_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.1	0.0e+00
AWJ33784.1|3479997_3480279_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
AWJ33785.1|3480302_3480677_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
AWJ33786.1|3481464_3481809_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ33787.1|3481805_3482252_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ33788.1|3482248_3482599_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ33789.1|3482608_3482935_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ33790.1|3485461_3485683_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWJ33791.1|3485727_3487665_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
AWJ33792.1|3487728_3489390_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
AWJ33793.1|3489386_3489950_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AWJ33794.1|3490240_3490606_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
AWJ33795.1|3490647_3490875_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AWJ33796.1|3491243_3491468_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33797.1|3491464_3491959_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.2	9.0e-77
AWJ33798.1|3492257_3492791_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
AWJ33799.1|3492841_3493186_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
AWJ33800.1|3493190_3493406_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
AWJ33801.1|3493482_3493755_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AWJ33802.1|3493795_3493975_-	DUF1378 domain-containing protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
AWJ33803.1|3494110_3496048_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
AWJ33804.1|3496096_3496225_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33805.1|3496369_3496636_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ33806.1|3497167_3498094_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33807.1|3498080_3498629_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ33808.1|3498641_3498983_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
AWJ33809.1|3499000_3499990_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
AWJ33810.1|3499997_3500795_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
AWJ33811.1|3500814_3501204_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
AWJ33812.1|3501200_3501527_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
AWJ33813.1|3501523_3502177_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
AWJ33814.1|3502176_3502671_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
AWJ33815.1|3502667_3503486_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
AWJ35971.1|3503482_3503707_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
AWJ33816.1|3503711_3504548_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
AWJ33817.1|3504544_3505096_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AWJ33818.1|3505139_3505340_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWJ33819.1|3505430_3506105_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
AWJ33820.1|3506504_3506699_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	98.4	1.7e-31
AWJ33821.1|3506771_3507134_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ33822.1|3507199_3508024_+	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
AWJ33823.1|3508152_3508689_+	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
AWJ33824.1|3508679_3509558_+	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	94.8	4.2e-170
AWJ33825.1|3509554_3509758_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
AWJ33826.1|3509750_3509990_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
AWJ33827.1|3509986_3510316_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
AWJ33828.1|3510317_3511181_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
AWJ33829.1|3511265_3511508_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
AWJ33830.1|3511511_3511658_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
AWJ33831.1|3511666_3511876_+	excisionase	NA	I6PBM8	Cronobacter_phage	88.2	1.6e-30
AWJ33832.1|3511830_3513006_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
AWJ35972.1|3513488_3514397_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	99.7	5.2e-171
AWJ35973.1|3514695_3515916_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
AWJ33833.1|3515954_3516371_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
AWJ33834.1|3516442_3518191_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
AWJ33835.1|3518192_3519911_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 16
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3592561	3599701	5631913		Escherichia_phage(83.33%)	6	NA	NA
AWJ33903.1|3592561_3595123_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
AWJ33904.1|3595228_3595885_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
AWJ33905.1|3595935_3596703_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWJ33906.1|3596898_3597807_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWJ33907.1|3597803_3599066_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWJ33908.1|3599062_3599701_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 17
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	3751387	3759336	5631913	transposase,integrase	Stx2-converting_phage(42.86%)	9	3749344:3749360	3758429:3758445
3749344:3749360	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AWJ34046.1|3751387_3752959_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ34047.1|3752978_3753326_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ34048.1|3753325_3754003_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ34049.1|3753964_3754090_+	copper resistance protein	NA	NA	NA	NA	NA
AWJ34050.1|3754195_3754396_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ34051.1|3754397_3755126_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
AWJ34052.1|3756034_3756694_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
AWJ34053.1|3756686_3758294_-|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
AWJ34054.1|3758580_3759336_-	lipoprotein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
3758429:3758445	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 18
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	4622565	4635897	5631913	transposase	Enterobacteria_phage(66.67%)	17	NA	NA
AWJ34864.1|4622565_4623735_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.1	1.7e-198
AWJ34865.1|4623754_4625614_+	helicase	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
AWJ34866.1|4625610_4626036_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ34867.1|4626363_4626936_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AWJ34868.1|4627009_4627510_-	transactivation protein	NA	NA	NA	NA	NA
AWJ34869.1|4627506_4628241_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
AWJ34870.1|4628588_4628780_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ34871.1|4628792_4629059_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AWJ34872.1|4629055_4629655_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
AWJ34873.1|4629647_4629935_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWJ34874.1|4629927_4630383_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
AWJ34875.1|4630457_4632029_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ34876.1|4632048_4632396_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ34877.1|4632395_4633073_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ34878.1|4633049_4633232_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ34879.1|4633228_4633549_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ34880.1|4633563_4635897_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
>prophage 19
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	4887174	4989774	5631913	tRNA,head,holin,tail,lysis,integrase,terminase,portal,capsid,transposase,plate	Escherichia_phage(47.92%)	110	4920212:4920258	4951669:4951715
AWJ35104.1|4887174_4887612_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWJ35105.1|4887608_4888598_+	acetyltransferase	NA	NA	NA	NA	NA
AWJ35106.1|4888661_4889570_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWJ35107.1|4889798_4890110_+	toxin HigB-2	NA	NA	NA	NA	NA
AWJ35108.1|4890110_4890401_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ36030.1|4891011_4891224_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWJ35109.1|4891466_4891685_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35110.1|4891913_4892894_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
AWJ35111.1|4892885_4893146_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35112.1|4893293_4894223_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWJ35113.1|4894219_4894855_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AWJ35114.1|4894851_4895754_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AWJ35115.1|4895766_4898817_-	formate dehydrogenase O subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AWJ35116.1|4898820_4899075_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35117.1|4899010_4899844_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AWJ35118.1|4899996_4901037_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AWJ35119.1|4901086_4902835_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AWJ35120.1|4902834_4903905_-	peptidase	NA	NA	NA	NA	NA
AWJ35121.1|4903894_4905346_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
AWJ35122.1|4905356_4905803_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AWJ35123.1|4906115_4906430_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AWJ35124.1|4906426_4907575_-	lactaldehyde reductase	NA	NA	NA	NA	NA
AWJ35125.1|4907646_4908471_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWJ35126.1|4908553_4909813_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWJ35127.1|4909809_4911279_-	rhamnulokinase	NA	NA	NA	NA	NA
AWJ35128.1|4912387_4913326_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AWJ35129.1|4913322_4914357_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AWJ35130.1|4914641_4915262_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
AWJ35131.1|4915436_4915544_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWJ35132.1|4915521_4916505_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWJ35133.1|4916653_4917328_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWJ35134.1|4917469_4918843_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWJ35135.1|4918839_4919538_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWJ36031.1|4919687_4920188_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
4920212:4920258	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AWJ35136.1|4920374_4921355_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AWJ35137.1|4921424_4921718_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AWJ35138.1|4921854_4922127_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AWJ35139.1|4922296_4922797_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWJ35140.1|4922860_4923085_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
AWJ35141.1|4923084_4923387_+	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
AWJ35142.1|4923386_4923611_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AWJ35143.1|4923607_4923883_+	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AWJ35144.1|4923872_4926149_+	replication protein A	NA	Q858T4	Yersinia_virus	98.1	0.0e+00
AWJ35145.1|4926350_4927295_+	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
AWJ35146.1|4927302_4928292_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35147.1|4928281_4929403_-	chromosome partitioning protein ParB	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
AWJ35148.1|4929817_4930852_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AWJ35149.1|4930851_4932624_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AWJ35150.1|4932797_4933652_+|capsid	capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
AWJ35151.1|4933710_4934784_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
AWJ35152.1|4934787_4935531_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	96.8	9.2e-126
AWJ35153.1|4935630_4936140_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWJ35154.1|4936139_4936343_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWJ35155.1|4936346_4936628_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AWJ35156.1|4936627_4937125_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
AWJ35157.1|4937139_4937565_+	protein lysA	NA	Q858W1	Yersinia_virus	88.7	1.6e-58
AWJ35158.1|4937552_4937978_+	protein lysB	NA	Q858W0	Yersinia_virus	97.2	2.1e-66
AWJ35159.1|4937949_4938123_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AWJ35160.1|4938085_4938553_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
AWJ35161.1|4938545_4938998_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
AWJ35162.1|4939064_4939700_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.4e-113
AWJ35163.1|4939696_4940044_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
AWJ35164.1|4940048_4940957_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
AWJ35165.1|4940949_4941561_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
AWJ35166.1|4941557_4942745_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	84.9	1.6e-156
AWJ35167.1|4942748_4943168_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.1	8.5e-36
AWJ35168.1|4943139_4943742_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	89.5	1.6e-96
AWJ35169.1|4943741_4944272_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	97.2	6.8e-99
AWJ35170.1|4944302_4944896_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	96.4	1.5e-102
AWJ35171.1|4944955_4946146_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AWJ35172.1|4946158_4946677_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWJ35173.1|4946733_4947009_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
AWJ35174.1|4947041_4947161_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWJ35175.1|4947153_4949601_+|tail	phage tail tape measure protein	tail	A0A0F7LCI6	Escherichia_phage	96.6	0.0e+00
AWJ35176.1|4949615_4950095_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
AWJ35177.1|4951302_4951557_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWJ35178.1|4951793_4952696_+	cation-efflux pump FieF	NA	NA	NA	NA	NA
4951669:4951715	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
AWJ35179.1|4952876_4953839_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AWJ35180.1|4954157_4955147_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ35181.1|4955253_4956009_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AWJ35182.1|4956063_4956831_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AWJ35183.1|4956938_4957538_-	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AWJ35184.1|4957638_4958079_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AWJ35185.1|4958290_4958590_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AWJ35186.1|4958616_4959045_+	universal stress protein D	NA	NA	NA	NA	NA
AWJ35187.1|4959049_4959796_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AWJ35188.1|4959892_4960903_-	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
AWJ35189.1|4961037_4962546_-	glycerol kinase	NA	NA	NA	NA	NA
AWJ35190.1|4962568_4963414_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AWJ35191.1|4963838_4964084_+	cell division protein ZapB	NA	NA	NA	NA	NA
AWJ35192.1|4964168_4964654_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWJ35193.1|4964746_4965673_-	prenyltransferase	NA	NA	NA	NA	NA
AWJ35194.1|4965739_4967071_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AWJ35195.1|4967080_4967611_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AWJ35196.1|4967703_4968663_-	cell division protein FtsN	NA	NA	NA	NA	NA
AWJ35197.1|4968754_4969780_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ35198.1|4969935_4972134_-	primosomal protein N'	NA	NA	NA	NA	NA
AWJ35199.1|4972336_4972549_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AWJ35200.1|4972708_4976881_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
AWJ35201.1|4976882_4977119_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35202.1|4977889_4978183_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35203.1|4978111_4978720_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35204.1|4978903_4979221_-	met repressor	NA	NA	NA	NA	NA
AWJ35205.1|4979497_4980658_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AWJ35206.1|4980660_4983093_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AWJ35207.1|4983441_4984332_+	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AWJ35208.1|4984660_4986841_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
AWJ35209.1|4986934_4987840_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWJ35210.1|4987866_4988484_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AWJ35211.1|4988793_4989774_-|transposase	IS110 family transposase IS621	transposase	NA	NA	NA	NA
>prophage 20
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5121831	5186759	5631913	tRNA,head,holin,lysis,integrase,terminase,capsid,tail	Enterobacteria_phage(28.99%)	84	5134011:5134025	5190352:5190366
AWJ35314.1|5121831_5121954_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AWJ35315.1|5122189_5122762_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AWJ35316.1|5122758_5123178_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35317.1|5123438_5123720_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.2e-43
AWJ35318.1|5123756_5124329_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.4	5.1e-108
AWJ35319.1|5124328_5124895_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	92.5	4.0e-97
AWJ36036.1|5124891_5125179_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.9	1.4e-53
AWJ35320.1|5125408_5125957_-	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
AWJ36037.1|5125953_5126163_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	100.0	8.8e-34
AWJ35321.1|5126174_5126786_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
AWJ35322.1|5126776_5127313_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
AWJ35323.1|5127440_5128265_-	DUF2303 domain-containing protein	NA	Q8SBF9	Shigella_phage	98.9	3.9e-149
AWJ35324.1|5128330_5128693_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWJ35325.1|5129150_5129804_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
AWJ35326.1|5129899_5130097_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
AWJ35327.1|5130124_5130709_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	60.3	1.6e-56
AWJ35328.1|5130705_5131851_+	peptidase	NA	A5LH69	Enterobacteria_phage	85.3	8.5e-179
AWJ35329.1|5131847_5132072_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
AWJ35330.1|5132068_5132887_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
AWJ35331.1|5132883_5133378_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	5.2e-85
AWJ35332.1|5133377_5134031_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
5134011:5134025	attL	GTCAGGGAGATGGCG	NA	NA	NA	NA
AWJ35333.1|5134027_5134354_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWJ35334.1|5134350_5134740_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AWJ35335.1|5134759_5135569_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
AWJ35336.1|5135584_5136100_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
AWJ35337.1|5136109_5137099_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
AWJ35338.1|5137112_5137865_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
AWJ35339.1|5137950_5138160_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	2.0e-25
AWJ35340.1|5138432_5139380_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
AWJ35341.1|5139389_5139659_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
AWJ35342.1|5139809_5140037_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
AWJ35343.1|5140158_5140248_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	6.3e-10
AWJ35344.1|5140287_5142096_+	sialate O-acetylesterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
AWJ35345.1|5142231_5142411_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AWJ35346.1|5142451_5142724_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
AWJ35347.1|5142800_5143016_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AWJ35348.1|5143020_5143554_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
AWJ35349.1|5143827_5144523_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
AWJ36038.1|5144751_5145219_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	88.4	8.5e-69
AWJ35350.1|5145395_5145947_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
AWJ35351.1|5146174_5146357_+	hypothetical protein	NA	H6WZK4	Escherichia_phage	100.0	4.5e-26
AWJ35352.1|5146292_5146619_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
AWJ35353.1|5146750_5146951_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AWJ35354.1|5146992_5147358_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
AWJ35355.1|5147326_5147455_+	DNase	NA	NA	NA	NA	NA
AWJ35356.1|5147646_5148210_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AWJ35357.1|5148206_5149868_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
AWJ35358.1|5149931_5151869_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
AWJ36039.1|5151913_5152135_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
AWJ35359.1|5154660_5154987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AWJ35360.1|5154996_5155347_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AWJ35361.1|5155343_5155790_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AWJ35362.1|5155786_5156131_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AWJ35363.1|5156197_5156914_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
AWJ35364.1|5156919_5157294_+|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
AWJ35365.1|5157317_5157599_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AWJ35366.1|5157646_5160889_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
AWJ35367.1|5160881_5161223_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
AWJ35368.1|5161222_5161921_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AWJ35369.1|5161926_5162670_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
AWJ35370.1|5162567_5163245_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.1	5.3e-112
AWJ35371.1|5163490_5166967_+|tail	phage tail protein	tail	Q687E8	Enterobacteria_phage	97.1	0.0e+00
AWJ35372.1|5167033_5167633_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
AWJ35373.1|5167697_5169011_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
AWJ35374.1|5169012_5169282_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AWJ35375.1|5169691_5170297_+	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
AWJ36040.1|5170521_5170893_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
AWJ35376.1|5171765_5172014_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AWJ35377.1|5172075_5173173_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
AWJ35378.1|5173261_5174299_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AWJ35379.1|5174432_5174675_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AWJ35380.1|5174840_5175824_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AWJ35381.1|5175906_5177322_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWJ35382.1|5177374_5178472_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	2.4e-29
AWJ35383.1|5178706_5179900_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AWJ35384.1|5180121_5180664_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35385.1|5181026_5181740_+	class B acid phosphatase	NA	NA	NA	NA	NA
AWJ35386.1|5181850_5182267_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AWJ35387.1|5182270_5182627_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AWJ35388.1|5182661_5185484_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWJ35389.1|5185434_5185617_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ35390.1|5185737_5186274_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AWJ35391.1|5186372_5186654_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ35392.1|5186612_5186759_+|integrase	integrase	integrase	NA	NA	NA	NA
5190352:5190366	attR	CGCCATCTCCCTGAC	NA	NA	NA	NA
>prophage 21
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5466251	5472474	5631913	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
AWJ35652.1|5466251_5466929_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ35653.1|5466928_5467276_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ35654.1|5467295_5468867_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ35655.1|5469176_5469449_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
AWJ35656.1|5469450_5470005_-	phage polarity suppression protein	NA	NA	NA	NA	NA
AWJ35657.1|5470001_5470754_-	septation initiation protein	NA	NA	NA	NA	NA
AWJ35658.1|5471668_5471929_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
AWJ35659.1|5471925_5472474_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
>prophage 22
CP028112	Escherichia coli O103 str. RM8385 chromosome, complete genome	5631913	5496579	5503136	5631913	transposase	Stx2-converting_phage(100.0%)	9	NA	NA
AWJ35682.1|5496579_5498151_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AWJ35683.1|5498170_5498518_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWJ35684.1|5498517_5499195_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWJ35685.1|5499156_5499270_+	copper resistance protein	NA	NA	NA	NA	NA
AWJ35686.1|5499262_5499403_-	hemolysin activation protein	NA	NA	NA	NA	NA
AWJ35687.1|5499949_5500351_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWJ35688.1|5500800_5501205_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AWJ35689.1|5501201_5501549_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWJ35690.1|5501597_5503136_+|transposase	IS66 family transposase ISEc22	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 1
CP028113	Escherichia coli O103 str. RM8385 plasmid pRM8385-1, complete sequence	94220	696	65227	94220	transposase,protease	Stx2-converting_phage(43.75%)	48	NA	NA
AWJ36060.1|696_1062_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36061.1|4094_4442_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ36062.1|4438_5113_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ36063.1|6399_10302_+|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
AWJ36064.1|10606_10789_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36065.1|11105_11450_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
AWJ36066.1|11517_12729_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
AWJ36067.1|13497_13818_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AWJ36068.1|14038_16759_-	relaxase NikB	NA	NA	NA	NA	NA
AWJ36069.1|16770_17103_-	nikA protein	NA	NA	NA	NA	NA
AWJ36070.1|17334_17670_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AWJ36127.1|17755_18604_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWJ36071.1|19182_19434_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWJ36128.1|19464_19686_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36072.1|19709_20600_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
AWJ36073.1|20664_20931_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36074.1|21023_21458_-	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AWJ36075.1|21454_21670_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36076.1|22185_22686_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
AWJ36129.1|23147_23465_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
AWJ36077.1|23741_24461_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWJ36078.1|24457_24940_-	recombinase	NA	NA	NA	NA	NA
AWJ36079.1|24984_25419_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWJ36130.1|25430_25649_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36080.1|25648_26332_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
AWJ36131.1|26715_27618_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AWJ36081.1|27890_28850_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
AWJ36082.1|28849_29245_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWJ36083.1|30205_30595_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
AWJ36084.1|30638_32849_-	Catalase-peroxidase 2	NA	NA	NA	NA	NA
AWJ36085.1|33033_34246_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
AWJ36086.1|35040_36018_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AWJ36087.1|36180_36408_+	hypothetical protein	NA	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
AWJ36088.1|36461_37136_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
AWJ36089.1|37132_37480_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
AWJ36090.1|37483_39052_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	6.6e-158
AWJ36091.1|39564_39948_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ36092.1|39875_40289_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36093.1|40239_41427_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWJ36094.1|45413_45890_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
AWJ36095.1|49016_49247_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ36096.1|59818_60850_-	replication initiation protein	NA	NA	NA	NA	NA
AWJ36097.1|60837_60927_-	positive regulator for repZ translation	NA	NA	NA	NA	NA
AWJ36098.1|61034_61265_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ36099.1|61551_62193_+	transcription termination factor NusG	NA	NA	NA	NA	NA
AWJ36100.1|62333_62999_+	traC	NA	NA	NA	NA	NA
AWJ36101.1|62962_63112_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AWJ36102.1|63658_65227_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	6.6e-158
