The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	0	2277	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWI98160.1|0_2277_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.8	0.0e+00
>prophage 2
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	5284	44563	4722506	lysis,transposase,portal,holin,terminase,tail,capsid,plate,head	Escherichia_phage(54.84%)	40	NA	NA
AWI98164.1|5284_6313_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	98.8	4.3e-198
AWI98165.1|6312_8085_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AWI98166.1|8258_9113_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	98.9	1.2e-156
AWI98167.1|9171_10245_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
AWI98168.1|10248_10992_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.0	3.3e-123
AWI98169.1|11090_11600_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWI98170.1|11599_11803_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AWI98171.1|11806_12088_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWI98172.1|12087_12585_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	98.8	4.5e-92
AWI98173.1|12599_13025_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.0	2.8e-58
AWI98174.1|13012_13438_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.7	1.4e-65
AWI98175.1|13409_13583_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AWI98176.1|13545_14013_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
AWI98177.1|14005_14458_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AWI98178.1|14524_15160_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AWI98179.1|15156_15504_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AWI98180.1|15508_16417_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.0	9.8e-162
AWI98181.1|16409_16940_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
AWI98182.1|16950_19173_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	40.8	8.8e-156
AWI98183.1|19176_19704_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	3.1e-91
AWI98184.1|20060_21596_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02463.1|21971_22706_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98185.1|23147_24338_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	9.0e-224
AWI98186.1|24350_24869_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWI98187.1|24925_25201_+	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	98.9	2.8e-40
AWJ02464.1|25233_25353_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWI98188.1|25345_27793_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.1	0.0e+00
AWI98189.1|27807_28287_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
AWI98190.1|28286_29450_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.2	1.6e-204
AWI98191.1|29495_29750_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWI98192.1|30022_31384_-	peptidase	NA	Q6DW11	Phage_TP	99.7	1.9e-217
AWI98193.1|31530_31863_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWI98194.1|32053_32776_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AWI98195.1|32772_34176_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
AWI98196.1|34172_35588_-	MFS transporter	NA	NA	NA	NA	NA
AWI98197.1|35588_38666_-	multidrug resistance protein MdtC	NA	NA	NA	NA	NA
AWI98198.1|38666_41789_-	multidrug transporter subunit MdtB	NA	NA	NA	NA	NA
AWI98199.1|41788_43036_-	multidrug transporter subunit MdtA	NA	NA	NA	NA	NA
AWJ02465.1|43314_43371_+	small toxic protein IbsB	NA	NA	NA	NA	NA
AWI98200.1|43450_44563_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	48638	49991	4722506		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWI98204.1|48638_49991_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 4
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	54716	65162	4722506		Catovirus(20.0%)	8	NA	NA
AWI98208.1|54716_55358_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AWI98209.1|55449_56031_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
AWI98210.1|56052_57906_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWI98211.1|58198_59782_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AWI98212.1|60440_61580_+	lipoprotein	NA	NA	NA	NA	NA
AWI98213.1|61585_62029_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AWI98214.1|62031_64194_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AWI98215.1|64322_65162_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 5
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	69405	76199	4722506		Synechococcus_phage(25.0%)	6	NA	NA
AWI98221.1|69405_70527_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
AWI98222.1|70529_71495_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	8.4e-87
AWI98223.1|71497_71977_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AWI98224.1|71973_73197_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AWI98225.1|73199_74636_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	2.8e-46
AWI98226.1|74828_76199_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	5.8e-33
>prophage 6
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	81911	83306	4722506		Klebsiella_phage(100.0%)	1	NA	NA
AWI98231.1|81911_83306_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.8e-18
>prophage 7
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	87387	88206	4722506		Catovirus(100.0%)	1	NA	NA
AWI98234.1|87387_88206_+	LicD family protein	NA	A0A1V0SAS8	Catovirus	50.0	1.6e-09
>prophage 8
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	92979	100784	4722506		Catovirus(25.0%)	7	NA	NA
AWI98240.1|92979_94014_+	UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase	NA	A0A1V0SAI8	Catovirus	35.2	4.5e-38
AWI98241.1|94015_95119_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AWI98242.1|95118_96249_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	47.8	4.9e-102
AWI98243.1|96248_97460_+	glycosyltransferase WbuB	NA	NA	NA	NA	NA
AWI98244.1|97446_97845_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWI98245.1|97961_99368_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
AWI98246.1|99617_100784_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	3.5e-111
>prophage 9
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	108136	109036	4722506		Cellulophaga_phage(100.0%)	1	NA	NA
AWI98254.1|108136_109036_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 10
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	116650	164149	4722506	transposase,holin,terminase,tail,head	Salmonella_phage(34.38%)	77	NA	NA
AWI98263.1|116650_117829_+	DUF4102 domain-containing protein	NA	A0A0P0ZDN8	Stx2-converting_phage	99.7	4.0e-232
AWI98264.1|117809_118001_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AWI98265.1|118082_118394_-	hypothetical protein	NA	A0A1I9LJL8	Stx_converting_phage	98.1	1.8e-54
AWI98266.1|118629_119277_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	35.7	1.7e-19
AWJ02470.1|119822_119990_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	96.4	4.3e-23
AWI98267.1|120000_120297_-	RecBCD nuclease inhibitor	NA	G9L665	Escherichia_phage	86.7	2.1e-41
AWI98268.1|120320_120908_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	98.5	4.2e-105
AWI98269.1|120904_121585_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
AWI98270.1|121593_121782_-	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
AWI98271.1|121778_122018_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.5	2.2e-36
AWI98272.1|122097_122466_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AWI98273.1|122656_122839_-	hypothetical protein	NA	K7PLT6	Enterobacteria_phage	98.3	2.1e-31
AWI98274.1|122972_123311_-	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
AWI98275.1|123313_123619_-	regulator	NA	K7PJM7	Enterobacteria_phage	98.0	1.6e-47
AWI98276.1|123933_124584_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
AWI98277.1|124664_124850_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
AWI98278.1|124965_125262_+	hypothetical protein	NA	K7PKU6	Enterobacteria_phage	99.0	4.4e-47
AWI98279.1|125442_126333_+	DNA replication protein	NA	Q716D3	Shigella_phage	98.6	1.9e-157
AWI98280.1|126307_127759_+	helicase DnaB	NA	Q08J37	Stx2-converting_phage	99.4	2.5e-276
AWI98281.1|127817_128276_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AWJ02471.1|128272_128800_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
AWI98282.1|128796_128973_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
AWI98283.1|128975_129335_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.8	2.0e-62
AWI98284.1|129334_129511_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
AWI98285.1|129503_130226_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	1.6e-130
AWI98286.1|130225_130516_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	97.9	5.5e-50
AWI98287.1|130512_130875_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AWI98288.1|130871_131060_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AWI98289.1|131056_131680_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.2e-113
AWI98290.1|132489_132813_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AWI98291.1|132796_133273_+	lysozyme	NA	K7P7Y6	Enterobacteria_phage	94.3	7.3e-84
AWI98292.1|133256_133649_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	2.5e-50
AWI98293.1|133536_133812_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	65.1	1.1e-20
AWI98294.1|133792_133978_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98295.1|134110_134725_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98296.1|134678_135230_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
AWI98297.1|135232_136855_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.9	0.0e+00
AWI98298.1|136854_138321_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	94.3	3.3e-268
AWI98299.1|138208_138946_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	5.0e-108
AWI98300.1|138960_140181_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.8	1.7e-201
AWI98301.1|140185_140689_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	82.6	1.6e-73
AWI98302.1|140700_141642_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	5.4e-155
AWI98303.1|141684_141906_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
AWI98304.1|141871_142279_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
AWI98305.1|142275_142830_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.3	7.9e-82
AWI98306.1|142816_143206_+|head,tail	head-tail adaptor	head,tail	A0A0M3ULK0	Salmonella_phage	95.3	4.3e-66
AWI98307.1|143180_143744_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
AWI98308.1|143747_144893_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	1.8e-160
AWI98309.1|144903_145344_+	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AWI98310.1|145347_145800_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	74.7	1.9e-57
AWI98311.1|145811_145988_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	70.0	1.6e-12
AWI98312.1|145977_147966_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.2	1.6e-270
AWI98313.1|147965_148553_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	9.9e-83
AWI98314.1|148552_148855_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	9.1e-48
AWI98315.1|148857_149919_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	2.0e-158
AWI98316.1|149922_150264_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.3	2.1e-32
AWI98317.1|150432_151005_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98318.1|151006_151423_+	toxin YafO, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWI98319.1|151465_152221_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	86.9	3.7e-114
AWI98320.1|152220_152574_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	1.5e-54
AWI98321.1|152573_153773_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	8.3e-185
AWI98322.1|153769_154450_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	1.0e-102
AWI98323.1|155159_155585_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	76.3	4.3e-27
AWI98324.1|155717_155912_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98325.1|155851_155983_+	umuD domain protein	NA	O64339	Escherichia_phage	61.9	5.2e-08
AWI98326.1|156306_157473_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	2.9e-227
AWI98327.1|157591_158065_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AWI98328.1|158263_159322_+	FUSC family protein	NA	NA	NA	NA	NA
AWI98329.1|159493_159823_+	DUF496 domain-containing protein	NA	NA	NA	NA	NA
AWI98330.1|159923_160106_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
AWJ02472.1|160138_161113_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWI98331.1|161666_161780_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AWJ02473.1|161792_161984_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98332.1|162445_162814_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWI98333.1|162887_163109_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AWI98334.1|163171_163618_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AWI98335.1|163663_164149_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	5.3e-13
>prophage 11
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	180780	181942	4722506	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
AWI98350.1|180780_181942_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 12
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	191818	192349	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWI98353.1|191818_192349_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	1.2e-55
>prophage 13
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	195893	208344	4722506		Bacillus_phage(28.57%)	12	NA	NA
AWJ02475.1|195893_196565_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AWI98358.1|196564_197923_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
AWI98359.1|198030_198882_-	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWI98360.1|199474_200548_-	porin	NA	Q1MVN1	Enterobacteria_phage	51.9	2.8e-99
AWI98361.1|201114_201480_+	permease	NA	NA	NA	NA	NA
AWI98362.1|201519_202215_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	7.3e-08
AWI98363.1|202281_203700_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
AWI98364.1|203680_204151_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
AWI98365.1|205233_206151_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWI98366.1|206229_206412_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AWJ02476.1|206540_206729_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98367.1|206649_208344_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	5.9e-19
>prophage 14
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	222964	223633	4722506		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWI98386.1|222964_223633_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	4.5e-79
>prophage 15
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	235450	238653	4722506	transposase	Bacillus_virus(50.0%)	5	NA	NA
AWI98400.1|235450_236203_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
AWI98401.1|236432_237155_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AWI98402.1|237221_237446_-	DUF2594 domain-containing protein	NA	NA	NA	NA	NA
AWJ02479.1|237511_237634_+	ABC transporter	NA	NA	NA	NA	NA
AWI98403.1|237672_238653_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
>prophage 16
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	250991	253043	4722506		Synechococcus_phage(100.0%)	1	NA	NA
AWI98415.1|250991_253043_+	RNA polymerase subunit sigma	NA	G8CLC7	Synechococcus_phage	35.3	6.5e-28
>prophage 17
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	267310	268825	4722506		Cedratvirus(100.0%)	1	NA	NA
AWI98430.1|267310_268825_+	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 18
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	278912	284556	4722506		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AWI98441.1|278912_280574_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AWI98442.1|280619_282221_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AWI98443.1|282239_283100_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AWI98444.1|283102_284152_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AWI98445.1|284166_284556_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 19
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	289808	291542	4722506	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWI98451.1|289808_291542_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 20
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	298935	300986	4722506		Synechococcus_phage(50.0%)	3	NA	NA
AWI98456.1|298935_299679_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AWI98457.1|299719_300115_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98458.1|300167_300986_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.9e-71
>prophage 21
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	305004	312068	4722506		Bacillus_virus(50.0%)	9	NA	NA
AWI98463.1|305004_305526_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AWI98464.1|305527_306130_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02480.1|306200_306266_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98465.1|306404_307016_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWI98466.1|307024_308035_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AWI98467.1|308181_308967_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWI98468.1|308963_309719_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AWJ02481.1|309797_310730_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWI98469.1|310745_312068_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 22
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	316066	317542	4722506		Cyanophage(100.0%)	1	NA	NA
AWI98473.1|316066_317542_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 23
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	325598	330068	4722506		Klebsiella_phage(33.33%)	7	NA	NA
AWI98481.1|325598_326261_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWI98482.1|326284_326941_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWI98483.1|327042_327273_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWI98484.1|327411_327786_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AWI98485.1|327789_328662_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98486.1|328674_329016_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AWI98487.1|329411_330068_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
>prophage 24
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	337564	339613	4722506	protease,tail	Moraxella_phage(100.0%)	1	NA	NA
AWI98493.1|337564_339613_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 25
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	344943	345153	4722506		Morganella_phage(100.0%)	1	NA	NA
AWI98501.1|344943_345153_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 26
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	350793	352350	4722506		Moraxella_phage(100.0%)	1	NA	NA
AWI98510.1|350793_352350_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 27
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	356212	364318	4722506	tRNA	Pandoravirus(33.33%)	8	NA	NA
AWI98514.1|356212_357574_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
AWI98515.1|357647_357827_+	YoaH family protein	NA	NA	NA	NA	NA
AWI98516.1|357946_358306_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AWI98517.1|358667_359012_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98518.1|359143_361054_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	3.8e-91
AWI98519.1|361111_361807_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWI98520.1|361846_362428_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98521.1|362632_364318_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 28
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	378847	382606	4722506		Bacillus_phage(100.0%)	2	NA	NA
AWI98539.1|378847_379294_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	29.5	7.2e-09
AWI98540.1|381322_382606_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 29
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	385924	386779	4722506		Indivirus(100.0%)	1	NA	NA
AWI98543.1|385924_386779_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.5	3.3e-10
>prophage 30
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	396366	400452	4722506		Staphylococcus_phage(50.0%)	4	NA	NA
AWI98552.1|396366_397347_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
AWI98553.1|397483_398242_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWI98554.1|398359_399718_+	MFS transporter	NA	NA	NA	NA	NA
AWI98555.1|399810_400452_-	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
>prophage 31
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	405378	407340	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWI98562.1|405378_407340_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.8e-40
>prophage 32
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	412938	413592	4722506		Bacillus_phage(100.0%)	1	NA	NA
AWI98569.1|412938_413592_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 33
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	420356	421577	4722506		Klosneuvirus(100.0%)	1	NA	NA
AWI98577.1|420356_421577_+	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 34
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	429053	429881	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWI98585.1|429053_429881_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 35
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	436987	439249	4722506		Tupanvirus(100.0%)	1	NA	NA
AWI98593.1|436987_439249_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 36
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	450376	471155	4722506	transposase,tRNA	Staphylococcus_phage(20.0%)	21	NA	NA
AWJ02490.1|450376_451351_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AWI98607.1|451615_453544_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AWI98608.1|453547_454090_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AWI98609.1|454186_454384_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWI98610.1|454436_454793_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWJ02491.1|454915_454960_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AWI98611.1|455243_456227_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AWI98612.1|456241_458629_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWI98613.1|458633_458933_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWI98614.1|459033_460014_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AWI98615.1|460076_460628_+	glutathione peroxidase	NA	NA	NA	NA	NA
AWI98616.1|460627_461377_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AWI98617.1|461454_461919_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
AWI98618.1|462165_462879_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWI98619.1|462941_464378_+	YdiU family protein	NA	NA	NA	NA	NA
AWI98620.1|464381_464573_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AWI98621.1|464704_465751_-	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
AWI98622.1|465907_466741_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AWI98623.1|466852_467020_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98624.1|467073_469452_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
AWJ02492.1|469508_471155_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	2.9e-31
>prophage 37
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	490576	495660	4722506		Lake_Baikal_phage(33.33%)	5	NA	NA
AWI98641.1|490576_490945_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
AWI98642.1|490953_492441_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AWI98643.1|492450_493197_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
AWI98644.1|493171_494443_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AWI98645.1|494439_495660_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 38
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	503949	506216	4722506		Escherichia_phage(50.0%)	3	NA	NA
AWJ02493.1|503949_504618_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
AWI98654.1|504614_505400_+	protein PhsC	NA	NA	NA	NA	NA
AWI98655.1|505403_506216_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 39
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	511720	520601	4722506		Orpheovirus(20.0%)	9	NA	NA
AWI98660.1|511720_512362_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AWI98661.1|512401_513550_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AWI98662.1|513840_515052_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWI98663.1|515164_516097_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWI98664.1|516093_517119_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AWI98665.1|517106_517331_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98666.1|517417_517507_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AWI98667.1|519076_519658_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AWI98668.1|519785_520601_-	murein DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 40
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	529403	530902	4722506		Indivirus(50.0%)	2	NA	NA
AWI98676.1|529403_530300_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
AWJ02494.1|530380_530902_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 41
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	537831	539106	4722506	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWI98684.1|537831_539106_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 42
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	558982	560794	4722506		Vaccinia_virus(100.0%)	1	NA	NA
AWI98706.1|558982_560794_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 43
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	570688	571990	4722506		Bacillus_phage(100.0%)	1	NA	NA
AWI98713.1|570688_571990_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 44
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	582090	682956	4722506	protease,holin,portal,terminase,tail,transposase,integrase	Enterobacteria_phage(47.62%)	98	642122:642137	696710:696725
AWI98726.1|582090_582912_-|protease	serine protease	protease	NA	NA	NA	NA
AWI98727.1|583011_583095_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98728.1|583187_583523_-	acid shock protein	NA	NA	NA	NA	NA
AWI98729.1|583919_585173_-	MFS transporter	NA	NA	NA	NA	NA
AWI98730.1|585279_586173_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWI98731.1|586307_587528_+	protein mlc	NA	NA	NA	NA	NA
AWI98732.1|587652_588348_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AWJ02497.1|588300_589593_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWI98733.1|589750_590365_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AWI98734.1|590407_591262_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWI98735.1|591263_591881_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AWI98736.1|594375_596802_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
AWI98737.1|597000_597306_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWJ02498.1|597413_598124_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWI98738.1|598126_598687_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWI98739.1|598721_599063_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWI98740.1|599197_599524_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWI98741.1|599560_599749_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98742.1|599729_600944_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWI98743.1|600955_601975_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
AWI98744.1|602032_602161_+	transporter	NA	NA	NA	NA	NA
AWI98745.1|602914_604077_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWI98746.1|605246_606408_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWI98747.1|606590_606779_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98748.1|606983_607706_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWI98749.1|607895_608111_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	8.5e-32
AWI98750.1|608115_608427_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
AWI98751.1|608423_608957_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	3.2e-96
AWI98752.1|608953_609451_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AWI98753.1|609814_610027_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWI98754.1|610037_610226_+	cold-shock protein	NA	NA	NA	NA	NA
AWI98755.1|610256_610529_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98756.1|610701_610875_+	protein GnsB	NA	NA	NA	NA	NA
AWI98757.1|611170_611377_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AWJ02499.1|611927_612467_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
AWI98758.1|612475_614575_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.3	0.0e+00
AWI98759.1|614571_614784_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWI98760.1|614783_616292_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
AWI98761.1|616140_618264_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
AWI98762.1|618305_618674_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	99.1	9.7e-52
AWI98763.1|618666_618942_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AWI98764.1|618953_619532_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
AWJ02501.1|619528_619930_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AWI98765.1|619940_620684_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
AWJ02500.1|620744_621131_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AWI98766.1|621139_621469_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.2e-55
AWI98767.1|624504_624834_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
AWI98768.1|624843_625542_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	3.3e-133
AWI98769.1|625547_626291_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.7e-149
AWI98770.1|626188_626836_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	4.3e-111
AWI98771.1|626896_630310_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
AWI98772.1|630379_630979_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
AWI98773.1|631043_634118_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
AWI98774.1|634117_634693_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AWI98775.1|634790_635381_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWI98776.1|635698_635932_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWI98777.1|636717_638001_+	MFS transporter	NA	NA	NA	NA	NA
AWI98778.1|638089_639550_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
AWI98779.1|639584_639788_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AWI98780.1|639964_640651_-	transcriptional regulator	NA	NA	NA	NA	NA
AWI98781.1|640739_641486_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWJ02502.1|641622_643668_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
642122:642137	attL	CCCTGACCAGCCAGTT	NA	NA	NA	NA
AWI98782.1|643711_644230_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
AWI98783.1|644507_644900_+	TIGR00156 family protein	NA	NA	NA	NA	NA
AWI98784.1|645154_646045_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
AWI98785.1|646263_646359_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98786.1|646485_647673_-	transporter	NA	NA	NA	NA	NA
AWI98787.1|647867_648767_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AWI98788.1|648797_649016_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AWI98789.1|649047_649431_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AWI98790.1|649451_649886_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AWI98791.1|650105_650426_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
AWI98792.1|650415_650700_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWI98793.1|650820_651486_+	stress protection protein MarC	NA	NA	NA	NA	NA
AWI98794.1|651510_652701_-	sugar efflux transporter	NA	NA	NA	NA	NA
AWI98795.1|654242_655124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWI98796.1|655224_656613_+	succinate semialdehyde dehydrogenase [NAD(P)+] Sad	NA	NA	NA	NA	NA
AWI98797.1|656676_657603_+	glutaminase 2	NA	NA	NA	NA	NA
AWI98798.1|657602_657962_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AWJ02503.1|658571_659519_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	4.8e-18
AWI98799.1|659469_659601_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWI98800.1|659745_661197_+	altronate oxidoreductase	NA	NA	NA	NA	NA
AWI98801.1|661253_661454_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98802.1|661403_662318_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98803.1|662321_663080_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AWI98804.1|663136_663427_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AWI98805.1|663450_664326_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase LsrF	NA	NA	NA	NA	NA
AWI98806.1|664352_665375_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
AWI98807.1|665386_666379_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
AWI98808.1|666378_667407_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AWI98809.1|667400_668936_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
AWI98810.1|669184_670138_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AWI98811.1|670216_671809_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
AWI98812.1|677978_678245_+	transcriptional regulator	NA	NA	NA	NA	NA
AWI98813.1|678244_679567_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AWI98814.1|679577_679727_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98815.1|679805_681329_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AWI98816.1|681291_682956_+|integrase	integrase	integrase	NA	NA	NA	NA
696710:696725	attR	AACTGGCTGGTCAGGG	NA	NA	NA	NA
>prophage 45
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	689175	689916	4722506		Salmonella_phage(100.0%)	1	NA	NA
AWI98822.1|689175_689916_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	62.6	1.2e-88
>prophage 46
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	696487	696832	4722506		Macacine_betaherpesvirus(100.0%)	1	NA	NA
AWJ02504.1|696487_696832_+	hypothetical protein	NA	I3WFA4	Macacine_betaherpesvirus	50.9	9.5e-09
>prophage 47
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	712144	714940	4722506		Powai_lake_megavirus(100.0%)	1	NA	NA
AWI98831.1|712144_714940_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 48
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	720214	724021	4722506		Bacillus_virus(50.0%)	2	NA	NA
AWI98834.1|720214_721597_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
AWI98835.1|721597_724021_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 49
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	728337	730243	4722506		Planktothrix_phage(100.0%)	2	NA	NA
AWI98840.1|728337_729324_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	4.2e-17
AWI98841.1|729316_730243_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 50
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	733516	734957	4722506		Tupanvirus(50.0%)	2	NA	NA
AWI98846.1|733516_734527_+	zinc-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
AWI98847.1|734672_734957_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 51
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	746644	748189	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWI98853.1|746644_748189_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 52
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	761305	763408	4722506		Salmonella_phage(100.0%)	1	NA	NA
AWI98868.1|761305_763408_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.0	6.9e-134
>prophage 53
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	770538	780699	4722506	protease,transposase	Mycoplasma_phage(20.0%)	9	NA	NA
AWI98877.1|770538_771552_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
AWI98878.1|772946_774353_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWI98879.1|774431_774848_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AWI98880.1|774893_775070_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AWI98881.1|775291_775522_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AWI98882.1|775613_777575_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.3	2.7e-23
AWI98883.1|777647_778184_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWI98884.1|778236_779451_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
AWI98885.1|779490_780699_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
>prophage 54
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	792503	793452	4722506		Moraxella_phage(50.0%)	2	NA	NA
AWI98896.1|792503_792677_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AWI98897.1|792921_793452_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 55
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	797391	801294	4722506		Klosneuvirus(100.0%)	1	NA	NA
AWI98901.1|797391_801294_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 56
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	809782	810772	4722506		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWI98907.1|809782_810772_+	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 57
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	815732	823003	4722506	tRNA	Enterobacteria_phage(20.0%)	7	NA	NA
AWI98912.1|815732_816866_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.3	3.1e-117
AWI98913.1|817006_817441_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AWI98914.1|817617_818553_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
AWI98915.1|818681_820055_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWI98916.1|820084_820258_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98917.1|820532_821516_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWJ02510.1|821770_823003_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 58
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	829329	829845	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWI98923.1|829329_829845_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 59
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	862297	863563	4722506		Klosneuvirus(100.0%)	1	NA	NA
AWI98954.1|862297_863563_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	9.2e-25
>prophage 60
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	876478	882135	4722506		Bacillus_virus(50.0%)	5	NA	NA
AWI98968.1|876478_877285_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AWI98969.1|877352_877706_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98970.1|878073_878862_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AWI98971.1|879005_880133_+	CMD domain-containing protein	NA	NA	NA	NA	NA
AWI98972.1|880200_882135_+	exoribonuclease 2	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 61
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	889952	890543	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWI98983.1|889952_890543_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 62
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	895467	900759	4722506	protease	Tupanvirus(33.33%)	5	NA	NA
AWI98989.1|895467_898065_-	DNA topoisomerase 1	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
AWI98990.1|898187_898400_-	hypothetical protein	NA	NA	NA	NA	NA
AWI98991.1|898444_898696_+	hypothetical protein	NA	NA	NA	NA	NA
AWI98992.1|898731_899781_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AWI98993.1|900000_900759_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
>prophage 63
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	907728	910686	4722506		Acinetobacter_phage(100.0%)	2	NA	NA
AWI99000.1|907728_909324_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AWJ02514.1|909327_910686_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
>prophage 64
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	922344	924359	4722506		Bacillus_virus(50.0%)	2	NA	NA
AWI99014.1|922344_923349_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AWI99015.1|923345_924359_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 65
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	932769	944331	4722506	transposase	Escherichia_phage(40.0%)	12	NA	NA
AWI99021.1|932769_933387_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
AWI99022.1|933990_934404_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AWI99023.1|934547_935456_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AWI99024.1|935657_936671_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AWI99025.1|936762_937668_-	patatin family protein	NA	NA	NA	NA	NA
AWJ02518.1|937748_937835_+	ABC transporter	NA	NA	NA	NA	NA
AWI99026.1|937873_938854_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AWI99027.1|938980_939439_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99028.1|939488_940331_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AWI99029.1|941408_942086_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AWI99030.1|942085_942796_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AWI99031.1|942792_944331_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 66
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	955586	955817	4722506		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
AWI99039.1|955586_955817_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 67
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	958915	962923	4722506		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
AWI99044.1|958915_959770_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AWI99045.1|959805_960615_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AWI99046.1|960618_961011_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99047.1|961007_961841_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWI99048.1|961840_962923_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 68
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	966059	968811	4722506		Tupanvirus(50.0%)	2	NA	NA
AWJ02521.1|966059_967007_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AWI99052.1|967131_968811_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 69
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	995480	997168	4722506		Salmonella_phage(50.0%)	2	NA	NA
AWI99075.1|995480_996749_-	protein UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
AWI99076.1|996748_997168_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 70
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1013874	1017607	4722506		Enterobacteria_phage(66.67%)	4	NA	NA
AWI99098.1|1013874_1014606_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
AWI99099.1|1014826_1015231_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AWI99100.1|1015930_1016254_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AWI99101.1|1016356_1017607_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	96.3	3.2e-22
>prophage 71
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1020743	1022114	4722506		Bodo_saltans_virus(100.0%)	1	NA	NA
AWI99105.1|1020743_1022114_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 72
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1027135	1029113	4722506		Mycoplasma_phage(100.0%)	2	NA	NA
AWI99110.1|1027135_1028272_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AWI99111.1|1028255_1029113_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 73
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1032370	1036111	4722506		Vibrio_phage(50.0%)	4	NA	NA
AWI99116.1|1032370_1033210_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
AWI99117.1|1033225_1034137_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWI99118.1|1034165_1035410_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AWI99119.1|1035409_1036111_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 74
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1043399	1043657	4722506		Erwinia_phage(100.0%)	1	NA	NA
AWI99124.1|1043399_1043657_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 75
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1055963	1057606	4722506		Streptococcus_virus(50.0%)	2	NA	NA
AWI99136.1|1055963_1056968_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	41.4	6.4e-05
AWI99137.1|1056964_1057606_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 76
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1060878	1062060	4722506		Ralstonia_phage(50.0%)	2	NA	NA
AWI99141.1|1060878_1061115_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AWI99142.1|1061325_1062060_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	6.5e-15
>prophage 77
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1074417	1075359	4722506		Brevibacillus_phage(100.0%)	1	NA	NA
AWI99154.1|1074417_1075359_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 78
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1091242	1091488	4722506		Salmonella_phage(100.0%)	1	NA	NA
AWI99174.1|1091242_1091488_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 79
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1096902	1097823	4722506		Morganella_phage(100.0%)	1	NA	NA
AWI99181.1|1096902_1097823_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 80
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1107131	1107665	4722506		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AWI99189.1|1107131_1107665_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 81
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1111800	1112634	4722506		Pelagibacter_phage(100.0%)	1	NA	NA
AWI99198.1|1111800_1112634_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 82
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1118808	1119873	4722506		Cronobacter_phage(100.0%)	1	NA	NA
AWI99203.1|1118808_1119873_-	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 83
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1134511	1136785	4722506		Enterobacteria_phage(100.0%)	3	NA	NA
AWI99217.1|1134511_1135006_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
AWI99218.1|1135026_1136355_+	transporter	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
AWI99219.1|1136611_1136785_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 84
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1141867	1154182	4722506		Klosneuvirus(20.0%)	13	NA	NA
AWI99225.1|1141867_1142788_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AWI99226.1|1142787_1143093_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AWI99227.1|1143244_1143844_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AWI99228.1|1143840_1146387_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
AWI99229.1|1146386_1147559_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AWI99230.1|1147688_1148381_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AWI99231.1|1148353_1149382_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AWI99232.1|1149464_1152209_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
AWI99233.1|1152280_1153354_+	electron transporter YccM	NA	NA	NA	NA	NA
AWI99234.1|1153402_1153576_-	protein GnsA	NA	NA	NA	NA	NA
AWI99235.1|1153565_1153796_-	cold-shock protein	NA	NA	NA	NA	NA
AWJ02535.1|1153770_1153959_-	cold-shock protein	NA	NA	NA	NA	NA
AWI99236.1|1153969_1154182_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 85
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1174223	1174883	4722506		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWI99254.1|1174223_1174883_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 86
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1179116	1181171	4722506		Bacillus_phage(100.0%)	1	NA	NA
AWI99262.1|1179116_1181171_-	helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 87
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1193770	1195678	4722506		Tupanvirus(100.0%)	1	NA	NA
AWI99273.1|1193770_1195678_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 88
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1210871	1217331	4722506	tRNA	Bacillus_virus(33.33%)	4	NA	NA
AWI99288.1|1210871_1211639_+	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AWI99289.1|1211681_1214294_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AWI99290.1|1214559_1215762_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AWI99291.1|1215930_1217331_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 89
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1221292	1221841	4722506		Rhodobacter_phage(100.0%)	1	NA	NA
AWJ02540.1|1221292_1221841_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 90
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1236545	1241087	4722506		Bacillus_phage(100.0%)	3	NA	NA
AWI99305.1|1236545_1238294_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AWI99306.1|1238330_1240595_-	ComEC family protein	NA	NA	NA	NA	NA
AWI99307.1|1240802_1241087_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 91
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1246173	1247262	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWI99312.1|1246173_1247262_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 92
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1251360	1254575	4722506		Tetraselmis_virus(100.0%)	2	NA	NA
AWI99316.1|1251360_1253643_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AWI99317.1|1253834_1254575_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 93
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1258498	1282396	4722506	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
AWI99321.1|1258498_1259116_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AWI99322.1|1259126_1261571_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AWI99323.1|1261809_1263102_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AWI99324.1|1263192_1264536_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AWI99325.1|1264546_1265158_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWI99326.1|1265312_1269341_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AWI99327.1|1269475_1269970_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWI99328.1|1270514_1271480_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AWI99329.1|1271602_1273369_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AWI99330.1|1273369_1275091_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
AWI99331.1|1275132_1275837_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWI99332.1|1276121_1276340_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWI99333.1|1277202_1279479_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
AWI99334.1|1279509_1279830_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AWI99335.1|1280152_1280377_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AWI99336.1|1280449_1282396_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 94
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1291693	1293412	4722506		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AWI99344.1|1291693_1293412_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 95
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1296999	1299737	4722506		Roseobacter_phage(50.0%)	4	NA	NA
AWI99347.1|1296999_1297830_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AWI99348.1|1297826_1298150_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99349.1|1298275_1298791_+	lipoprotein	NA	NA	NA	NA	NA
AWI99350.1|1299008_1299737_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 96
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1303097	1312247	4722506		Streptococcus_phage(25.0%)	12	NA	NA
AWI99355.1|1303097_1304225_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
AWI99356.1|1304265_1304754_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWI99357.1|1304813_1305659_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWI99358.1|1305655_1306609_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWI99359.1|1306618_1307752_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AWI99360.1|1307846_1308959_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWI99361.1|1308942_1309104_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWI99362.1|1309309_1309786_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWI99363.1|1309873_1310776_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AWI99364.1|1310836_1311559_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWI99365.1|1311542_1311830_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWI99366.1|1311989_1312247_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 97
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1320813	1322016	4722506		Stx2-converting_phage(100.0%)	1	NA	NA
AWJ02542.1|1320813_1322016_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 98
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1333351	1335223	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWI99384.1|1333351_1335223_-	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 99
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1338438	1346780	4722506		Synechococcus_phage(33.33%)	6	NA	NA
AWI99388.1|1338438_1339101_-	fructose-6-phosphate aldolase 1	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
AWI99389.1|1339231_1340131_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AWI99390.1|1340136_1342569_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
AWI99391.1|1342714_1343530_+	sugar phosphatase YbiV	NA	NA	NA	NA	NA
AWI99392.1|1343681_1344947_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AWI99393.1|1345187_1346780_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 100
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1351777	1357002	4722506		Escherichia_phage(33.33%)	7	NA	NA
AWI99399.1|1351777_1352293_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AWI99400.1|1352645_1353533_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWI99401.1|1353831_1354335_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AWI99402.1|1354620_1354812_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99403.1|1354738_1355485_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWI99404.1|1355623_1356283_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AWI99405.1|1356279_1357002_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
>prophage 101
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1360542	1375498	4722506		Erwinia_phage(14.29%)	13	NA	NA
AWI99408.1|1360542_1360947_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AWI99409.1|1361211_1363494_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AWI99410.1|1363535_1364213_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AWI99411.1|1364286_1364553_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AWI99412.1|1364817_1365078_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWI99413.1|1365306_1366392_-	dehydrogenase	NA	NA	NA	NA	NA
AWI99414.1|1366532_1367495_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWI99415.1|1367522_1369673_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
AWI99416.1|1369792_1370275_+	swarming motility protein YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
AWI99417.1|1370506_1371871_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AWJ02544.1|1372099_1372771_+	transcriptional regulator	NA	NA	NA	NA	NA
AWI99418.1|1372770_1373769_+	secretion protein HlyD	NA	NA	NA	NA	NA
AWI99419.1|1373761_1375498_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 102
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1386095	1387004	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWI99433.1|1386095_1387004_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 103
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1393485	1414339	4722506	transposase,integrase,terminase,coat	Escherichia_phage(42.86%)	19	1395401:1395415	1414413:1414427
AWI99439.1|1393485_1394775_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
AWI99440.1|1394833_1395310_+	kinase inhibitor	NA	NA	NA	NA	NA
AWI99441.1|1395224_1395404_+	hypothetical protein	NA	NA	NA	NA	NA
1395401:1395415	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AWI99442.1|1396055_1397387_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	2.5e-20
AWI99443.1|1399885_1401025_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
AWI99444.1|1401123_1401888_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
AWI99445.1|1401992_1403105_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	2.7e-113
AWI99446.1|1403088_1404495_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	6.1e-187
AWI99447.1|1404497_1405799_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	7.2e-150
AWI99448.1|1405779_1406874_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.8	3.1e-114
AWJ02545.1|1406877_1407087_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99449.1|1407791_1408953_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AWI99450.1|1409249_1410038_-	transcriptional regulator	NA	R4TG31	Halovirus	40.9	9.7e-49
AWI99451.1|1409955_1410237_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99452.1|1410175_1411633_-	potassium transporter TrkG	NA	NA	NA	NA	NA
AWI99453.1|1411829_1412015_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AWI99454.1|1412910_1413033_+	hypothetical protein	NA	A0A2I6PID7	Escherichia_phage	96.9	5.5e-12
AWI99455.1|1413072_1413291_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWI99456.1|1413268_1414339_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
1414413:1414427	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 104
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1424142	1430716	4722506		Planktothrix_phage(33.33%)	8	NA	NA
AWI99464.1|1424142_1425201_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AWI99465.1|1425203_1425893_-	molybdenum ABC transporter permease	NA	NA	NA	NA	NA
AWI99466.1|1425892_1426666_-	molybdate-binding periplasmic protein	NA	NA	NA	NA	NA
AWI99467.1|1426687_1426897_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99468.1|1426832_1426982_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AWI99469.1|1427110_1427899_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWI99470.1|1427966_1429439_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
AWI99471.1|1429699_1430716_+	UDP-glucose 4-epimerase	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 105
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1435069	1438589	4722506		Klebsiella_phage(33.33%)	4	NA	NA
AWI99476.1|1435069_1436122_-	phospho-2-dehydro-3-deoxyheptonate aldolase Phe-sensitive	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
AWI99477.1|1436437_1436818_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99478.1|1436931_1437873_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
AWI99479.1|1437869_1438589_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 106
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1475266	1476058	4722506		Kaumoebavirus(100.0%)	1	NA	NA
AWI99508.1|1475266_1476058_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 107
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1479436	1482486	4722506		Acinetobacter_phage(50.0%)	2	NA	NA
AWI99513.1|1479436_1480918_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
AWI99514.1|1481067_1482486_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
>prophage 108
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1488993	1501714	4722506		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
AWI99518.1|1488993_1493187_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
AWI99519.1|1493429_1493636_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AWI99520.1|1493948_1494038_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWI99521.1|1494037_1495711_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AWI99522.1|1495733_1497782_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
AWI99523.1|1497790_1498363_+	potassium-transporting ATPase subunit C	NA	NA	NA	NA	NA
AWI99524.1|1498355_1501040_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AWI99525.1|1501036_1501714_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 109
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1509967	1510732	4722506		Mycobacterium_phage(100.0%)	1	NA	NA
AWI99532.1|1509967_1510732_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 110
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1515012	1518891	4722506	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AWI99538.1|1515012_1516677_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AWI99539.1|1516944_1518891_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 111
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1523657	1525322	4722506		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWI99545.1|1523657_1525322_+	asparagine synthetase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 112
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1529417	1530497	4722506		Pseudomonas_phage(100.0%)	1	NA	NA
AWI99548.1|1529417_1530497_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 113
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1536380	1537106	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWI99555.1|1536380_1537106_+	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 114
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1547962	1550545	4722506	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AWI99563.1|1547962_1550545_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 115
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1557555	1559994	4722506		Synechococcus_phage(50.0%)	2	NA	NA
AWI99572.1|1557555_1558644_+	septal ring lytic transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AWI99573.1|1558782_1559994_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 116
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1565584	1566231	4722506		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AWI99582.1|1565584_1565968_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AWI99583.1|1566021_1566231_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 117
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1581655	1583770	4722506		Morganella_phage(50.0%)	2	NA	NA
AWI99600.1|1581655_1582084_+	universal stress protein G	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
AWI99601.1|1582204_1583770_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 118
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1586953	1588776	4722506		Streptococcus_phage(50.0%)	2	NA	NA
AWI99606.1|1586953_1588174_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	7.9e-58
AWI99607.1|1588146_1588776_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 119
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1603323	1609366	4722506		Klosneuvirus(50.0%)	3	NA	NA
AWI99622.1|1603323_1604139_+	ferric enterobactin transport ATP-binding protein FepC	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
AWI99623.1|1604135_1605269_-	ferric enterobactin transporter FepE	NA	NA	NA	NA	NA
AWI99624.1|1605484_1609366_-	enterobactin synthase component F	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 120
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1628060	1640714	4722506		Streptococcus_phage(40.0%)	12	NA	NA
AWI99641.1|1628060_1630076_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
AWI99642.1|1630146_1631133_-	cell division protein ZipA	NA	NA	NA	NA	NA
AWI99643.1|1631362_1632124_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWI99644.1|1632308_1633280_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AWI99645.1|1633663_1633921_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWI99646.1|1633965_1635693_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
AWI99647.1|1635733_1636243_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWI99648.1|1636285_1637137_-	pyridoxine kinase	NA	NA	NA	NA	NA
AWI99649.1|1637241_1637616_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99650.1|1637648_1638383_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AWI99651.1|1638571_1639483_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
AWI99652.1|1639616_1640714_-	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 121
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1643731	1644523	4722506		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWI99657.1|1643731_1644523_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 122
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1648001	1653121	4722506		Mycobacterium_phage(33.33%)	6	NA	NA
AWI99661.1|1648001_1649306_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
AWI99662.1|1649545_1650445_-	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AWI99663.1|1650540_1651116_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWI99664.1|1651176_1651626_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AWI99665.1|1651612_1652038_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
AWI99666.1|1652251_1653121_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 123
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1659341	1659578	4722506		Proteus_phage(100.0%)	1	NA	NA
AWI99671.1|1659341_1659578_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	42.0	5.0e-09
>prophage 124
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1674614	1675565	4722506		Cyanophage(100.0%)	1	NA	NA
AWI99685.1|1674614_1675565_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 125
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1692853	1693567	4722506		Synechococcus_phage(100.0%)	1	NA	NA
AWI99698.1|1692853_1693567_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 126
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1714650	1718652	4722506		Enterobacteria_phage(33.33%)	5	NA	NA
AWI99719.1|1714650_1715940_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AWI99720.1|1716025_1716652_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AWI99721.1|1716772_1716958_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99722.1|1716976_1718014_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AWI99723.1|1718013_1718652_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 127
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1724898	1731383	4722506		Escherichia_phage(66.67%)	7	NA	NA
AWI99727.1|1724898_1725051_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AWI99728.1|1725068_1725260_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AWI99729.1|1725572_1726091_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AWI99730.1|1726106_1726646_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AWI99731.1|1726738_1728316_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWI99732.1|1728384_1729851_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AWI99733.1|1730012_1731383_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 128
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1740213	1740645	4722506		Powai_lake_megavirus(100.0%)	1	NA	NA
AWI99742.1|1740213_1740645_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 129
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1750855	1757193	4722506		Mycoplasma_phage(20.0%)	8	NA	NA
AWI99747.1|1750855_1752139_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
AWI99748.1|1752197_1752398_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWI99749.1|1752409_1752745_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWI99750.1|1752746_1754597_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AWI99751.1|1754613_1755129_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AWI99752.1|1755224_1755548_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AWI99753.1|1755564_1755951_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AWI99754.1|1755978_1757193_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 130
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1772511	1774023	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWI99770.1|1772511_1774023_-	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	2.4e-11
>prophage 131
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1779915	1791205	4722506		Bacillus_phage(50.0%)	7	NA	NA
AWI99774.1|1779915_1781169_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AWI99775.1|1781496_1782687_+	flavohemoprotein	NA	NA	NA	NA	NA
AWI99776.1|1782731_1783070_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AWI99777.1|1783130_1784465_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AWI99778.1|1784454_1785168_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWI99779.1|1785332_1786760_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AWI99780.1|1787317_1791205_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 132
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1795324	1795585	4722506		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWI99786.1|1795324_1795585_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 133
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1799044	1802787	4722506		Tetraselmis_virus(50.0%)	4	NA	NA
AWI99793.1|1799044_1799725_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AWI99794.1|1799668_1799947_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99795.1|1799997_1800972_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AWI99796.1|1800987_1802787_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 134
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1807689	1865791	4722506	plate,tail,tRNA	Salmonella_phage(50.0%)	58	NA	NA
AWI99802.1|1807689_1808427_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWI99803.1|1808558_1809893_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AWJ02557.1|1810101_1810983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWI99804.1|1811085_1811673_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AWI99805.1|1811728_1812112_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
AWI99806.1|1812416_1813106_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
AWI99807.1|1813153_1814191_-	methyltransferase	NA	NA	NA	NA	NA
AWI99808.1|1814180_1814384_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99809.1|1814397_1814817_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AWJ02558.1|1814885_1815584_+	DTW domain-containing protein YfiP	NA	NA	NA	NA	NA
AWI99810.1|1815615_1818276_+	protein lysine acetyltransferase Pka	NA	NA	NA	NA	NA
AWI99811.1|1818389_1819745_+	phosphatidylserine synthase	NA	NA	NA	NA	NA
AWI99812.1|1819790_1820114_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99813.1|1820110_1821409_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
AWI99814.1|1821390_1821504_-	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AWI99815.1|1827271_1829845_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	1.2e-127
AWI99816.1|1829974_1830706_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWI99817.1|1830702_1831683_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AWI99818.1|1831817_1832555_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWI99819.1|1832584_1832791_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99820.1|1832825_1833167_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWJ02559.1|1833270_1833318_+	Phe operon leader peptide	NA	NA	NA	NA	NA
AWI99821.1|1833416_1834577_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWI99822.1|1834619_1835741_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWI99823.1|1835751_1836822_-	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
AWI99824.1|1837031_1837397_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AWI99825.1|1837546_1838065_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWI99826.1|1838054_1839281_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWI99827.1|1839296_1839779_+	OmpA family protein	NA	NA	NA	NA	NA
AWI99828.1|1839854_1840202_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWI99829.1|1840243_1841011_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWJ02560.1|1841041_1841590_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWI99830.1|1841608_1841857_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWI99831.1|1841993_1843355_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWJ02561.1|1843521_1844313_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWJ02562.1|1844378_1845620_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWI99832.1|1845674_1846268_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWI99833.1|1846264_1846459_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWI99834.1|1846390_1847269_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWI99835.1|1847354_1849016_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWI99836.1|1849164_1849506_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWI99837.1|1849567_1849858_-	RnfH family protein	NA	NA	NA	NA	NA
AWI99838.1|1849847_1850324_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWI99839.1|1850455_1850938_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWI99840.1|1851631_1851850_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AWI99841.1|1851918_1853019_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.1	1.8e-189
AWI99842.1|1853015_1853501_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
AWI99843.1|1853504_1856564_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	85.4	0.0e+00
AWI99844.1|1856556_1856676_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
AWI99845.1|1856690_1856993_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	6.1e-44
AWI99846.1|1857047_1857563_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.2	1.3e-91
AWI99847.1|1857572_1858745_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	9.5e-210
AWI99848.1|1859589_1861098_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.7	2.2e-86
AWI99849.1|1861109_1862135_+	hypothetical protein	NA	NA	NA	NA	NA
AWI99850.1|1862333_1862474_-	hypothetical protein	NA	NA	NA	NA	NA
AWI99851.1|1863938_1864544_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	3.0e-114
AWI99852.1|1864536_1865445_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	3.3e-149
AWI99853.1|1865431_1865791_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.8	4.0e-58
>prophage 135
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1874814	1878866	4722506		Klosneuvirus(50.0%)	4	NA	NA
AWI99857.1|1874814_1876095_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
AWI99858.1|1876332_1877733_+	GABA permease	NA	NA	NA	NA	NA
AWI99859.1|1877753_1878416_+	transcriptional regulator	NA	NA	NA	NA	NA
AWI99860.1|1878416_1878866_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 136
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1882802	1888097	4722506		Oenococcus_phage(20.0%)	5	NA	NA
AWI99868.1|1882802_1883048_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AWI99869.1|1883044_1883455_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AWI99870.1|1883427_1885572_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
AWI99871.1|1885581_1886541_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
AWI99872.1|1886894_1888097_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 137
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1901147	1906533	4722506	tRNA	Vibrio_phage(25.0%)	5	NA	NA
AWI99885.1|1901147_1901333_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AWI99886.1|1901567_1904198_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AWI99887.1|1904325_1904826_-	regulatory protein RecX	NA	NA	NA	NA	NA
AWI99888.1|1904894_1905956_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AWI99889.1|1906035_1906533_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.0	1.3e-30
>prophage 138
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1912776	1913742	4722506		Tetraselmis_virus(100.0%)	1	NA	NA
AWI99896.1|1912776_1913742_+	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 139
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1921217	1922228	4722506		Enterobacteria_phage(100.0%)	1	NA	NA
AWJ02563.1|1921217_1922228_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 140
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1940056	1953240	4722506		Escherichia_phage(50.0%)	12	NA	NA
AWI99919.1|1940056_1942618_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AWI99920.1|1942723_1943380_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AWI99921.1|1943430_1944198_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AWI99922.1|1944393_1945302_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWI99923.1|1945298_1946561_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AWI99924.1|1946557_1947196_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWI99925.1|1947200_1947977_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWI99926.1|1948066_1949431_+	permease	NA	NA	NA	NA	NA
AWI99927.1|1949524_1950517_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWI99928.1|1950579_1951719_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWI99929.1|1951858_1952485_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWI99930.1|1952478_1953240_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 141
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1956352	1958385	4722506		Tupanvirus(50.0%)	2	NA	NA
AWI99936.1|1956352_1956958_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
AWI99937.1|1956957_1958385_-	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
>prophage 142
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1983044	1983830	4722506		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWI99958.1|1983044_1983830_-	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 143
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1988631	1993552	4722506		Vibrio_phage(33.33%)	4	NA	NA
AWI99961.1|1988631_1989303_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
AWI99962.1|1989596_1990469_+	TPM domain protein phosphatase	NA	NA	NA	NA	NA
AWI99963.1|1990528_1991827_-	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AWI99964.1|1991914_1993552_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 144
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	1997584	2001699	4722506		Erysipelothrix_phage(50.0%)	2	NA	NA
AWI99969.1|1997584_1998886_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
AWI99970.1|1998942_2001699_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 145
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2009233	2010082	4722506		Vibrio_phage(100.0%)	1	NA	NA
AWI99978.1|2009233_2010082_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 146
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2014940	2015696	4722506		Bacillus_phage(100.0%)	1	NA	NA
AWI99982.1|2014940_2015696_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 147
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2027222	2042770	4722506	tRNA	Bacillus_phage(33.33%)	9	NA	NA
AWI99994.1|2027222_2028428_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
AWI99995.1|2028427_2028871_+	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AWI99996.1|2028921_2029728_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
AWI99997.1|2029966_2031064_-	murein transglycosylase A	NA	NA	NA	NA	NA
AWI99998.1|2031642_2032896_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AWI99999.1|2033127_2034459_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AWJ00001.1|2034520_2036347_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	2.7e-25
AWJ00002.1|2036346_2039889_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
AWJ00003.1|2039881_2042770_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
>prophage 148
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2048246	2055019	4722506		Geobacillus_virus(33.33%)	6	NA	NA
AWJ00009.1|2048246_2049041_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
AWJ00010.1|2049047_2049923_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWJ00011.1|2050073_2052320_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AWJ00012.1|2052332_2052863_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWJ00013.1|2053547_2054237_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AWJ00014.1|2054305_2055019_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 149
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2064649	2067144	4722506		Aichi_virus(50.0%)	2	NA	NA
AWJ00023.1|2064649_2066068_-	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
AWJ00024.1|2066382_2067144_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 150
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2076019	2081065	4722506	integrase	Aeromonas_phage(25.0%)	4	2073245:2073262	2080158:2080175
2073245:2073262	attL	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
AWJ00033.1|2076019_2076580_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.8	1.0e-20
AWJ00034.1|2076771_2077239_+	DUF1643 domain-containing protein	NA	A0A0F6WE62	Mycobacterium_phage	43.0	1.6e-27
AWJ00035.1|2078127_2080068_-|integrase	integrase	integrase	A0A059XK29	uncultured_phage	28.7	1.8e-11
AWJ00036.1|2080309_2081065_-	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
2080158:2080175	attR	TGGAGCGGGCGAAGGGAA	NA	NA	NA	NA
>prophage 151
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2088025	2094112	4722506	tRNA	Catovirus(25.0%)	5	NA	NA
AWJ00042.1|2088025_2089543_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWJ00043.1|2089552_2090651_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AWJ00044.1|2090741_2092475_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
AWJ00045.1|2092480_2093191_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
AWJ00046.1|2093215_2094112_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 152
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2098030	2103410	4722506		Pandoravirus(50.0%)	3	NA	NA
AWJ00053.1|2098030_2099470_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
AWJ00054.1|2099526_2100270_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWJ00055.1|2100536_2103410_-	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 153
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2111546	2112779	4722506		Catovirus(100.0%)	1	NA	NA
AWJ00065.1|2111546_2112779_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 154
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2141072	2142227	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ00093.1|2141072_2142227_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 155
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2164986	2166171	4722506		Enterobacteria_phage(100.0%)	1	NA	NA
AWJ00119.1|2164986_2166171_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.1	1.7e-121
>prophage 156
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2181426	2182323	4722506		Moraxella_phage(100.0%)	1	NA	NA
AWJ00132.1|2181426_2182323_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
>prophage 157
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2187776	2198049	4722506		Acinetobacter_phage(20.0%)	8	NA	NA
AWJ00137.1|2187776_2189411_-	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
AWJ00138.1|2189474_2192888_-	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
AWJ00139.1|2193171_2193369_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00140.1|2194309_2194576_-	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
AWJ00141.1|2194719_2195046_+	killer suppression protein HigA	NA	NA	NA	NA	NA
AWJ00142.1|2195042_2196125_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
AWJ00143.1|2196127_2197072_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00144.1|2197068_2198049_-	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
>prophage 158
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2204418	2205633	4722506		Salmonella_phage(100.0%)	1	NA	NA
AWJ00151.1|2204418_2205633_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
>prophage 159
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2209603	2210407	4722506		Hepacivirus(100.0%)	1	NA	NA
AWJ00157.1|2209603_2210407_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
>prophage 160
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2228440	2234048	4722506	transposase	Salmonella_phage(40.0%)	7	NA	NA
AWJ00172.1|2228440_2229259_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.6e-46
AWJ00173.1|2229350_2229836_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
AWJ02573.1|2229881_2230328_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AWJ00174.1|2230396_2230618_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AWJ00175.1|2230697_2231072_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWJ00176.1|2231657_2232533_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
AWJ00177.1|2232785_2234048_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 161
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2267948	2269121	4722506		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AWJ00209.1|2267948_2269121_+	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 162
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2291331	2292216	4722506		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AWJ00235.1|2291331_2292216_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 163
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2298292	2307643	4722506		Staphylococcus_phage(33.33%)	7	NA	NA
AWJ00243.1|2298292_2299120_+	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
AWJ00244.1|2299319_2300246_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWJ00245.1|2300296_2300554_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00246.1|2300596_2302816_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AWJ00247.1|2302926_2304339_-	cell division protein FtsP	NA	NA	NA	NA	NA
AWJ00248.1|2304413_2305151_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AWJ00249.1|2305384_2307643_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
>prophage 164
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2311570	2322533	4722506		Bacillus_virus(20.0%)	13	NA	NA
AWJ00254.1|2311570_2313463_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
AWJ00255.1|2313491_2314073_-	esterase YqiA	NA	NA	NA	NA	NA
AWJ00256.1|2314072_2314900_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AWJ00257.1|2314924_2315347_-	DUF1249 domain-containing protein	NA	NA	NA	NA	NA
AWJ00258.1|2315347_2315977_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
AWJ00259.1|2316181_2317663_+	outer membrane protein TolC	NA	NA	NA	NA	NA
AWJ00260.1|2317662_2317923_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00261.1|2317810_2318482_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AWJ00262.1|2318487_2319648_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
AWJ00263.1|2319685_2320474_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWJ00264.1|2320616_2321390_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AWJ00265.1|2321447_2321618_-	DUF4051 domain-containing protein	NA	NA	NA	NA	NA
AWJ00266.1|2321879_2322533_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 165
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2332827	2334261	4722506		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWJ00274.1|2332827_2334261_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 166
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2339398	2340637	4722506	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AWJ00278.1|2339398_2340637_+|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 167
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2347299	2363495	4722506	tRNA	Moraxella_phage(16.67%)	16	NA	NA
AWJ00285.1|2347299_2348313_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AWJ00286.1|2348321_2348552_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00287.1|2348550_2348766_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWJ00288.1|2348876_2350622_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AWJ00289.1|2350635_2350758_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWJ00290.1|2350816_2352658_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AWJ00291.1|2352736_2353243_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AWJ00292.1|2353496_2354261_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AWJ00293.1|2354548_2355172_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ00294.1|2355325_2356846_-	aerotaxis receptor	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AWJ00295.1|2357121_2357328_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00296.1|2357263_2358643_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
AWJ00297.1|2358684_2359017_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AWJ00298.1|2359123_2359306_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00299.1|2359235_2360219_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ00300.1|2360402_2363495_+	evolved beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 168
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2376349	2377315	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWJ00312.1|2376349_2377315_+	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 169
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2397893	2400188	4722506		Tetraselmis_virus(100.0%)	1	NA	NA
AWJ00335.1|2397893_2400188_-	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 170
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2408388	2409534	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWJ00342.1|2408388_2409534_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 171
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2432544	2440338	4722506		Streptococcus_phage(25.0%)	10	NA	NA
AWJ00365.1|2432544_2433405_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
AWJ00366.1|2433469_2435506_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWJ00367.1|2435463_2435859_+	YraN family protein	NA	NA	NA	NA	NA
AWJ00368.1|2435878_2436469_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AWJ00369.1|2436478_2437054_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWJ00370.1|2437167_2438208_-	permease	NA	NA	NA	NA	NA
AWJ00371.1|2438280_2438916_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00372.1|2439043_2439562_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	3.4e-10
AWJ00373.1|2439541_2439985_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00374.1|2440035_2440338_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 172
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2446040	2447930	4722506		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWJ00381.1|2446040_2447930_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 173
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2453411	2460050	4722506		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AWJ00388.1|2453411_2456084_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.2	1.9e-24
AWJ00389.1|2456108_2457596_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AWJ02581.1|2457623_2458076_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AWJ00390.1|2458706_2460050_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 174
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2464132	2467005	4722506	protease	Pandoravirus(50.0%)	2	NA	NA
AWJ00394.1|2464132_2464981_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
AWJ00395.1|2465070_2467005_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 175
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2473779	2475258	4722506		Indivirus(50.0%)	2	NA	NA
AWJ00404.1|2473779_2474751_+	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
AWJ00405.1|2474979_2475258_+	sugar fermentation stimulation protein B	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 176
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2479326	2494121	4722506		Staphylococcus_phage(25.0%)	17	NA	NA
AWJ00410.1|2479326_2480136_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
AWJ00411.1|2480345_2481323_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWJ00412.1|2481336_2482323_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AWJ00413.1|2482343_2482910_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AWJ00414.1|2482906_2483482_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWJ00415.1|2483450_2484008_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWJ00416.1|2484014_2484740_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AWJ00417.1|2484787_2486221_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWJ00418.1|2486243_2486531_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AWJ00419.1|2486648_2487140_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWJ00420.1|2487185_2488040_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AWJ00421.1|2488036_2488309_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AWJ00422.1|2488522_2489155_+	protein YrbL	NA	NA	NA	NA	NA
AWJ00423.1|2489151_2489880_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWJ00424.1|2489876_2490530_-	glutamine amidotransferase	NA	NA	NA	NA	NA
AWJ00425.1|2490759_2493096_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AWJ02584.1|2493191_2494121_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 177
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2501639	2506009	4722506		Salmonella_phage(50.0%)	5	NA	NA
AWJ00429.1|2501639_2502389_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.1e-73
AWJ00430.1|2502448_2502913_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AWJ00431.1|2502909_2503785_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AWJ00432.1|2503781_2504471_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AWJ00433.1|2504518_2506009_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 178
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2509713	2510211	4722506		Pseudomonas_phage(100.0%)	1	NA	NA
AWJ00437.1|2509713_2510211_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 179
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2514177	2516702	4722506	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWJ00442.1|2514177_2515545_+|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
AWJ00443.1|2515634_2516702_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 180
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2533204	2534248	4722506		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWJ00458.1|2533204_2534248_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 181
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2544813	2545698	4722506		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWJ00470.1|2544813_2545698_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 182
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2549530	2550289	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWJ00473.1|2549530_2550289_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 183
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2560795	2562267	4722506	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AWJ00481.1|2560795_2561305_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
AWJ00482.1|2561319_2562267_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 184
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2583482	2585435	4722506		Vibrio_phage(100.0%)	1	NA	NA
AWJ00520.1|2583482_2585435_+	type II secretion system protein GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 185
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2597250	2602824	4722506		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AWJ00533.1|2597250_2598435_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AWJ00534.1|2598505_2600620_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AWJ00535.1|2600716_2601187_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AWJ00536.1|2601283_2601658_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AWJ00537.1|2601783_2602071_-	sulfurtransferase TusB	NA	NA	NA	NA	NA
AWJ00538.1|2602078_2602438_-	sulfurtransferase TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AWJ00539.1|2602437_2602824_-	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 186
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2608394	2617935	4722506		Tupanvirus(25.0%)	10	NA	NA
AWJ00548.1|2608394_2610308_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
AWJ00549.1|2610307_2611330_+	hydrolase	NA	NA	NA	NA	NA
AWJ00550.1|2611323_2611542_+	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AWJ00551.1|2611595_2612465_+	phosphoribulokinase	NA	NA	NA	NA	NA
AWJ00552.1|2612519_2612924_-	OsmC family protein	NA	NA	NA	NA	NA
AWJ00553.1|2613003_2613219_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00554.1|2613225_2613858_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWJ00555.1|2613896_2615999_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AWJ00556.1|2616065_2617286_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWJ00557.1|2617371_2617935_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 187
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2642183	2643020	4722506		Vibrio_phage(100.0%)	1	NA	NA
AWJ00584.1|2642183_2643020_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 188
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2659924	2663691	4722506		Bacillus_phage(66.67%)	3	NA	NA
AWJ00598.1|2659924_2661547_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
AWJ00599.1|2661622_2662975_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AWJ00600.1|2662971_2663691_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 189
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2670254	2671133	4722506	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWJ00606.1|2670254_2671133_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	7.9e-68
>prophage 190
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2677167	2679561	4722506		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWJ00612.1|2677167_2679561_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 191
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2683940	2685167	4722506		Ralstonia_phage(100.0%)	1	NA	NA
AWJ00615.1|2683940_2685167_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 192
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2691222	2693670	4722506		Dickeya_phage(100.0%)	1	NA	NA
AWJ00622.1|2691222_2693670_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 193
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2710993	2712804	4722506		Enterococcus_phage(50.0%)	2	NA	NA
AWJ00636.1|2710993_2711737_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
AWJ00637.1|2711733_2712804_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 194
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2716345	2717828	4722506		Planktothrix_phage(50.0%)	2	NA	NA
AWJ00641.1|2716345_2717059_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
AWJ00642.1|2717060_2717828_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 195
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2723562	2726381	4722506		Salicola_phage(50.0%)	3	NA	NA
AWJ00648.1|2723562_2724417_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
AWJ00649.1|2724661_2725720_-	ABC transporter permease	NA	NA	NA	NA	NA
AWJ00650.1|2725712_2726381_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 196
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2729387	2733519	4722506		Dickeya_phage(50.0%)	4	NA	NA
AWJ00655.1|2729387_2730014_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
AWJ00656.1|2730087_2732286_+	cadmium-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
AWJ00657.1|2732387_2732633_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AWJ00658.1|2732853_2733519_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 197
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2741412	2747064	4722506		Bacillus_virus(50.0%)	3	NA	NA
AWJ00667.1|2741412_2742219_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
AWJ00668.1|2742224_2742626_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AWJ00669.1|2742828_2747064_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
>prophage 198
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2750439	2753175	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ00674.1|2750439_2753175_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 199
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2766769	2768812	4722506		Indivirus(100.0%)	1	NA	NA
AWJ00686.1|2766769_2768812_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 200
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2772157	2774292	4722506		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AWJ00691.1|2772157_2772511_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
AWJ00692.1|2772564_2773854_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
AWJ00693.1|2773866_2774292_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 201
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2777685	2778333	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWJ02593.1|2777685_2778333_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 202
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2824294	2826279	4722506		Bacillus_virus(50.0%)	2	NA	NA
AWJ00732.1|2824294_2825299_-	dipeptide transport ATP-binding protein DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
AWJ00733.1|2825295_2826279_-	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 203
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2836322	2838656	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWJ00744.1|2836322_2838656_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 204
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2842310	2844311	4722506	transposase	Morganella_phage(50.0%)	3	NA	NA
AWJ00749.1|2842310_2842523_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AWJ00750.1|2842710_2842863_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWJ00751.1|2842942_2844311_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 205
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2848149	2849145	4722506		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWJ00755.1|2848149_2849145_+	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 206
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2854463	2856005	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ00761.1|2854463_2856005_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 207
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2880278	2890427	4722506	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
AWJ00785.1|2880278_2882123_-	selenocysteine-specific translation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
AWJ00786.1|2882119_2883511_-|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AWJ00787.1|2883608_2884217_-	glutathione S-transferase	NA	NA	NA	NA	NA
AWJ00788.1|2884444_2888578_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
AWJ00789.1|2888598_2889441_+	lyase	NA	NA	NA	NA	NA
AWJ00790.1|2889488_2890427_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	1.7e-23
>prophage 208
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2906451	2917957	4722506		Rhizobium_phage(16.67%)	9	NA	NA
AWJ00809.1|2906451_2906703_-	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
AWJ00810.1|2906844_2907276_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWJ00811.1|2907520_2909065_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWJ00812.1|2909074_2910358_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AWJ00813.1|2910361_2911321_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWJ00814.1|2911307_2912342_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AWJ00815.1|2912580_2913606_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AWJ00816.1|2913615_2914812_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AWJ00817.1|2917024_2917957_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
>prophage 209
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2921356	2923450	4722506		Catovirus(50.0%)	2	NA	NA
AWJ00821.1|2921356_2922340_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
AWJ00822.1|2922424_2923450_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 210
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2930888	2935451	4722506		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AWJ00830.1|2930888_2931368_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
AWJ00831.1|2931406_2932216_-	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AWJ00832.1|2932313_2932481_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWJ00833.1|2932501_2932738_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWJ00834.1|2932954_2933623_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AWJ00835.1|2933794_2935015_+	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AWJ02596.1|2934995_2935451_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 211
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2940552	2945573	4722506		Pseudomonas_phage(33.33%)	4	NA	NA
AWJ00842.1|2940552_2942235_-	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
AWJ00843.1|2942492_2943116_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AWJ00844.1|2943170_2943446_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWJ00845.1|2943464_2945573_+	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 212
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2950009	2951401	4722506		environmental_Halophage(100.0%)	1	NA	NA
AWJ00849.1|2950009_2951401_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 213
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2972161	2979189	4722506	transposase	Micromonas_sp._RCC1109_virus(20.0%)	13	NA	NA
AWJ00867.1|2972161_2973850_-	acetolactate synthase isozyme 1 large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
AWJ00868.1|2973955_2974054_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWJ00869.1|2974040_2974331_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00870.1|2974327_2974486_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ00871.1|2974508_2974622_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AWJ00872.1|2974618_2974708_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AWJ00873.1|2974987_2976172_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
AWJ00874.1|2976179_2976677_-	radical SAM protein	NA	NA	NA	NA	NA
AWJ00875.1|2976673_2977036_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00876.1|2977025_2977373_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02598.1|2977542_2978751_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.3	1.3e-206
AWJ00877.1|2978820_2978943_+	hypothetical protein	NA	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
AWJ00878.1|2978943_2979189_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	63.3	1.3e-23
>prophage 214
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2985123	2986077	4722506		Synechococcus_phage(50.0%)	2	NA	NA
AWJ00883.1|2985123_2985552_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AWJ00884.1|2985663_2986077_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 215
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2990504	2991653	4722506		Oenococcus_phage(100.0%)	1	NA	NA
AWJ00888.1|2990504_2991653_-	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 216
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	2996359	3003728	4722506		Bacillus_virus(33.33%)	8	NA	NA
AWJ00894.1|2996359_2998774_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
AWJ00895.1|2998802_2999876_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AWJ00896.1|2999875_3000976_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AWJ00897.1|3000980_3002384_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWJ00898.1|3002677_3002878_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ00899.1|3002990_3003131_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWJ00900.1|3003147_3003507_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AWJ00901.1|3003470_3003728_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 217
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3013926	3015264	4722506		Moraxella_phage(100.0%)	1	NA	NA
AWJ00910.1|3013926_3015264_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 218
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3026250	3033858	4722506		Bacillus_phage(25.0%)	6	NA	NA
AWJ00921.1|3026250_3027024_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
AWJ00922.1|3027206_3028097_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWJ00923.1|3028096_3029056_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AWJ00924.1|3029142_3030183_-	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AWJ00925.1|3030496_3032326_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
AWJ00926.1|3032487_3033858_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 219
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3045812	3046805	4722506		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWJ00940.1|3045812_3046805_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 220
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3049973	3055826	4722506		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AWJ00943.1|3049973_3051842_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
AWJ02602.1|3052008_3052428_+	D-ribose pyranase	NA	NA	NA	NA	NA
AWJ00944.1|3052435_3053941_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AWJ00945.1|3053945_3054911_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWJ00946.1|3054935_3055826_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 221
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3069220	3070867	4722506		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWJ00954.1|3069220_3070867_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 222
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3079340	3084752	4722506		Bacillus_phage(33.33%)	5	NA	NA
AWJ00963.1|3079340_3081362_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
AWJ00964.1|3081408_3082893_-	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AWJ00965.1|3082898_3083021_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AWJ00966.1|3083026_3084292_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AWJ00967.1|3084422_3084752_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 223
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3088794	3094938	4722506		Enterobacteria_phage(40.0%)	6	NA	NA
AWJ00973.1|3088794_3089925_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
AWJ00974.1|3089921_3091184_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AWJ00975.1|3091183_3092251_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
AWJ00976.1|3092269_3093151_+	glucose-1-phosphate thymidylyltransferase 2	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
AWJ00977.1|3093128_3093803_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
AWJ00978.1|3093807_3094938_+	dTDP-4-amino-4,6-dideoxygalactose aminotransferase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 224
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3103022	3104678	4722506		Tetraselmis_virus(100.0%)	1	NA	NA
AWJ00985.1|3103022_3104678_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 225
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3114981	3118840	4722506		Bacillus_phage(100.0%)	3	NA	NA
AWJ00996.1|3114981_3115878_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
AWJ00997.1|3115877_3116594_+	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AWJ00998.1|3116677_3118840_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 226
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3124558	3126388	4722506		Catovirus(100.0%)	1	NA	NA
AWJ02605.1|3124558_3126388_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	4.8e-83
>prophage 227
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3138920	3142207	4722506		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AWJ01019.1|3138920_3140561_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
AWJ01020.1|3140639_3140909_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AWJ01021.1|3140912_3141428_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWJ01022.1|3141430_3142207_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 228
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3151088	3151703	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWJ01030.1|3151088_3151703_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 229
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3165562	3168349	4722506		uncultured_virus(100.0%)	1	NA	NA
AWJ01041.1|3165562_3168349_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	9.9e-72
>prophage 230
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3172463	3174934	4722506		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AWJ02606.1|3172463_3173873_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
AWJ01046.1|3173884_3174934_-	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 231
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3192039	3257450	4722506	lysis,portal,holin,terminase,tail,capsid,plate,tRNA,head,integrase	Escherichia_phage(57.45%)	75	3191865:3191879	3232741:3232755
3191865:3191879	attL	TTAACTTTGAAATCA	NA	NA	NA	NA
AWJ01057.1|3192039_3192936_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	1.6e-60
AWJ01058.1|3193103_3194000_+	sugar kinase	NA	NA	NA	NA	NA
AWJ01059.1|3194033_3194819_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AWJ01060.1|3194917_3195517_+	phosphatase	NA	NA	NA	NA	NA
AWJ01061.1|3195510_3196383_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
AWJ01062.1|3196379_3196817_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AWJ01063.1|3196813_3197803_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWJ01064.1|3199438_3199651_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWJ01065.1|3199892_3200111_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01066.1|3200440_3201370_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AWJ01067.1|3201366_3202002_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AWJ01068.1|3201998_3202901_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AWJ01069.1|3202913_3205964_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AWJ01070.1|3205967_3206222_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01071.1|3206157_3206991_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
AWJ01072.1|3207143_3208199_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
AWJ01073.1|3208248_3209997_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AWJ01074.1|3209996_3211067_-	peptidase	NA	NA	NA	NA	NA
AWJ01075.1|3211056_3212508_-	fructose-like PTS system EIIBC component	NA	NA	NA	NA	NA
AWJ01076.1|3212518_3212965_-	fructose-like phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AWJ01077.1|3213265_3213580_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AWJ01078.1|3213589_3214414_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
AWJ01079.1|3214496_3215756_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AWJ01080.1|3215752_3217222_-	rhamnulokinase	NA	NA	NA	NA	NA
AWJ01081.1|3217509_3218346_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AWJ01082.1|3219264_3220299_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AWJ01083.1|3220583_3221204_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
AWJ01084.1|3221378_3221486_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWJ01085.1|3221463_3222447_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AWJ01086.1|3222595_3223270_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AWJ01087.1|3223375_3224749_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AWJ01088.1|3224745_3225444_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AWJ02609.1|3225593_3226094_+	periplasmic protein CpxP	NA	NA	NA	NA	NA
AWJ01089.1|3226280_3227261_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	99.7	1.8e-185
AWJ01090.1|3227330_3227624_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AWJ01091.1|3227760_3228033_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AWJ01092.1|3228202_3228703_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWJ01093.1|3228766_3228991_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWJ01094.1|3228990_3229293_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
AWJ01095.1|3229292_3229517_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AWJ01096.1|3229513_3229789_+	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
AWJ01097.1|3229778_3232055_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.0	0.0e+00
AWJ01098.1|3232255_3233200_+	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
3232741:3232755	attR	TGATTTCAAAGTTAA	NA	NA	NA	NA
AWJ01099.1|3233207_3234197_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01100.1|3234186_3235308_-	chromosome partitioning protein ParB	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
AWJ01101.1|3235722_3236757_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
AWJ01102.1|3236756_3238529_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AWJ01103.1|3238702_3239557_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	98.9	1.2e-156
AWJ01104.1|3239615_3240689_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.2	5.7e-201
AWJ01105.1|3240692_3241430_+|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	99.6	1.6e-130
AWJ01106.1|3241529_3242039_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWJ01107.1|3242038_3242242_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	1.5e-30
AWJ01108.1|3242245_3242527_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AWJ01109.1|3242526_3243024_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWJ01110.1|3243038_3243464_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	97.9	3.8e-60
AWJ01111.1|3243451_3243877_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	96.5	4.7e-66
AWJ01112.1|3243776_3243992_+|holin	holin	holin	Q7Y4E1	Escherichia_virus	93.0	1.6e-30
AWJ01113.1|3243984_3244452_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AWJ01114.1|3244444_3244897_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
AWJ01115.1|3244963_3245599_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	5.5e-111
AWJ01116.1|3245595_3245943_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AWJ01117.1|3245947_3246856_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	4.4e-162
AWJ01118.1|3246848_3247460_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
AWJ01119.1|3248655_3249093_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	65.5	9.8e-51
AWJ01120.1|3249064_3249667_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	86.9	8.3e-93
AWJ01121.1|3249666_3250164_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	69.3	3.3e-55
AWJ01122.1|3250194_3250788_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
AWJ01123.1|3250847_3252038_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AWJ01124.1|3252050_3252569_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWJ01125.1|3252625_3252901_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWJ02610.1|3252933_3253053_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWJ01126.1|3253045_3255493_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.1	0.0e+00
AWJ01127.1|3255507_3255987_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
AWJ01128.1|3255986_3257150_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	99.2	1.4e-205
AWJ01129.1|3257195_3257450_+	transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
>prophage 232
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3268462	3272965	4722506		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AWJ01142.1|3268462_3269308_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AWJ01143.1|3269732_3269978_+	cell division protein ZapB	NA	NA	NA	NA	NA
AWJ01144.1|3270062_3270548_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AWJ01145.1|3270640_3271567_-	prenyltransferase	NA	NA	NA	NA	NA
AWJ01146.1|3271633_3272965_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	6.4e-45
>prophage 233
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3290263	3297510	4722506		Synechococcus_phage(33.33%)	5	NA	NA
AWJ01161.1|3290263_3290926_-	fructose-6-phosphate aldolase 2	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
AWJ01162.1|3290937_3293439_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AWJ01163.1|3293747_3294827_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AWJ01164.1|3294841_3295162_+	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AWJ01165.1|3295212_3297510_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 234
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3314610	3316455	4722506		Acinetobacter_phage(100.0%)	1	NA	NA
AWJ01180.1|3314610_3316455_+	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 235
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3324964	3328017	4722506		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AWJ01184.1|3324964_3325915_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
AWJ01185.1|3325897_3326092_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01186.1|3326101_3326257_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01187.1|3326832_3328017_+	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 236
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3332133	3340462	4722506		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AWJ01194.1|3332133_3336162_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AWJ01195.1|3336238_3340462_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 237
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3349679	3351443	4722506		Klosneuvirus(50.0%)	3	NA	NA
AWJ01206.1|3349679_3350351_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
AWJ01207.1|3350393_3350984_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWJ01208.1|3351170_3351443_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 238
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3356805	3358395	4722506		Prochlorococcus_phage(100.0%)	1	NA	NA
AWJ01214.1|3356805_3358395_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.4e-67
>prophage 239
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3371892	3379134	4722506	transposase	Escherichia_phage(50.0%)	4	NA	NA
AWJ01222.1|3371892_3372873_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AWJ01223.1|3372913_3374110_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01224.1|3374426_3375251_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ01225.1|3375450_3379134_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 240
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3398406	3399522	4722506		Mycoplasma_phage(100.0%)	1	NA	NA
AWJ01244.1|3398406_3399522_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 241
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3408736	3409345	4722506		Lactococcus_phage(100.0%)	1	NA	NA
AWJ01252.1|3408736_3409345_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 242
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3415939	3418487	4722506		Escherichia_phage(50.0%)	2	NA	NA
AWJ01260.1|3415939_3417355_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AWJ01261.1|3417407_3418487_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 243
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3422674	3426287	4722506		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AWJ01266.1|3422674_3425497_-	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AWJ01267.1|3425447_3425630_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01268.1|3425750_3426287_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 244
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3430104	3431454	4722506		Moraxella_phage(100.0%)	1	NA	NA
AWJ01276.1|3430104_3431454_+	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 245
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3437814	3439773	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ01280.1|3437814_3439773_-	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 246
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3449508	3451656	4722506		Escherichia_phage(100.0%)	1	NA	NA
AWJ01291.1|3449508_3451656_-	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 247
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3456901	3463270	4722506		Tetraselmis_virus(50.0%)	5	NA	NA
AWJ01296.1|3456901_3458887_-	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
AWJ01297.1|3459159_3460089_-	allose kinase	NA	NA	NA	NA	NA
AWJ01298.1|3460072_3460768_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AWJ01299.1|3460778_3461759_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AWJ01300.1|3461737_3463270_-	D-allose import ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 248
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3469504	3470185	4722506		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWJ01308.1|3469504_3470185_-	alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
>prophage 249
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3476667	3477456	4722506		Cedratvirus(100.0%)	1	NA	NA
AWJ01315.1|3476667_3477456_-	phosphonates import ATP-binding protein PhnC	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 250
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3482694	3484197	4722506		Burkholderia_virus(100.0%)	1	NA	NA
AWJ01319.1|3482694_3484197_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 251
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3505393	3508605	4722506	tRNA	Catovirus(50.0%)	2	NA	NA
AWJ01338.1|3505393_3506911_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AWJ01339.1|3507147_3508605_-	dipeptide and tripeptide permease C	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 252
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3522882	3524866	4722506		Cronobacter_phage(50.0%)	2	NA	NA
AWJ01352.1|3522882_3523176_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AWJ01353.1|3523219_3524866_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	1.8e-190
>prophage 253
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3529379	3529913	4722506		Morganella_phage(100.0%)	1	NA	NA
AWJ01361.1|3529379_3529913_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	1.6e-47
>prophage 254
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3534833	3535811	4722506		Tupanvirus(100.0%)	1	NA	NA
AWJ01367.1|3534833_3535811_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 255
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3543794	3544340	4722506		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWJ01374.1|3543794_3544340_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 256
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3548376	3561407	4722506	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
AWJ01378.1|3548376_3549714_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AWJ01379.1|3549723_3551571_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AWJ01380.1|3551563_3552514_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AWJ01381.1|3552599_3552908_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AWJ01382.1|3552983_3554264_+	GTPase HflX	NA	NA	NA	NA	NA
AWJ01383.1|3554349_3555609_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AWJ01384.1|3555611_3556616_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AWJ01385.1|3556697_3556895_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AWJ01386.1|3556998_3558297_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AWJ01387.1|3558501_3558927_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ01388.1|3558965_3561407_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 257
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3565340	3566504	4722506		Ralstonia_phage(100.0%)	1	NA	NA
AWJ01395.1|3565340_3566504_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 258
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3602193	3608681	4722506		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AWJ01434.1|3602193_3602724_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
AWJ01435.1|3603033_3603990_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWJ01436.1|3604129_3605632_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
AWJ01437.1|3605642_3606668_+	ABC transporter permease	NA	NA	NA	NA	NA
AWJ01438.1|3606654_3607650_+	ABC transporter permease	NA	NA	NA	NA	NA
AWJ01439.1|3607682_3608681_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 259
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3612997	3615790	4722506		Cronobacter_phage(50.0%)	2	NA	NA
AWJ01444.1|3612997_3613462_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
AWJ01445.1|3613651_3615790_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 260
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3619428	3625525	4722506		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
AWJ01448.1|3619428_3620376_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AWJ02621.1|3620560_3620614_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AWJ01449.1|3620754_3623451_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AWJ01450.1|3623656_3624043_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AWJ01451.1|3624115_3624577_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWJ01452.1|3624589_3625525_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 261
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3633996	3644424	4722506	tRNA	Klosneuvirus(25.0%)	7	NA	NA
AWJ01464.1|3633996_3636852_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AWJ01465.1|3636851_3637295_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWJ01466.1|3637651_3639163_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWJ01467.1|3639429_3640530_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWJ01468.1|3640529_3641612_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWJ01469.1|3641772_3643275_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	5.1e-83
AWJ01470.1|3643404_3644424_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.1e-44
>prophage 262
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3656254	3657715	4722506		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWJ01479.1|3656254_3657715_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.2e-49
>prophage 263
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3664282	3664837	4722506		Clostridioides_phage(100.0%)	1	NA	NA
AWJ01489.1|3664282_3664837_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 264
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3677422	3682787	4722506		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AWJ01500.1|3677422_3679087_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
AWJ01501.1|3679135_3680497_-	MFS transporter	NA	NA	NA	NA	NA
AWJ01502.1|3680711_3681626_-	FCD domain-containing protein	NA	NA	NA	NA	NA
AWJ01503.1|3681764_3682787_+	galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 265
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3686011	3687291	4722506		Shigella_phage(50.0%)	2	NA	NA
AWJ01505.1|3686011_3686749_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
AWJ01506.1|3686751_3687291_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 266
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3695118	3697994	4722506		Streptococcus_phage(50.0%)	3	NA	NA
AWJ01517.1|3695118_3696708_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AWJ01518.1|3697100_3697706_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWJ01519.1|3697814_3697994_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 267
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3703932	3705255	4722506		Geobacillus_virus(100.0%)	1	NA	NA
AWJ01526.1|3703932_3705255_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 268
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3711998	3717353	4722506		Enterococcus_phage(33.33%)	4	NA	NA
AWJ01533.1|3711998_3713231_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
AWJ01534.1|3713537_3715205_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AWJ02626.1|3715178_3715307_+	methionine aminopeptidase	NA	NA	NA	NA	NA
AWJ02627.1|3715415_3717353_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.0	6.8e-11
>prophage 269
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3720636	3722750	4722506		Bacillus_phage(50.0%)	2	NA	NA
AWJ01539.1|3720636_3721326_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
AWJ01540.1|3721325_3722750_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.2e-09
>prophage 270
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3734519	3744937	4722506	transposase	Cyanophage(20.0%)	10	NA	NA
AWJ01550.1|3734519_3735473_+	transaldolase 1	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
AWJ01551.1|3735587_3736175_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AWJ01552.1|3736209_3736776_-	succinate-acetate/proton symporter SatP	NA	NA	NA	NA	NA
AWJ01553.1|3736924_3737638_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
AWJ01554.1|3737663_3738068_-	DUF2541 domain-containing protein	NA	NA	NA	NA	NA
AWJ01555.1|3738444_3740361_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AWJ01556.1|3740449_3741580_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	1.0e-27
AWJ01557.1|3741842_3742955_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AWJ02631.1|3743032_3743242_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
AWJ01558.1|3743770_3744937_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 271
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3755199	3758016	4722506	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWJ01568.1|3755199_3758016_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 272
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3762422	3763571	4722506		Halovirus(100.0%)	1	NA	NA
AWJ01574.1|3762422_3763571_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 273
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3772626	3776157	4722506		Bacillus_phage(50.0%)	5	NA	NA
AWJ01583.1|3772626_3773106_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
AWJ01584.1|3773126_3773306_+	antitoxin	NA	NA	NA	NA	NA
AWJ01585.1|3773404_3773824_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01586.1|3774684_3775284_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
AWJ01587.1|3775308_3776157_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 274
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3785294	3790716	4722506		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWJ01596.1|3785294_3788201_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
AWJ01597.1|3788364_3790716_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.0	1.3e-35
>prophage 275
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3797021	3797720	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWJ01602.1|3797021_3797720_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.8	1.6e-23
>prophage 276
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3810208	3811933	4722506		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWJ01614.1|3810208_3811933_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 277
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3838020	3839064	4722506		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWJ01641.1|3838020_3839064_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 278
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3843308	3843860	4722506		Sphingobium_phage(100.0%)	1	NA	NA
AWJ01646.1|3843308_3843860_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.0	4.3e-11
>prophage 279
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3852370	3853795	4722506		Erysipelothrix_phage(100.0%)	1	NA	NA
AWJ01653.1|3852370_3853795_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 280
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3861541	3868164	4722506		Mamastrovirus(33.33%)	5	NA	NA
AWJ01661.1|3861541_3863092_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
AWJ01662.1|3863293_3865684_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AWJ01663.1|3865889_3866426_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AWJ01664.1|3866466_3867129_-	carbonic anhydrase	NA	NA	NA	NA	NA
AWJ01665.1|3867237_3868164_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 281
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3871426	3872299	4722506	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWJ01671.1|3871426_3872299_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.6	3.2e-61
>prophage 282
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3876153	3882959	4722506	tRNA	unidentified_phage(50.0%)	6	NA	NA
AWJ01676.1|3876153_3877572_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AWJ01677.1|3877610_3878537_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWJ01678.1|3878573_3879029_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AWJ01679.1|3879206_3879911_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWJ01680.1|3879925_3880456_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWJ01681.1|3880529_3882959_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
>prophage 283
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3888138	3888936	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWJ01684.1|3888138_3888936_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 284
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3894847	3895192	4722506		Lake_Baikal_phage(100.0%)	1	NA	NA
AWJ01689.1|3894847_3895192_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 285
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3899121	3900546	4722506	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWJ01694.1|3899121_3900546_+|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 286
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3913143	3913902	4722506		Flavobacterium_phage(100.0%)	1	NA	NA
AWJ01708.1|3913143_3913902_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 287
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3922730	3926846	4722506		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AWJ01717.1|3922730_3923327_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
AWJ01718.1|3923363_3926846_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 288
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3939851	3940883	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWJ01733.1|3939851_3940883_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 289
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3947406	3955038	4722506		Indivirus(25.0%)	9	NA	NA
AWJ01735.1|3947406_3948210_+	2,5-diketo-D-gluconic acid reductase B	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
AWJ01736.1|3948206_3949121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWJ01737.1|3949361_3950162_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AWJ01738.1|3950165_3950789_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ01739.1|3950836_3952195_-	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AWJ01740.1|3952266_3953022_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWJ01741.1|3953055_3953778_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWJ01742.1|3953774_3954242_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AWJ02635.1|3954306_3955038_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 290
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	3966289	4049820	4722506	protease,head,holin,portal,terminase,plate,capsid,tail,transposase,integrase	Enterobacteria_phage(36.21%)	98	4001574:4001590	4030568:4030584
AWJ01750.1|3966289_3969055_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	5.2e-81
AWJ01751.1|3969063_3969825_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01752.1|3969829_3971161_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWJ01753.1|3971163_3971688_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWJ01754.1|3971684_3972965_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AWJ01755.1|3972989_3974072_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWJ01756.1|3974035_3975886_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWJ01757.1|3975889_3976303_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AWJ01758.1|3976309_3977785_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWJ01759.1|3977835_3978060_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01760.1|3978094_3978595_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWJ01761.1|3979289_3979808_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWJ01762.1|3979840_3979978_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01763.1|3980017_3980410_+	type VI secretion protein	NA	NA	NA	NA	NA
AWJ01764.1|3980419_3982159_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	4.6e-19
AWJ01765.1|3982234_3986479_+	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
AWJ01766.1|3986456_3986690_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01767.1|3989234_3990005_-	hydrolase YafV	NA	NA	NA	NA	NA
AWJ01768.1|3990158_3990632_+	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AWJ01769.1|3990674_3993119_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AWJ01770.1|3993358_3993937_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AWJ01771.1|3994142_3994910_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AWJ01772.1|3994880_3995621_-	transpeptidase	NA	NA	NA	NA	NA
AWJ01773.1|3996882_3997086_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
AWJ01774.1|3997295_3998045_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
AWJ01775.1|3998220_3998718_+|transposase	transposase	transposase	NA	NA	NA	NA
AWJ01776.1|3998941_4000681_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AWJ01777.1|4000640_4001411_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AWJ01778.1|4001481_4002537_+	DNA polymerase IV	NA	NA	NA	NA	NA
4001574:4001590	attL	TGGCGGCAGCCGCGAAC	NA	NA	NA	NA
AWJ01779.1|4002588_4002882_+	antitoxin YafN	NA	NA	NA	NA	NA
AWJ01780.1|4002884_4003283_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AWJ01781.1|4003292_4003745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWJ02637.1|4003978_4004245_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02636.1|4004177_4004714_+	peptide chain release factor H	NA	NA	NA	NA	NA
AWJ01782.1|4004770_4006228_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AWJ01783.1|4006488_4006947_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AWJ01784.1|4007038_4008283_+	esterase	NA	NA	NA	NA	NA
AWJ01785.1|4008340_4008742_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AWJ01786.1|4008780_4009836_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AWJ01787.1|4010123_4011227_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWJ01788.1|4011238_4012492_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
AWJ02638.1|4012696_4013671_-|integrase	integrase	integrase	U5P434	Shigella_phage	99.4	9.1e-190
AWJ01789.1|4013736_4014117_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	96.6	1.6e-57
AWJ01790.1|4014058_4014337_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AWJ01791.1|4014384_4014603_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
AWJ01792.1|4014701_4014983_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AWJ01793.1|4014993_4015551_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	1.3e-60
AWJ02639.1|4015547_4015706_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.1	2.4e-23
AWJ01794.1|4015702_4016383_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.7	6.0e-132
AWJ01795.1|4016379_4017165_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWJ01796.1|4017170_4017467_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AWJ01797.1|4017542_4017749_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWJ01798.1|4018257_4019085_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AWJ01799.1|4019081_4019831_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01800.1|4019953_4020709_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWJ01801.1|4020747_4020978_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWJ01802.1|4021047_4021587_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	6.8e-62
AWJ01803.1|4021583_4022603_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	65.0	2.1e-112
AWJ01804.1|4022599_4023301_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.9	9.3e-128
AWJ01805.1|4023659_4024166_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01806.1|4024172_4024958_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01807.1|4026165_4026267_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01808.1|4026263_4026719_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	68.2	3.7e-61
AWJ01809.1|4026718_4026889_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AWJ01810.1|4026881_4027172_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AWJ01811.1|4027168_4027531_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	3.3e-60
AWJ01812.1|4027527_4027668_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
AWJ01813.1|4027664_4028354_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	4.9e-57
AWJ01814.1|4028663_4028981_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AWJ01815.1|4028967_4029444_+	lysozyme	NA	U5P0A9	Shigella_phage	96.2	8.6e-85
AWJ01816.1|4029427_4029820_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	80.8	5.7e-50
AWJ01817.1|4030035_4030410_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01818.1|4030537_4030888_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	7.5e-62
4030568:4030584	attR	GTTCGCGGCTGCCGCCA	NA	NA	NA	NA
AWJ01819.1|4031004_4031508_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	1.4e-88
AWJ01820.1|4031504_4033238_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AWJ01821.1|4033385_4034612_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
AWJ01822.1|4034604_4035207_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
AWJ01823.1|4035217_4036447_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.5	3.4e-226
AWJ01824.1|4036525_4036849_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
AWJ01825.1|4036845_4037256_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
AWJ01826.1|4037230_4037737_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
AWJ01827.1|4037733_4038294_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.9	2.3e-105
AWJ01828.1|4038302_4038470_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
AWJ01829.1|4038456_4039950_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.8	1.4e-274
AWJ01830.1|4039949_4040306_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
AWJ01831.1|4040305_4040575_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AWJ01832.1|4040541_4040730_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01833.1|4040716_4042552_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
AWJ01834.1|4042570_4043941_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.9	8.7e-255
AWJ01835.1|4043937_4045017_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	1.2e-206
AWJ01836.1|4045016_4045565_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AWJ01837.1|4045561_4045990_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
AWJ01838.1|4045976_4047035_+|plate	phage baseplate protein	plate	U5P424	Shigella_phage	97.7	1.2e-198
AWJ01839.1|4047025_4047610_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.0	1.6e-112
AWJ01840.1|4047613_4048261_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	69.1	3.9e-64
AWJ01841.1|4048263_4048704_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	67.3	8.9e-52
AWJ01842.1|4048675_4049269_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	63.9	4.5e-59
AWJ01843.1|4049268_4049820_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	8.8e-57
>prophage 291
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4054641	4056840	4722506		Acinetobacter_phage(100.0%)	1	NA	NA
AWJ01847.1|4054641_4056840_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
>prophage 292
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4071636	4072962	4722506		Erysipelothrix_phage(100.0%)	1	NA	NA
AWJ01865.1|4071636_4072962_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 293
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4078537	4084457	4722506	holin	Catovirus(50.0%)	5	NA	NA
AWJ01873.1|4078537_4080208_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AWJ01874.1|4080221_4081694_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWJ01875.1|4081707_4082295_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ02641.1|4082211_4082427_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ01876.1|4082423_4084457_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.7	4.4e-21
>prophage 294
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4095844	4096894	4722506		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AWJ01888.1|4095844_4096894_+	aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 295
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4105666	4107448	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ01897.1|4105666_4107448_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.0	1.2e-41
>prophage 296
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4110646	4111546	4722506		Lactobacillus_phage(100.0%)	1	NA	NA
AWJ01900.1|4110646_4111546_-	transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 297
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4116086	4120366	4722506		Herpes_simplex_virus(50.0%)	2	NA	NA
AWJ01905.1|4116086_4119161_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
AWJ01906.1|4119283_4120366_-	lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 298
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4125776	4127737	4722506		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AWJ01912.1|4125776_4126727_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
AWJ01913.1|4126723_4127737_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
>prophage 299
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4131018	4132128	4722506		Prochlorococcus_phage(100.0%)	1	NA	NA
AWJ01917.1|4131018_4132128_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 300
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4137425	4138193	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWJ01924.1|4137425_4138193_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 301
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4142938	4147501	4722506	transposase	Escherichia_phage(50.0%)	5	NA	NA
AWJ01928.1|4142938_4143919_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AWJ02645.1|4143957_4144092_-	ABC transporter	NA	NA	NA	NA	NA
AWJ02644.1|4144084_4145632_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AWJ01929.1|4145719_4146343_+	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
AWJ01930.1|4146343_4147501_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 302
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4154916	4156032	4722506		Bacillus_phage(100.0%)	1	NA	NA
AWJ01942.1|4154916_4156032_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 303
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4160321	4170398	4722506		Bacillus_phage(60.0%)	7	NA	NA
AWJ02646.1|4160321_4161233_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
AWJ01951.1|4161357_4162266_+	fructokinase	NA	NA	NA	NA	NA
AWJ02647.1|4162510_4163695_-	MFS transporter	NA	NA	NA	NA	NA
AWJ01952.1|4163820_4166967_-	nuclease SbcCD subunit C	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AWJ01953.1|4166963_4168166_-	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AWJ01954.1|4168355_4169045_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AWJ01955.1|4169102_4170398_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 304
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4177350	4186331	4722506	tRNA	uncultured_Mediterranean_phage(60.0%)	11	NA	NA
AWJ01961.1|4177350_4178478_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AWJ01962.1|4178500_4178833_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AWJ01963.1|4178860_4180708_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWJ01964.1|4180718_4181690_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AWJ01965.1|4181818_4182166_+	HNH endonuclease	NA	NA	NA	NA	NA
AWJ01966.1|4182342_4183227_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AWJ01967.1|4183359_4183563_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01968.1|4183525_4184065_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ01969.1|4184215_4184665_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AWJ01970.1|4184668_4185772_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
AWJ01971.1|4185860_4186331_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 305
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4207890	4212937	4722506	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AWJ01995.1|4207890_4208514_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AWJ01996.1|4208639_4209914_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AWJ01997.1|4210101_4212456_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AWJ01998.1|4212664_4212937_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 306
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4216065	4216761	4722506		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWJ02002.1|4216065_4216761_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 307
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4220084	4223631	4722506		Bacillus_phage(100.0%)	2	NA	NA
AWJ02006.1|4220084_4221857_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
AWJ02007.1|4221849_4223631_+	multidrug resistance-like ATP-binding protein MdlB	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 308
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4232466	4235616	4722506		Leptospira_phage(100.0%)	1	NA	NA
AWJ02018.1|4232466_4235616_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 309
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4242624	4251186	4722506		Klosneuvirus(25.0%)	8	NA	NA
AWJ02027.1|4242624_4243176_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AWJ02028.1|4243304_4245236_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AWJ02029.1|4245288_4245618_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWJ02030.1|4245617_4246223_+	recombination protein RecR	NA	NA	NA	NA	NA
AWJ02031.1|4246332_4248207_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
AWJ02032.1|4248387_4249032_+	adenylate kinase	NA	NA	NA	NA	NA
AWJ02033.1|4249267_4250230_+	ferrochelatase	NA	NA	NA	NA	NA
AWJ02034.1|4250226_4251186_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
>prophage 310
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4259430	4262592	4722506		Escherichia_phage(50.0%)	2	NA	NA
AWJ02043.1|4259430_4259772_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AWJ02044.1|4260087_4262592_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 311
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4267131	4267809	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWJ02050.1|4267131_4267809_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 312
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4270945	4271632	4722506		Planktothrix_phage(100.0%)	1	NA	NA
AWJ02055.1|4270945_4271632_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 313
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4283391	4285173	4722506		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWJ02063.1|4283391_4285173_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	8.6e-37
>prophage 314
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4288635	4289781	4722506		Streptococcus_phage(100.0%)	1	NA	NA
AWJ02065.1|4288635_4289781_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 315
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4301358	4304489	4722506	tRNA	Moumouvirus(50.0%)	4	NA	NA
AWJ02077.1|4301358_4302744_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
AWJ02078.1|4302779_4303301_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWJ02079.1|4303408_4303621_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02080.1|4303622_4304489_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 316
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4323906	4329443	4722506		Ralstonia_phage(50.0%)	3	NA	NA
AWJ02091.1|4323906_4325808_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
AWJ02092.1|4327321_4328770_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
AWJ02093.1|4328759_4329443_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 317
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4332713	4335857	4722506		Leptospira_phage(100.0%)	1	NA	NA
AWJ02098.1|4332713_4335857_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 318
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4356493	4357228	4722506		Clostridioides_phage(100.0%)	1	NA	NA
AWJ02119.1|4356493_4357228_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 319
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4361046	4361967	4722506		Morganella_phage(100.0%)	1	NA	NA
AWJ02122.1|4361046_4361967_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 320
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4365661	4373238	4722506		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AWJ02127.1|4365661_4367356_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
AWJ02128.1|4367425_4368370_+	transporter YfdV	NA	NA	NA	NA	NA
AWJ02129.1|4368443_4369589_+	acetyl-CoA--oxalate CoA-transferase	NA	NA	NA	NA	NA
AWJ02130.1|4369644_4373238_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 321
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4381878	4386861	4722506		Enterobacteria_phage(66.67%)	12	NA	NA
AWJ02136.1|4381878_4382079_-	excisionase	NA	K7P7V0	Enterobacteria_phage	98.5	7.1e-33
AWJ02137.1|4382136_4382304_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	4.9e-27
AWJ02138.1|4382361_4383162_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	3.7e-157
AWJ02139.1|4383290_4383569_-	DUF4752 domain-containing protein	NA	K7P6P7	Enterobacteria_phage	100.0	1.9e-47
AWJ02140.1|4383568_4384264_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.1	9.7e-53
AWJ02141.1|4384266_4384458_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
AWJ02142.1|4384459_4385149_-	hypothetical protein	NA	Q6H9Z5	Enterobacteria_phage	68.1	4.7e-84
AWJ02143.1|4385150_4385450_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	94.9	1.2e-55
AWJ02144.1|4385446_4385992_-	hypothetical protein	NA	J9Q748	Salmonella_phage	83.8	6.4e-84
AWJ02654.1|4385988_4386156_-	DUF2737 domain-containing protein	NA	K7PJY9	Enterobacterial_phage	100.0	1.3e-24
AWJ02145.1|4386166_4386460_-	DUF2856 domain-containing protein	NA	K7P7E6	Enterobacteria_phage	99.0	4.2e-50
AWJ02146.1|4386483_4386861_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.3	3.1e-61
>prophage 322
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4390047	4392449	4722506		Enterobacteria_phage(100.0%)	2	NA	NA
AWJ02149.1|4390047_4391205_-	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.7	2.8e-222
AWJ02150.1|4391516_4392449_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 323
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4410276	4472029	4722506	holin,portal,terminase,plate,tail,capsid,tRNA,transposase,integrase	Enterobacteria_phage(69.39%)	78	4419902:4419921	4456830:4456849
AWJ02168.1|4410276_4411362_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AWJ02169.1|4411365_4412190_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWJ02170.1|4412189_4412999_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02171.1|4412998_4413547_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWJ02172.1|4413580_4413859_+	YfcL family protein	NA	NA	NA	NA	NA
AWJ02173.1|4413979_4415986_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWJ02174.1|4416144_4417365_+	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWJ02655.1|4417466_4417688_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02175.1|4417629_4418808_+	arabinose transporter	NA	NA	NA	NA	NA
AWJ02176.1|4418804_4419800_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
4419902:4419921	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
AWJ02177.1|4420029_4420821_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.6	8.7e-66
AWJ02178.1|4420765_4420963_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWJ02179.1|4421213_4421354_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AWJ02180.1|4421544_4421805_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02181.1|4421847_4422957_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	3.7e-195
AWJ02182.1|4423114_4424299_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AWJ02183.1|4424298_4424811_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AWJ02184.1|4424866_4425241_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
AWJ02185.1|4425168_4425405_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AWJ02186.1|4425391_4428199_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.9	0.0e+00
AWJ02187.1|4428205_4428700_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.2e-86
AWJ02188.1|4428726_4429326_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
AWJ02189.1|4429396_4429825_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	2.9e-39
AWJ02190.1|4429835_4430342_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	64.9	1.1e-53
AWJ02191.1|4430370_4430829_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	55.3	6.6e-42
AWJ02192.1|4430835_4431447_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
AWJ02193.1|4431446_4431887_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	5.8e-35
AWJ02194.1|4431915_4432419_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.5	2.1e-41
AWJ02195.1|4432429_4434100_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.5	1.5e-144
AWJ02196.1|4434096_4434705_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
AWJ02197.1|4434697_4435594_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.9e-155
AWJ02198.1|4435597_4435948_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	9.2e-60
AWJ02199.1|4435944_4436526_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	5.0e-103
AWJ02200.1|4436522_4437158_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AWJ02201.1|4437150_4437618_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AWJ02656.1|4437604_4437784_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02202.1|4437755_4438163_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
AWJ02203.1|4438159_4438552_-	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
AWJ02204.1|4438548_4438872_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AWJ02205.1|4438874_4439075_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AWJ02206.1|4439074_4439569_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AWJ02207.1|4439671_4440472_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
AWJ02208.1|4440517_4441570_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.3	3.6e-184
AWJ02209.1|4441593_4442430_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AWJ02210.1|4442584_4444336_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
AWJ02211.1|4444335_4445382_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
AWJ02212.1|4445912_4447292_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02213.1|4447302_4447647_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02214.1|4447630_4448440_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02215.1|4448485_4451251_-	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.3	0.0e+00
AWJ02216.1|4451247_4451637_-	inositol monophosphatase	NA	NA	NA	NA	NA
AWJ02217.1|4451709_4451940_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	96.1	2.6e-31
AWJ02218.1|4452262_4452562_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
AWJ02219.1|4452558_4452804_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
AWJ02220.1|4452800_4453004_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
AWJ02221.1|4453200_4453443_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
AWJ02222.1|4453454_4453742_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AWJ02223.1|4453752_4454094_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
AWJ02224.1|4454346_4454553_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02225.1|4454559_4454847_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
AWJ02657.1|4454995_4455547_+	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.1e-14
AWJ02226.1|4455643_4456648_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
AWJ02227.1|4456805_4457963_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
4456830:4456849	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
AWJ02228.1|4458028_4459042_+	USG-1 protein	NA	NA	NA	NA	NA
AWJ02229.1|4459041_4459854_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AWJ02230.1|4459936_4460596_+	protein DedA	NA	NA	NA	NA	NA
AWJ02231.1|4460751_4461666_+	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AWJ02232.1|4461735_4463004_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AWJ02233.1|4462993_4463656_+	protein DedD	NA	NA	NA	NA	NA
AWJ02234.1|4463914_4464403_+	colicin V production protein	NA	NA	NA	NA	NA
AWJ02235.1|4464439_4465957_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
AWJ02236.1|4466051_4466621_+	3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein	NA	NA	NA	NA	NA
AWJ02237.1|4466886_4467669_+	lysine/arginine/ornithine-binding periplasmic protein	NA	NA	NA	NA	NA
AWJ02238.1|4467889_4468672_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AWJ02239.1|4468761_4469448_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AWJ02240.1|4469444_4470161_+	histidine ABC transporter permease	NA	NA	NA	NA	NA
AWJ02241.1|4470168_4470942_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AWJ02242.1|4471138_4472029_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
>prophage 324
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4482588	4485816	4722506		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AWJ02254.1|4482588_4483239_+	sugar phosphatase YfbT	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
AWJ02255.1|4483325_4485158_+	SLC13 family permease	NA	NA	NA	NA	NA
AWJ02256.1|4485216_4485816_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 325
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4525416	4530420	4722506		Tupanvirus(50.0%)	4	NA	NA
AWJ02291.1|4525416_4527399_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
AWJ02292.1|4527398_4528367_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.5e-35
AWJ02293.1|4528370_4529510_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	3.2e-29
AWJ02294.1|4529817_4530420_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
>prophage 326
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4535907	4536879	4722506	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWJ02301.1|4535907_4536879_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	4.2e-70
>prophage 327
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4542771	4543851	4722506		Staphylococcus_phage(100.0%)	1	NA	NA
AWJ02306.1|4542771_4543851_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 328
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4546913	4550648	4722506		Pseudomonas_phage(66.67%)	3	NA	NA
AWJ02310.1|4546913_4547168_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
AWJ02311.1|4547167_4548298_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
AWJ02312.1|4548362_4550648_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
>prophage 329
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4556110	4558738	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWJ02314.1|4556110_4558738_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 330
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4568436	4571286	4722506		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AWJ02320.1|4568436_4571286_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.9	4.0e-36
>prophage 331
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4575562	4581334	4722506		Enterobacteria_phage(33.33%)	5	NA	NA
AWJ02324.1|4575562_4576660_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.8	4.7e-118
AWJ02325.1|4576771_4577827_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWJ02326.1|4577900_4578965_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
AWJ02327.1|4578964_4579615_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AWJ02328.1|4579690_4581334_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 332
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4590663	4591287	4722506		Bacillus_virus(100.0%)	1	NA	NA
AWJ02339.1|4590663_4591287_+	cytochrome c biogenesis ATP-binding export protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 333
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4603161	4610810	4722506		Vibrio_phage(50.0%)	8	NA	NA
AWJ02352.1|4603161_4604169_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
AWJ02353.1|4604307_4604592_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AWJ02354.1|4604716_4606477_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
AWJ02355.1|4606502_4606625_-	aldose epimerase	NA	NA	NA	NA	NA
AWJ02356.1|4606625_4607321_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AWJ02357.1|4607348_4608539_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
AWJ02358.1|4608872_4609217_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02359.1|4609220_4610810_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 334
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4616564	4620865	4722506		Clostridioides_phage(50.0%)	4	NA	NA
AWJ02364.1|4616564_4617131_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AWJ02365.1|4617542_4618256_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWJ02366.1|4618294_4619281_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02367.1|4619398_4620865_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
>prophage 335
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4635412	4636270	4722506		Catovirus(100.0%)	1	NA	NA
AWJ02381.1|4635412_4636270_-	endonuclease IV with intrinsic 3''-5'' exonuclease activity	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 336
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4640340	4644126	4722506	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AWJ02386.1|4640340_4642332_+	colicin I receptor	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
AWJ02387.1|4642363_4643200_-	S-formylglutathione hydrolase YeiG	NA	NA	NA	NA	NA
AWJ02388.1|4643127_4643304_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02389.1|4643360_4643474_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AWJ02390.1|4643457_4644126_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 337
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4647820	4649341	4722506		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWJ02395.1|4647820_4649341_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 338
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4669739	4679180	4722506		Enterobacteria_phage(85.71%)	10	NA	NA
AWJ02414.1|4669739_4670666_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWJ02415.1|4670670_4671402_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AWJ02416.1|4671382_4671490_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02417.1|4671549_4672281_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWJ02418.1|4672502_4674188_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWJ02419.1|4674184_4674904_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWJ02420.1|4674950_4675421_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AWJ02421.1|4675460_4675922_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWJ02422.1|4676046_4678047_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AWJ02423.1|4678043_4679180_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 339
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4691589	4693623	4722506	tRNA	Indivirus(100.0%)	1	NA	NA
AWJ02427.1|4691589_4693623_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 340
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4704271	4707828	4722506		Paenibacillus_phage(50.0%)	4	NA	NA
AWJ02439.1|4704271_4705090_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
AWJ02440.1|4705141_4705888_+	transcriptional regulator	NA	NA	NA	NA	NA
AWJ02441.1|4705861_4706827_-	sugar kinase	NA	NA	NA	NA	NA
AWJ02442.1|4706823_4707828_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	6.4e-13
>prophage 341
CP029180	Escherichia coli strain H9Ecoli chromosome, complete genome	4722506	4717046	4722245	4722506	integrase	Escherichia_phage(50.0%)	10	4718280:4718292	4721029:4721041
AWJ02452.1|4717046_4717946_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
4718280:4718292	attL	ATTATAATAATCA	NA	NA	NA	NA
AWJ02453.1|4718351_4718669_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02454.1|4718656_4718872_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02455.1|4718934_4719948_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
AWJ02456.1|4720063_4720363_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
AWJ02457.1|4720477_4720753_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
AWJ02458.1|4720930_4721431_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
4721029:4721041	attR	TGATTATTATAAT	NA	NA	NA	NA
AWJ02459.1|4721494_4721719_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWJ02460.1|4721718_4722021_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	1.9e-45
AWJ02461.1|4722020_4722245_+	hypothetical protein	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
>prophage 1
CP029181	Escherichia coli strain H9Ecoli plasmid p1-H9, complete sequence	145524	0	67221	145524	transposase,plate,integrase	Escherichia_phage(43.75%)	54	51082:51141	64883:65703
AWJ02663.1|0_882_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	2.9e-54
AWJ02664.1|2237_2600_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02665.1|2600_3752_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AWJ02666.1|3708_4077_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	7.2e-39
AWJ02667.1|4133_4700_-	recombination-associated protein RdgC	NA	Q71TA1	Escherichia_phage	97.8	7.3e-91
AWJ02668.1|4692_4977_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.3e-48
AWJ02669.1|4961_5174_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02670.1|5250_5430_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	96.6	1.2e-26
AWJ02671.1|5438_6227_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	95.8	7.8e-115
AWJ02672.1|6266_6689_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
AWJ02673.1|6864_7257_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AWJ02674.1|7592_8477_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	99.7	4.7e-161
AWJ02675.1|8769_9579_+	helicase	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AWJ02676.1|9747_10944_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AWJ02677.1|10960_11962_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AWJ02678.1|12187_13894_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
AWJ02679.1|13953_15543_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	7.1e-301
AWJ02680.1|15552_16368_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	2.4e-111
AWJ02681.1|16403_16985_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.0	8.6e-103
AWJ02682.1|16996_17506_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AWJ02683.1|17665_18778_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AWJ02684.1|18971_19127_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	88.2	1.2e-14
AWJ02685.1|21827_24002_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWJ02686.1|24335_25160_+	carbon-phosphorus lyase	NA	A0A0E3D9J5	Bacillus_phage	26.7	6.9e-05
AWJ02687.1|25172_26408_+	MFS transporter	NA	NA	NA	NA	NA
AWJ02688.1|26440_27154_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.4	4.1e-14
AWJ02689.1|27342_27744_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02690.1|28390_29914_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
AWJ02691.1|30207_30639_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02692.1|33200_33923_-	hypothetical protein	NA	NA	NA	NA	NA
AWJ02693.1|33919_34405_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWJ02694.1|35430_35961_+	hypothetical protein	NA	NA	NA	NA	NA
AWJ02695.1|37089_38136_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWJ02696.1|39130_40282_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AWJ02697.1|43227_46743_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
AWJ02698.1|47112_47313_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
AWJ02699.1|47602_47890_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	5.8e-20
AWJ02700.1|47886_48138_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWJ02701.1|48390_48522_+	replication protein RepA4	NA	NA	NA	NA	NA
51082:51141	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AWJ02702.1|51133_51838_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-137
AWJ02703.1|52157_53333_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
AWJ02704.1|53356_56509_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AWJ02705.1|56578_57058_-	transcriptional regulator	NA	NA	NA	NA	NA
AWJ02706.1|57149_57854_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-137
AWJ02707.1|58398_58746_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWJ02708.1|58909_59701_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWJ02709.1|59793_60267_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AWJ02710.1|60423_61437_+|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	2.3e-71
AWJ02711.1|61375_61990_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWJ02712.1|64185_64890_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-137
AWJ02713.1|65224_65617_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AWJ02714.1|65936_66323_-	bleomycin binding protein	NA	NA	NA	NA	NA
64883:65703	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCAAGGAAGTGTATGAAAAATGTCTGGTATAATAAAGATATCATCTTGAAAATCGAGTGTTGCTCTGTGGATAACTTGCAGGGTTTAATAAGTATCTTTACTCAAAAGTTGCAATCAATAATTTATTGAAAAAGATTGAAAGGTGGTGGTAAATAATGTTACAATGTGGGAGTATCAGTTTAAATTCTTCGTGAAATAGTGTTCTTTTAAGCTAATAAAAAATGCACGTGGAATTTAGGTCAAAGAAAAGTAAAGAAAAATTTATTTATGGAGGTAAAAAAGGATGAGTCAAGTTGTTGATTTTTTAAATGAAGCAAAAACTTTTTATTTTGCAACCGTTGAAGGAGACCAGCCAAGGGTCAGACCGTTTAATGCAGCCATGGAGAGGAATGGCAAGGTCTATCTTGGTACAACCAATCAGAAAAAAGTTTATCAGCAGTTATTGGCAAATTCAAAGGTGGAAGTCTCAGGTATGGCAAAAGGAAAATGGATTCGGCTCACCGGCGAAGCCGTAATTGATGATACCGTGGAAGCAAGGGAAGCAATGCTTGAAGCAAATCCGCCTTTGAGAGATTGGTATAGCGCTGATGATGGGAAATTCACCGTATTTTATTTGAAAAACATGCAGGCAGTTTTATATTCCTTTACAGGAGATCCGGAGATATTAGATAATTAATCAAAACATGCAGCCCAAGTGTAGAATGAACTGACCCCCATAAGTTAGACCAAAAATCTAACTTATGGGAGGTCATTTTTTATGGC	NA	NA	NA	NA
AWJ02715.1|66391_66571_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AWJ02716.1|66516_67221_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-137
>prophage 2
CP029181	Escherichia coli strain H9Ecoli plasmid p1-H9, complete sequence	145524	82427	111874	145524	transposase,terminase	Escherichia_phage(77.78%)	29	NA	NA
AWJ02727.1|82427_82868_+	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AWJ02728.1|82864_83113_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AWJ02729.1|83149_84277_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.1	7.6e-156
AWJ02730.1|84379_85021_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	96.7	1.2e-110
AWJ02731.1|85210_85771_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	99.5	2.9e-100
AWJ02732.1|86018_86330_-	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
AWJ02733.1|86380_87412_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.4	1.4e-193
AWJ02734.1|87419_87641_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AWJ02735.1|88052_88145_+	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AWJ02736.1|88128_88239_+	ABC transporter	NA	NA	NA	NA	NA
AWJ02737.1|88277_89258_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AWJ02738.1|89715_90246_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
AWJ02739.1|90242_90839_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	99.5	6.5e-114
AWJ02740.1|90893_91670_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
AWJ02741.1|91662_92289_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
AWJ02773.1|92302_94705_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	83.8	0.0e+00
AWJ02742.1|95220_95859_+	histidine kinase	NA	NA	NA	NA	NA
AWJ02743.1|95897_96878_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AWJ02774.1|97004_97100_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AWJ02744.1|97065_97275_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AWJ02745.1|97385_98237_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AWJ02746.1|98269_99385_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	92.2	4.0e-189
AWJ02747.1|99962_101447_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.6	1.6e-291
AWJ02748.1|102712_103165_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
AWJ02749.1|104888_105068_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	6.0e-23
AWJ02750.1|105072_105453_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AWJ02751.1|105452_105674_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	8.7e-32
AWJ02775.1|105856_107413_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.1e-104
AWJ02752.1|108757_111874_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.3	3.4e-28
