The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2034510	2043973	5331435	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
AWF44830.1|2034510_2035626_+	macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWF46717.1|2035622_2037563_+	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWF47257.1|2037639_2037861_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWF46984.1|2038186_2038504_+|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWF44087.1|2038567_2040814_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWF44102.1|2040933_2041152_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWF47775.1|2041505_2042207_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWF47383.1|2042251_2043973_-	thiol reductant ABC exporter, CydC subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 2
CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2299668	2368814	5331435	capsid,head,portal,tail,terminase,plate,tRNA,integrase	Enterobacteria_phage(51.61%)	80	2326861:2326882	2363570:2363591
AWF43642.1|2299668_2300775_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase	tRNA	NA	NA	NA	NA
AWF44585.1|2300831_2301290_-	phosphatase NudJ	NA	NA	NA	NA	NA
AWF47504.1|2301306_2301927_-	pseudouridine synthase family protein	NA	NA	NA	NA	NA
AWF48320.1|2302197_2303448_+	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWF45104.1|2303720_2304434_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF46497.1|2304430_2304823_-	ACT domain protein	NA	NA	NA	NA	NA
AWF47216.1|2304815_2305139_-	antibiotic biosynthesis monooxygenase family protein	NA	NA	NA	NA	NA
AWF46472.1|2305382_2305568_+	hypothetical protein	NA	NA	NA	NA	NA
AWF44061.1|2305588_2305711_-	hypothetical protein	NA	NA	NA	NA	NA
AWF44060.1|2305928_2307122_-	alcohol dehydrogenase GroES-associated family protein	NA	NA	NA	NA	NA
AWF43949.1|2307744_2307930_+	stress-induced bacterial acidophilic repeat motif family protein	NA	NA	NA	NA	NA
AWF46901.1|2308020_2308515_+	protein YciF	NA	NA	NA	NA	NA
AWF46496.1|2308541_2309048_+	protein YciE	NA	NA	NA	NA	NA
AWF44186.1|2309064_2309952_+	manganese containing catalase family protein	NA	NA	NA	NA	NA
AWF45910.1|2310007_2311414_+	bacterial Cytochrome Ubiquinol Oxidase family protein	NA	NA	NA	NA	NA
AWF47234.1|2311410_2312421_+	cytochrome d ubiquinol oxidase, subunit II	NA	NA	NA	NA	NA
AWF48412.1|2312533_2312731_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43916.1|2313297_2313930_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF45807.1|2313969_2314149_+	hypothetical protein	NA	NA	NA	NA	NA
AWF45473.1|2314546_2315233_+	EAL domain protein	NA	NA	NA	NA	NA
AWF46885.1|2315345_2315510_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43739.1|2315543_2317052_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase family protein	NA	NA	NA	NA	NA
AWF47770.1|2317172_2318063_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF46727.1|2318069_2319854_-	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWF45627.1|2319927_2321136_-	hypothetical protein	NA	NA	NA	NA	NA
AWF44436.1|2321438_2322482_+	L-asparaginase	NA	NA	NA	NA	NA
AWF46870.1|2322562_2322682_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46384.1|2322989_2323145_-	hypothetical protein	NA	NA	NA	NA	NA
AWF46974.1|2323143_2324058_+	lipid A biosynthesis lauroyl (or palmitoleoyl) acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
AWF44746.1|2324147_2324786_+	leucine efflux protein	NA	NA	NA	NA	NA
AWF45278.1|2324916_2325180_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48497.1|2325239_2325365_-	hypothetical protein	NA	NA	NA	NA	NA
AWF47199.1|2325556_2325694_-	hypothetical protein	NA	NA	NA	NA	NA
AWF45654.1|2325715_2326729_-	putative diguanylate cyclase YeaP	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
AWF44255.1|2326794_2326911_-	hypothetical protein	NA	NA	NA	NA	NA
2326861:2326882	attL	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
AWF44128.1|2326993_2327977_-|integrase	phage integrase family protein	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AWF45829.1|2328811_2329030_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWF43563.1|2329045_2329423_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48439.1|2329438_2329702_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47450.1|2329779_2330004_+	hypothetical protein	NA	NA	NA	NA	NA
AWF44738.1|2330799_2331735_+	DNA adenine methylase family protein	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AWF47477.1|2331772_2333920_+	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
AWF46178.1|2334177_2336124_+	hypothetical protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
AWF47469.1|2336107_2337124_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46276.1|2337290_2337404_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43948.1|2338045_2338798_+	putative membrane protein	NA	NA	NA	NA	NA
AWF44826.1|2339274_2340327_-|portal	phage portal protein, PBSX family	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
AWF45012.1|2340329_2342057_-|terminase	ATPase subunit of terminase family protein	terminase	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
AWF45410.1|2342213_2343053_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
AWF45037.1|2343063_2344098_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AWF46479.1|2344147_2345014_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
AWF46998.1|2345118_2345634_+|head	phage head completion family protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
AWF47806.1|2345633_2345834_+	phage Tail Protein X family protein	NA	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWF45686.1|2345824_2346109_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46641.1|2346105_2346651_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
AWF45252.1|2346662_2346992_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47362.1|2347047_2347173_+	hypothetical protein	NA	NA	NA	NA	NA
AWF44542.1|2347173_2347641_+|tail	P2 phage tail completion R family protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AWF44332.1|2347637_2348273_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AWF45115.1|2348269_2348857_+|plate	phage baseplate assembly V family protein	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AWF45596.1|2348874_2349204_+	lysozyme family protein	NA	A0A0A7NQ90	Enterobacteria_phage	53.7	1.2e-24
AWF46080.1|2349205_2350129_+|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
AWF45795.1|2350211_2353145_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.5	2.4e-20
AWF47859.1|2353141_2353354_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46710.1|2353353_2354451_+|tail	phage tail-collar fiber family protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AWF45264.1|2354604_2355963_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
AWF46009.1|2356207_2356483_-	phage P2 GpU family protein	NA	A0A0A7NV65	Enterobacteria_phage	62.5	1.9e-23
AWF46809.1|2356714_2359690_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
AWF44810.1|2359834_2360152_-|tail	putative phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWF47759.1|2360197_2360713_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWF44204.1|2360712_2361885_-|tail	major tail sheath protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AWF46801.1|2362039_2363179_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AWF46075.1|2363738_2363978_+	hypothetical protein	NA	NA	NA	NA	NA
2363570:2363591	attR	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
AWF45887.1|2363967_2364327_-	hypothetical protein	NA	NA	NA	NA	NA
AWF45952.1|2364310_2364820_-	hypothetical protein	NA	NA	NA	NA	NA
AWF46741.1|2364965_2365658_+	glutamine amidotransferase class-I family protein	NA	NA	NA	NA	NA
AWF45757.1|2365689_2366874_-	cyanate transporter family protein	NA	NA	NA	NA	NA
AWF47893.1|2366975_2367767_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF45796.1|2367750_2368197_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43716.1|2368313_2368814_-|tRNA	ybaK / prolyl-tRNA synthetases associated domain protein	tRNA	NA	NA	NA	NA
>prophage 3
CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2491983	2536028	5331435	capsid,portal,tail,terminase,integrase	Klebsiella_phage(29.27%)	51	2490314:2490328	2521772:2521786
2490314:2490328	attL	TCAGCAGGCGAATAA	NA	NA	NA	NA
AWF44005.1|2491983_2493171_+|integrase	phage integrase family protein	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
AWF48411.1|2493671_2494610_-	recT family protein	NA	H6WRX0	Salmonella_phage	84.6	5.0e-153
AWF47684.1|2494793_2497943_-	enterobacterial exodeoxyribonuclease VIII family protein	NA	H6WRX1	Salmonella_phage	56.5	7.8e-291
AWF45028.1|2498244_2498436_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43801.1|2498432_2498546_-	putative gifsy-1 prophage protein	NA	NA	NA	NA	NA
AWF44272.1|2499056_2499176_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43494.1|2499267_2499411_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43787.1|2499986_2500523_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
AWF45490.1|2500651_2501446_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
AWF45489.1|2501463_2502351_+	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	2.4e-24
AWF46511.1|2502353_2503103_+	istB-like ATP binding family protein	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
AWF44141.1|2503206_2503479_+	hypothetical protein	NA	H6WRX9	Salmonella_phage	55.8	2.0e-06
AWF48146.1|2503475_2503679_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
AWF45051.1|2503671_2503908_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	92.1	2.4e-32
AWF48496.1|2504155_2505205_+	DGQHR domain protein	NA	NA	NA	NA	NA
AWF47047.1|2505872_2506037_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47745.1|2506089_2506488_-|portal	phage portal family protein	portal	A0A1S6KZW5	Salmonella_phage	83.1	3.0e-59
AWF45123.1|2506639_2506873_+	dinI-like family protein	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
AWF45435.1|2506950_2507172_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43487.1|2507229_2507829_+	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
AWF48391.1|2508037_2508334_+	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.7e-35
AWF47155.1|2508330_2508699_+	endodeoxyribonuclease RusA family protein	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
AWF46763.1|2508695_2509478_+	antitermination family protein	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
AWF43352.1|2509574_2509889_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.7e-42
AWF46166.1|2510842_2511154_+	putative membrane protein	NA	A0A286N2Q5	Klebsiella_phage	98.0	1.6e-47
AWF46550.1|2511150_2511690_+	putative Peptidoglycan domain protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
AWF48013.1|2511686_2512031_+	putative membrane protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AWF46887.1|2512027_2512303_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AWF45608.1|2512319_2512448_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.7	6.8e-13
AWF45430.1|2512907_2513036_+	hypothetical protein	NA	A0A286N2R0	Klebsiella_phage	78.6	1.4e-10
AWF47617.1|2513261_2513507_+	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AWF43346.1|2514369_2515374_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AWF45450.1|2515351_2516659_+|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.2e-148
AWF45024.1|2516658_2518059_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
AWF46165.1|2518129_2519155_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.4	1.2e-99
AWF43344.1|2519239_2520025_+	putative phage protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AWF47187.1|2520035_2520989_+|capsid	putative major capsid protein	capsid	A0A1B0VMF8	Pseudomonas_phage	74.0	2.5e-131
AWF44848.1|2521310_2521706_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
AWF45033.1|2521707_2521962_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
2521772:2521786	attR	TTATTCGCCTGCTGA	NA	NA	NA	NA
AWF47602.1|2522191_2522575_+	putative glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AWF47690.1|2522576_2523128_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
AWF47064.1|2523540_2524713_+	bacterial Ig-like domain family protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AWF46608.1|2524766_2525249_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46593.1|2525416_2525584_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47611.1|2525859_2526171_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43874.1|2526262_2529163_+|tail	prophage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	5.2e-100
AWF44315.1|2529327_2529627_+	alkanesulfonate transport protein	NA	A0A286S298	Klebsiella_phage	70.8	1.4e-37
AWF43985.1|2529807_2530290_+	hypothetical protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
AWF48197.1|2530299_2530680_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	2.4e-69
AWF47058.1|2530676_2533751_+|tail	phage tail family protein	tail	A0A286S259	Klebsiella_phage	96.7	0.0e+00
AWF44982.1|2533826_2536028_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	4.4e-99
>prophage 4
CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	2823374	2834261	5331435		Escherichia_phage(87.5%)	9	NA	NA
AWF44415.1|2823374_2823995_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AWF43928.1|2823987_2825253_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AWF45482.1|2825264_2826167_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWF46338.1|2826427_2827189_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWF46853.1|2827209_2828070_-	beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AWF46042.1|2828367_2828628_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWF45358.1|2828714_2829803_+	recF/RecN/SMC N terminal domain protein	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AWF47115.1|2829833_2831099_-	lactose permease	NA	NA	NA	NA	NA
AWF43868.1|2831153_2834261_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
CP029137	Klebsiella pneumoniae strain AR376 chromosome, complete genome	5331435	4246400	4323878	5331435	capsid,head,portal,tail,terminase,plate,tRNA,lysis,integrase	Salmonella_phage(77.08%)	87	4291282:4291328	4326159:4326205
AWF46601.1|4246400_4247138_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AWF44324.1|4247269_4248601_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AWF47040.1|4248646_4249030_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AWF43371.1|4249342_4250032_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AWF44478.1|4250089_4251175_-	RNA 2'-O ribose methyltransferase substrate binding family protein	NA	NA	NA	NA	NA
AWF45066.1|4251378_4251804_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AWF45212.1|4251873_4252572_+	DTW domain protein	NA	NA	NA	NA	NA
AWF45857.1|4252606_4255258_+	succinyl-CoA ligase like flavodoxin domain protein	NA	NA	NA	NA	NA
AWF43924.1|4255378_4256734_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWF43691.1|4256775_4257099_+	hypothetical protein	NA	NA	NA	NA	NA
AWF44153.1|4257102_4258398_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
AWF47288.1|4258481_4258694_-	hypothetical protein	NA	NA	NA	NA	NA
AWF44455.1|4264390_4264516_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43564.1|4264554_4267128_-	ATP-dependent chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AWF44683.1|4267257_4267959_-	multi-copper polyphenol oxidoreductase laccase family protein	NA	NA	NA	NA	NA
AWF47169.1|4267985_4268966_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AWF44598.1|4269097_4269835_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWF45478.1|4270105_4270441_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWF47512.1|4270695_4271856_+	P-protein	NA	NA	NA	NA	NA
AWF48387.1|4271852_4272725_-	SMP-30/Gluconolaconase/LRE-like region family protein	NA	NA	NA	NA	NA
AWF43789.1|4272787_4273909_-	T-protein	NA	NA	NA	NA	NA
AWF46071.1|4273918_4274989_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AWF45762.1|4275331_4275841_+	hypothetical protein	NA	NA	NA	NA	NA
AWF44728.1|4275833_4277057_+	putative diguanylate cyclase YfiN	NA	NA	NA	NA	NA
AWF47301.1|4277070_4277553_+	ompA family protein	NA	NA	NA	NA	NA
AWF47126.1|4277561_4278932_-	pepSY-associated TM helix family protein	NA	NA	NA	NA	NA
AWF44227.1|4278988_4279447_-	hypothetical protein	NA	NA	NA	NA	NA
AWF45640.1|4279566_4279914_-	ribosomal protein L19	NA	NA	NA	NA	NA
AWF45404.1|4279953_4280721_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AWF44969.1|4280752_4281211_-	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AWF45746.1|4281319_4281568_-	ribosomal protein S16	NA	NA	NA	NA	NA
AWF46785.1|4281827_4283192_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWF43920.1|4283355_4284147_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWF43419.1|4284211_4285453_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47930.1|4285572_4286163_-	protein GrpE	NA	NA	NA	NA	NA
AWF44106.1|4286287_4287166_+	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWF45147.1|4287252_4288914_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWF43325.1|4288939_4289080_+	hypothetical protein	NA	NA	NA	NA	NA
AWF46259.1|4289061_4289403_+	smpA / OmlA family protein	NA	NA	NA	NA	NA
AWF47979.1|4289469_4289760_-	hypothetical protein	NA	NA	NA	NA	NA
AWF45706.1|4289749_4290187_-	ribosome association toxin RatA	NA	NA	NA	NA	NA
AWF43837.1|4290336_4290819_+	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4291282:4291328	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AWF43538.1|4291602_4291800_+	hypothetical protein	NA	NA	NA	NA	NA
AWF47944.1|4292112_4293201_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.4	2.1e-174
AWF46506.1|4293206_4293692_-	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	77.0	9.1e-58
AWF46121.1|4293688_4296316_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	3.9e-118
AWF44142.1|4296308_4296428_-	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWF48277.1|4296442_4296742_-	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	79.0	2.8e-33
AWF48446.1|4296794_4297310_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWF45139.1|4297319_4298492_-|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
AWF48344.1|4298639_4299803_-|tail	phage tail-collar fiber family protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
AWF46813.1|4299830_4300049_-	hypothetical protein	NA	NA	NA	NA	NA
AWF44625.1|4300049_4302158_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
AWF45326.1|4302163_4302757_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
AWF43706.1|4302749_4303658_-|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
AWF44356.1|4303644_4304007_-	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
AWF45321.1|4304003_4304576_-|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
AWF48292.1|4304644_4305091_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
AWF48464.1|4305083_4305515_-|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWF46478.1|4305477_4305651_-	putative fels-2 prophage protein	NA	A0A1S6KZX6	Salmonella_phage	73.7	4.7e-17
AWF47908.1|4305610_4306039_-|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
AWF43457.1|4306035_4306419_-	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
AWF45868.1|4306423_4306933_-	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
AWF45862.1|4306913_4307129_-	putative membrane protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AWF45776.1|4307132_4307336_-	phage Tail Protein X family protein	NA	E5G6M9	Salmonella_phage	88.1	1.7e-29
AWF45423.1|4307335_4307800_-|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
AWF47747.1|4307896_4308547_-|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
AWF48135.1|4308550_4309615_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
AWF45335.1|4309631_4310465_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
AWF45841.1|4310614_4312369_+	sigma-70, region 4 family protein	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
AWF47389.1|4312368_4313403_+|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
AWF43365.1|4313437_4314871_-	SEFIR domain protein	NA	NA	NA	NA	NA
AWF48416.1|4315086_4315929_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
AWF45900.1|4315928_4316147_-	hypothetical protein	NA	NA	NA	NA	NA
AWF44241.1|4316433_4316667_-	dinI-like family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
AWF44312.1|4316677_4316866_-	putative levan regulatory protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
AWF47494.1|4316909_4317023_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48334.1|4317019_4319434_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
AWF46043.1|4319430_4320288_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
AWF44516.1|4320284_4320512_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
AWF45985.1|4320511_4320745_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
AWF44274.1|4320812_4321154_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
AWF44554.1|4321117_4321240_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	92.3	1.5e-14
AWF46900.1|4321325_4321835_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWF48138.1|4321867_4322110_-	putative bacteriophage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AWF45552.1|4322457_4322862_+	putative phage regulatory protein cI	NA	A0A1S6KZZ7	Salmonella_phage	49.1	2.2e-28
AWF43954.1|4322990_4323878_+|integrase	phage integrase family protein	integrase	A0A1S6L016	Salmonella_phage	93.6	2.1e-164
4326159:4326205	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
CP029135	Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence	70613	3937	40415	70613	transposase,integrase	Escherichia_phage(22.73%)	38	3022:3051	15596:15625
3022:3051	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAG	NA	NA	NA	NA
AWF43060.1|3937_4201_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF43061.1|4571_6041_-	HNH endonuclease family protein	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AWF43062.1|6687_6801_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43063.1|6797_6944_-	helix-turn-helix domain of resolvase family protein	NA	NA	NA	NA	NA
AWF43064.1|7759_8773_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWF43065.1|10031_10796_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWF43066.1|11062_12040_+	type-2 restriction enzyme EcoRII	NA	E5E3X4	Burkholderia_phage	37.3	8.1e-13
AWF43067.1|12305_13739_-	DNA (cytosine-5-)-methyltransferase family protein	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWF43068.1|13843_14110_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	1.2e-40
AWF43069.1|14331_14769_-	restriction endonuclease family protein	NA	NA	NA	NA	NA
AWF43070.1|14868_15573_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AWF43071.1|16576_16711_+	putative stbA	NA	NA	NA	NA	NA
15596:15625	attR	CTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AWF43072.1|16719_16911_+	putative plasmid stability protein StbB	NA	NA	NA	NA	NA
AWF43073.1|16921_17101_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	51.5	5.8e-18
AWF43074.1|17203_17338_-	insA N-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	100.0	3.5e-12
AWF43075.1|18033_18678_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	96.2	1.2e-116
AWF43076.1|18997_19132_+	insA N-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	100.0	3.5e-12
AWF43077.1|21072_22020_-|transposase	transposase family protein	transposase	A0A1S7J231	Thermus_phage	29.2	1.9e-19
AWF43078.1|22305_22509_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43079.1|23675_23804_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43080.1|23789_24521_+	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWF43081.1|24558_24837_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43082.1|25154_25766_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43083.1|25762_26632_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	57.6	5.4e-69
AWF43084.1|26836_26962_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43085.1|27122_27743_-	resolvase, N terminal domain protein	NA	A0A219Y912	Aeromonas_phage	31.0	1.0e-08
AWF43086.1|28780_29422_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A4JWV7	Burkholderia_virus	25.5	1.1e-05
AWF43087.1|30059_31181_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	61.1	4.5e-132
AWF43088.1|31246_31951_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF43089.1|32061_33324_-|transposase	transposase DDE domain group 1 family protein	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWF43090.1|33505_33724_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	4.4e-36
AWF43091.1|34049_34445_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	99.2	1.2e-63
AWF43092.1|34627_35488_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWF43093.1|35910_36051_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43094.1|36208_37045_-	aminoglycoside/hydroxyurea antibiotic resistance kinase family protein	NA	NA	NA	NA	NA
AWF43095.1|37044_37848_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWF43096.1|37908_38724_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AWF43097.1|39410_40415_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 2
CP029135	Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence	70613	48667	61196	70613	integrase	Escherichia_phage(33.33%)	14	45479:45490	61988:61999
45479:45490	attL	TGCCGGCCGCTG	NA	NA	NA	NA
AWF43110.1|48667_49195_+	PLD-like domain protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AWF43111.1|49227_49659_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43112.1|49790_49967_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43113.1|50138_51104_-	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AWF43114.1|51235_51367_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43115.1|51573_53058_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWF43116.1|53466_53898_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWF43117.1|53897_55169_+	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AWF43118.1|55250_56225_-	parB	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWF43119.1|56224_57430_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWF43120.1|57844_58114_+	LWamide neuropeptides domain protein	NA	NA	NA	NA	NA
AWF43121.1|58470_59298_-	initiator Replication family protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWF43122.1|60104_60362_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43123.1|60419_61196_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
61988:61999	attR	CAGCGGCCGGCA	NA	NA	NA	NA
>prophage 1
CP029136	Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence	190416	2389	135839	190416	transposase,integrase,holin,bacteriocin	Escherichia_phage(19.3%)	128	24764:24779	132929:132943
AWF43273.1|2389_4408_+|bacteriocin	DNase/tRNase domain of colicin-like bacteriocin family protein	bacteriocin	NA	NA	NA	NA
AWF43275.1|5127_5508_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	37.9	5.2e-16
AWF43228.1|6393_7251_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWF43260.1|8697_10893_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
AWF43252.1|10889_12206_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43200.1|12209_14519_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AWF43265.1|15163_15373_-|transposase	transposase family protein	transposase	Q9MCT5	Escherichia_phage	98.6	4.1e-31
AWF43234.1|15476_16088_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	99.4	3.5e-99
AWF43182.1|16224_17478_-	lactose permease	NA	NA	NA	NA	NA
AWF43296.1|17529_20604_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AWF43312.1|20725_21808_-	periplasmic binding and sugar binding domain of LacI family protein	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AWF43207.1|22030_22246_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43251.1|22268_23279_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWF43143.1|23682_24687_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
24764:24779	attL	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43179.1|25390_25510_+	hypothetical protein	NA	NA	NA	NA	NA
24764:24779	attL	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43240.1|25557_25851_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
24764:24779	attL	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43154.1|25949_26717_-	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AWF43313.1|26717_27674_-	fe(3+) dicitrate transport system permease protein FecD	NA	NA	NA	NA	NA
AWF43308.1|27670_28669_-	ABC 3 transport family protein	NA	NA	NA	NA	NA
AWF43264.1|28665_29568_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF43229.1|29612_31937_-	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AWF43303.1|32022_32976_-	fecR family protein	NA	NA	NA	NA	NA
AWF43250.1|32972_33494_-	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWF43287.1|33969_34338_-	putative tnpA	NA	U5N3F9	Enterobacteria_phage	89.9	2.4e-58
AWF43316.1|34596_34764_+|integrase	putative integrase catalytic region	integrase	NA	NA	NA	NA
AWF43217.1|35048_36176_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF43198.1|36172_36766_+	response regulator	NA	NA	NA	NA	NA
AWF43223.1|36762_37611_+	N-terminal TM domain of oligopeptide transport permease C family protein	NA	NA	NA	NA	NA
AWF43249.1|37610_38531_+	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWF43317.1|38543_40148_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWF43293.1|40192_41140_+	acetamidase/Formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AWF43171.1|41147_42881_+	nickel import ATP-binding protein NikE	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AWF43320.1|44701_45049_-|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.3	2.6e-62
AWF43254.1|45116_45635_-|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.1	1.7e-86
AWF43172.1|45679_46654_-|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.8	2.7e-149
AWF43226.1|46703_47051_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AWF43139.1|47047_47425_-|transposase	transposase family protein	transposase	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AWF43209.1|48613_49726_-	4Fe-4S single cluster domain protein	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
48645:48660	attR	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43138.1|49718_51107_-	4Fe-4S single cluster domain protein	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
48645:48660	attR	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43225.1|51779_52145_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	95.0	2.9e-56
48645:48660	attR	CGGCCTGTTGAGGAAC	NA	NA	NA	NA
AWF43204.1|52192_52528_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	72.8	1.9e-30
AWF43248.1|52539_53244_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF43196.1|53437_53758_-	hypothetical protein	NA	Q38213	Escherichia_phage	52.9	3.2e-27
AWF43185.1|54339_54927_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.9	1.2e-14
AWF43271.1|54977_55787_+	phosphate/phosphite/phosphonate ABC transporter, periplasmic binding family protein	NA	NA	NA	NA	NA
AWF43141.1|55795_56623_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWF43190.1|56631_57642_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AWF43208.1|57635_58505_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF43164.1|58612_59248_+	hypothetical protein	NA	Q38213	Escherichia_phage	52.8	1.2e-33
AWF43180.1|59533_59656_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43147.1|59713_60694_-	hypothetical protein	NA	Q38213	Escherichia_phage	99.1	8.9e-185
AWF43292.1|60952_61246_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	89.7	9.1e-45
AWF43170.1|61374_61599_-	insA N-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	98.6	1.2e-36
AWF43192.1|62840_62978_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43278.1|62996_63566_+	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWF43184.1|63680_66476_+	AAA domain protein	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWF43213.1|66475_66673_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43257.1|67171_67660_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AWF43232.1|67646_68609_+	peptidase M48 family protein	NA	NA	NA	NA	NA
AWF43156.1|68923_69229_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF43309.1|69339_69951_+|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	45.9	4.0e-42
AWF43165.1|70159_70291_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43144.1|70451_71798_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF43237.1|72921_73176_-	putative yaeB	NA	NA	NA	NA	NA
AWF43299.1|73251_73419_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43177.1|73557_73761_-	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AWF43224.1|74206_74701_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43202.1|74731_75307_-	putative ydeA	NA	NA	NA	NA	NA
AWF43277.1|75294_75564_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43187.1|75921_76272_+	bacterial regulatory, arsR family protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWF43268.1|76321_76684_+	arsenical resistance operon trans-acting repressor ArsD	NA	NA	NA	NA	NA
AWF43188.1|76701_78453_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWF43151.1|78500_79790_+	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWF43321.1|79802_80228_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWF43137.1|80260_80797_-	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWF43274.1|80918_81305_-	anion-transporting ATPase family protein	NA	NA	NA	NA	NA
AWF43169.1|81334_82669_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWF43267.1|82693_83056_-	arsenical resistance operon trans-acting repressor ArsD family protein	NA	NA	NA	NA	NA
AWF43245.1|83131_83677_-	RNA polymerase sigma factor, sigma-70 family protein	NA	NA	NA	NA	NA
AWF43314.1|83685_84399_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWF43266.1|84395_84722_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF43174.1|85053_85551_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWF43279.1|85600_86005_-	major intrinsic family protein	NA	NA	NA	NA	NA
AWF43242.1|86171_86987_+|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	A9YX10	Burkholderia_phage	25.9	1.7e-11
AWF43162.1|87477_87792_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF43142.1|87852_88032_+	putative plasmid stabilization protein	NA	NA	NA	NA	NA
AWF43176.1|88263_88698_-	putative copper-binding protein PcoE	NA	NA	NA	NA	NA
AWF43168.1|88914_90315_-	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWF43289.1|90311_90992_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWF43160.1|91046_91976_-	copper resistance D family protein	NA	NA	NA	NA	NA
AWF43149.1|91980_92319_-	copper resistance protein C	NA	NA	NA	NA	NA
AWF43152.1|92400_93291_-	copper resistance protein B	NA	NA	NA	NA	NA
AWF43158.1|93296_95114_-	copper resistance protein A	NA	NA	NA	NA	NA
AWF43175.1|95347_95797_+	putative copper resistant protein PcoE	NA	NA	NA	NA	NA
AWF43236.1|96856_97054_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43285.1|97094_99455_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.3e-84
AWF43256.1|99668_100109_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43307.1|100195_103342_-	cation efflux system protein CusA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWF43222.1|103352_104645_-	cation efflux system protein CusB	NA	NA	NA	NA	NA
AWF43305.1|104758_104887_-	putative periplasmic copper-binding protein	NA	NA	NA	NA	NA
AWF43214.1|104923_105088_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43211.1|105140_106526_-	efflux transporter, outer membrane factor (OMF) lipo, NodT family protein	NA	NA	NA	NA	NA
AWF43150.1|106715_107396_+	transcriptional regulatory protein CusR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWF43295.1|107388_108864_+	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWF43306.1|109114_109546_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AWF43186.1|109841_110246_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF43311.1|110399_110795_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	92.4	5.7e-66
AWF43227.1|110947_111343_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	75.4	1.4e-43
AWF43284.1|111300_112182_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	63.2	1.2e-100
AWF43290.1|112423_112648_+	insA N-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	97.3	1.2e-36
AWF43148.1|112674_113070_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	92.4	2.6e-66
AWF43270.1|113221_115219_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWF43136.1|115281_116559_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43259.1|117541_118378_-	EAL domain protein	NA	NA	NA	NA	NA
AWF43318.1|120527_121451_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AWF43166.1|121853_122810_-	diguanylate cyclase domain protein	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AWF43301.1|123744_123897_-	hypothetical protein	NA	NA	NA	NA	NA
AWF43146.1|123944_124685_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AWF43253.1|125401_126100_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	55.7	5.2e-54
AWF43194.1|127163_128330_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AWF43193.1|128329_129301_+	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AWF43286.1|129300_130263_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43262.1|130797_131082_+|transposase	putative transposase family protein	transposase	A0A1W6JP07	Morganella_phage	86.8	1.0e-40
AWF43191.1|131078_131936_+|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	80.9	1.0e-128
AWF43263.1|131958_132114_-	antitoxin, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWF43319.1|132252_133524_-	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AWF43159.1|133523_133949_-	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AWF43189.1|134354_135839_+	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 1
CP029138	Klebsiella pneumoniae strain AR376 plasmid unnamed3, complete sequence	81137	2852	37133	81137	protease,integrase,transposase	Escherichia_phage(23.08%)	43	33098:33112	39493:39507
AWF48586.1|2852_3557_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AWF48532.1|3603_4836_-|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF48522.1|4946_5654_-	EAL domain protein	NA	NA	NA	NA	NA
AWF48561.1|5650_5887_-	merE family protein	NA	NA	NA	NA	NA
AWF48567.1|5883_6246_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWF48563.1|6263_7958_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWF48570.1|8009_8432_-	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWF48556.1|8467_8743_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AWF48552.1|8756_9107_-	merT mercuric transport family protein	NA	NA	NA	NA	NA
AWF48574.1|9178_9613_+	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF48510.1|9691_10696_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF48555.1|11518_12532_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	2.3e-71
AWF48565.1|13377_14301_-|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
AWF48503.1|14466_15327_+	beta-lactamase SHV-2	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
AWF48596.1|15347_16109_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWF48511.1|16216_19114_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
AWF48528.1|19208_19814_+	resolvase, N terminal domain protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWF48526.1|20396_22430_-	putative trbC conjugal transfer protein	NA	NA	NA	NA	NA
AWF48507.1|22496_23447_-	F plasmid transfer operon family protein	NA	NA	NA	NA	NA
AWF48579.1|23457_24684_-	putative trbA	NA	NA	NA	NA	NA
AWF48559.1|24764_25160_-	transglycosylase SLT domain protein	NA	NA	NA	NA	NA
AWF48585.1|25264_25660_-	hypothetical protein	NA	NA	NA	NA	NA
AWF48580.1|25727_26381_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWF48550.1|26472_26730_+	antitoxin PemI	NA	NA	NA	NA	NA
AWF48576.1|26731_27064_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWF48520.1|27342_27591_+	peptidase S24-like family protein	NA	A0A218MND2	uncultured_virus	50.0	5.6e-11
AWF48533.1|27656_28085_+	impB/mucB/samB family protein	NA	A0A1W6JNT0	Morganella_phage	50.0	9.9e-32
AWF48505.1|28042_28843_+	hypothetical protein	NA	F1C5A5	Cronobacter_phage	50.0	1.0e-61
AWF48512.1|28965_29175_-	hypothetical protein	NA	NA	NA	NA	NA
AWF48508.1|29312_29444_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48588.1|29440_30124_-	hypothetical protein	NA	NA	NA	NA	NA
AWF48519.1|30124_30382_-	hypothetical protein	NA	NA	NA	NA	NA
AWF48531.1|30399_31674_-	relB antitoxin family protein	NA	NA	NA	NA	NA
AWF48562.1|32201_32558_+	putative oRF10	NA	NA	NA	NA	NA
AWF48594.1|32535_33114_+	putative oRF11	NA	NA	NA	NA	NA
33098:33112	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
AWF48527.1|33115_33523_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48548.1|33675_34221_-	hypothetical protein	NA	NA	NA	NA	NA
AWF48583.1|34361_34832_+	putative oRF13	NA	NA	NA	NA	NA
AWF48569.1|34833_35067_+	helix-turn-helix domain protein	NA	A0A248SLB9	Klebsiella_phage	52.5	3.2e-08
AWF48542.1|35182_35647_+	restriction endonuclease family protein	NA	NA	NA	NA	NA
AWF48591.1|35643_36129_+	putative lipoprotein	NA	NA	NA	NA	NA
AWF48566.1|36170_36374_+	hypothetical protein	NA	NA	NA	NA	NA
AWF48506.1|36392_37133_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
39493:39507	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
