The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	448423	511925	4891057	portal,integrase,coat,terminase,tail	Salmonella_phage(32.26%)	80	450458:450475	510079:510096
AWF29715.1|448423_449101_+	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	2.1e-76
AWF32968.1|449139_449454_+	putative nitroreductase	NA	NA	NA	NA	NA
AWF31047.1|449568_449880_-	yebG family protein	NA	NA	NA	NA	NA
AWF29913.1|449989_450604_-	tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	1.9e-28
450458:450475	attL	CGCCAGCGGCCAGTCCTG	NA	NA	NA	NA
AWF31956.1|450648_451503_-	DMSO reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.7	2.0e-23
AWF31513.1|451504_452122_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	1.0e-74
AWF29659.1|452132_453791_-	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	50.8	1.4e-158
AWF30931.1|453787_454570_-	molybdopterin oxidoreductase Fe4S4 domain protein	NA	A0A077SK27	Escherichia_phage	46.5	1.6e-48
AWF31669.1|454700_455006_-	hypothetical protein	NA	NA	NA	NA	NA
AWF30048.1|455108_455963_-	glycosyltransferase 17 family protein	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
AWF30688.1|456155_456866_+	hypothetical protein	NA	NA	NA	NA	NA
AWF30837.1|456883_457444_-	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWF29559.1|457443_457782_-	hypothetical protein	NA	NA	NA	NA	NA
AWF29620.1|457932_458259_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	54.5	7.1e-22
AWF29825.1|458370_459585_+	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	30.0	2.5e-48
AWF32617.1|459599_460619_+	zinc-binding dehydrogenase family protein	NA	NA	NA	NA	NA
AWF29259.1|460823_462104_-|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	60.9	1.6e-154
AWF29467.1|462136_462385_-	hypothetical protein	NA	S4TND0	Salmonella_phage	54.3	4.0e-17
AWF31382.1|462859_463081_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32251.1|463043_463664_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	44.9	4.2e-47
AWF28968.1|464481_464664_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32052.1|464678_464951_-	putative gp45	NA	K7P7M4	Enterobacteria_phage	57.1	3.6e-19
AWF30977.1|465162_465933_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.4	1.8e-63
AWF32735.1|465929_467060_-	methyltransferase domain protein	NA	A0A060D598	Salmonella_phage	48.1	5.8e-87
AWF30706.1|467205_467559_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	94.0	6.2e-56
AWF30834.1|467630_468155_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	99.4	4.7e-100
AWF31322.1|468307_469225_-	recombinase, phage RecT family protein	NA	M9NZA6	Enterobacteria_phage	90.8	7.8e-159
AWF30309.1|469234_469516_-	hypothetical protein	NA	M9NZI3	Enterobacteria_phage	95.7	1.6e-46
AWF31070.1|469523_470492_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	74.6	3.2e-38
AWF31790.1|470568_470715_-	hypothetical protein	NA	G8C7T2	Escherichia_phage	97.9	1.9e-19
AWF29140.1|470771_470930_-	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	94.1	2.4e-20
AWF30119.1|472072_472315_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	94.1	1.5e-29
AWF30574.1|473130_473820_-	helix-turn-helix domain protein	NA	G8C7U1	Escherichia_phage	79.7	2.7e-95
AWF31703.1|473925_474159_+	helix-turn-helix family protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
AWF29136.1|474237_474732_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	91.5	1.6e-78
AWF30884.1|475384_475594_+	DNA-binding helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF31842.1|475590_476370_+	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	64.6	1.8e-95
AWF32029.1|476366_476666_+	putative protein ren	NA	M1FPD5	Enterobacteria_phage	52.6	4.8e-17
AWF31395.1|476907_477204_+	hypothetical protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
AWF30909.1|477997_478447_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	77.2	2.0e-46
AWF32287.1|478875_479043_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28908.1|479834_480143_+	putative phage protein	NA	K7P7B8	Enterobacteria_phage	99.0	1.6e-55
AWF32596.1|480142_480313_+	putative NinE-like protein from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	92.5	7.7e-20
AWF31446.1|481223_481415_+	bacteriophage Lambda NinG family protein	NA	H6WRY9	Salmonella_phage	88.9	1.2e-21
AWF33027.1|481554_482151_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	73.2	8.6e-82
AWF32169.1|482804_483110_+	putative membrane protein	NA	NA	NA	NA	NA
AWF29981.1|483160_483382_+	hypothetical protein	NA	S4TNV9	Salmonella_phage	40.6	1.3e-06
AWF30607.1|483384_483927_+	putative Peptidoglycan domain protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.1e-74
AWF31228.1|483923_484202_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32277.1|484170_484332_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	88.6	9.8e-17
AWF31915.1|484689_484833_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29297.1|484836_485475_+	hypothetical protein	NA	I6S676	Salmonella_phage	93.4	2.2e-115
AWF30584.1|485505_485961_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	81.3	4.0e-63
AWF31759.1|485957_487205_+|terminase	phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	98.9	2.7e-218
AWF31977.1|487219_488572_+|portal	putative phage portal protein	portal	H6WRT0	Salmonella_phage	78.7	5.4e-209
AWF31863.1|488630_489455_+	phage Mu F like family protein	NA	H6WRT1	Salmonella_phage	79.9	3.0e-117
AWF33032.1|489458_490724_+|coat	putative phage coat protein	coat	H6WRT2	Salmonella_phage	94.5	4.6e-226
AWF32810.1|490736_491198_+	putative decoration protein	NA	G0ZND8	Cronobacter_phage	80.4	4.5e-62
AWF28839.1|491210_492308_+|coat	putative phage coat protein	coat	G0ZND9	Cronobacter_phage	84.1	5.6e-180
AWF31163.1|492318_492603_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	75.3	1.7e-32
AWF32077.1|493066_493246_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	91.5	1.2e-26
AWF31612.1|493238_493601_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	90.8	3.9e-61
AWF29118.1|493608_494007_+	putative gp14	NA	Q5G8X5	Enterobacteria_phage	90.9	1.3e-62
AWF31278.1|494003_494390_+	putative gp15	NA	A0A1V0E5P4	Salmonella_phage	94.5	2.1e-65
AWF33266.1|494407_495142_+|tail	phage major tail 2 family protein	tail	H6WRU1	Salmonella_phage	86.0	2.1e-114
AWF33014.1|495178_495832_+	putative gp17	NA	I6R0Q2	Salmonella_phage	92.2	1.3e-112
AWF29837.1|496553_496811_-	putative regulator protein	NA	NA	NA	NA	NA
AWF29521.1|497176_497893_+	BRO family, N-terminal domain protein	NA	H6WRU8	Salmonella_phage	52.1	1.3e-47
AWF33180.1|498002_498698_+	phage regulatory Rha family protein	NA	A0A2I7RX10	Vibrio_phage	42.9	1.2e-13
AWF29095.1|499014_499128_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31741.1|499658_502004_+	putative gp21	NA	F1C5E9	Cronobacter_phage	39.4	4.7e-107
AWF33074.1|502047_502260_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29865.1|502418_502664_+|tail	phage minor tail family protein	tail	H6WRV8	Salmonella_phage	93.8	3.7e-39
AWF32678.1|503203_503887_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	99.1	2.7e-132
AWF33137.1|504231_504465_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31986.1|505421_508877_+	hypothetical protein	NA	A0A1V0E5M1	Salmonella_phage	57.7	0.0e+00
AWF30079.1|508923_509844_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	38.9	1.4e-51
AWF33103.1|509903_511286_+|tail	putative tail fiber	tail	K7P6I4	Enterobacteria_phage	57.0	2.1e-123
510079:510096	attR	CGCCAGCGGCCAGTCCTG	NA	NA	NA	NA
AWF29042.1|511368_511608_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	62.8	1.6e-23
AWF28836.1|511607_511925_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	1.5e-21
>prophage 2
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	683842	744342	4891057	transposase,integrase	Escherichia_phage(50.0%)	51	677180:677194	745308:745322
677180:677194	attL	GCCACACCCTGCACC	NA	NA	NA	NA
AWF29920.1|683842_685366_+|integrase	putative phage integrase	integrase	NA	NA	NA	NA
AWF30743.1|685328_686999_+|integrase	putative phage integrase	integrase	NA	NA	NA	NA
AWF31910.1|686995_689533_+	hypothetical protein	NA	NA	NA	NA	NA
AWF30296.1|689525_690029_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31620.1|690842_691190_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31245.1|692065_692257_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32669.1|692986_693106_+	dinI-like family protein	NA	NA	NA	NA	NA
AWF33235.1|693499_693943_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32513.1|693929_697430_+	DEAD/DEAH box helicase family protein	NA	M1IHE6	Paramecium_bursaria_Chlorella_virus	24.9	5.3e-14
AWF32364.1|698252_699170_+|transposase	transposase DDE domain protein	transposase	A0A1V0E8E1	Vibrio_phage	59.8	4.4e-101
AWF30810.1|699215_702068_-	hypothetical protein	NA	NA	NA	NA	NA
AWF29274.1|702585_703503_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31127.1|703547_703697_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33224.1|704006_706688_-	AAA domain protein	NA	NA	NA	NA	NA
AWF31492.1|706740_707286_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32739.1|707278_709666_-	restriction endonuclease family protein	NA	NA	NA	NA	NA
AWF31738.1|710279_710657_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.3e-67
AWF31525.1|710701_710929_-	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	98.7	1.1e-37
AWF32524.1|711176_711749_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWF30363.1|711892_712609_+	EAL domain protein	NA	NA	NA	NA	NA
AWF30608.1|712643_713279_-	fimbrial family protein	NA	NA	NA	NA	NA
AWF30782.1|713292_714288_-	fimbria adhesin protein	NA	NA	NA	NA	NA
AWF32167.1|714278_716765_-	papC C-terminal domain protein	NA	NA	NA	NA	NA
AWF32180.1|716776_717478_-	gram-negative pili assembly chaperone, C-terminal domain protein	NA	NA	NA	NA	NA
AWF32269.1|717573_718182_-	fimbrial family protein	NA	NA	NA	NA	NA
AWF29247.1|718511_718637_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	97.5	4.4e-17
AWF30603.1|718658_719162_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	99.4	5.7e-95
AWF29609.1|719172_720135_-	putative sugar kinase domain protein	NA	NA	NA	NA	NA
AWF28766.1|720560_720950_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33238.1|721095_721521_-	hypothetical protein	NA	NA	NA	NA	NA
AWF30421.1|722453_723419_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33020.1|723434_724004_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28854.1|724054_724468_-	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWF31531.1|724527_724794_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31706.1|724857_725787_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF29755.1|725916_727305_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AWF31496.1|727326_728322_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31606.1|728331_729318_-	hypothetical protein	NA	NA	NA	NA	NA
AWF28911.1|729314_729998_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31229.1|730261_730810_+	winged helix DNA-binding domain protein	NA	NA	NA	NA	NA
AWF32629.1|730806_732807_-	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AWF29966.1|732897_735366_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AWF30397.1|735362_737150_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AWF29152.1|737281_737809_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWF29423.1|738007_738805_+	KR domain protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	57.3	3.6e-75
AWF31197.1|738912_739890_+	metallo-beta-lactamase superfamily protein	NA	NA	NA	NA	NA
AWF31982.1|740005_740545_-	snoaL-like domain protein	NA	NA	NA	NA	NA
AWF30464.1|740699_741581_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF31795.1|741627_742521_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF30044.1|742511_743366_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF32935.1|743424_744342_-|transposase	transposase DDE domain protein	transposase	A0A1V0E8E1	Vibrio_phage	59.8	4.4e-101
745308:745322	attR	GGTGCAGGGTGTGGC	NA	NA	NA	NA
>prophage 3
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	1084078	1164129	4891057	capsid,portal,tRNA,protease,head,integrase,terminase,tail	Enterobacteria_phage(26.0%)	92	1104167:1104195	1165104:1165132
AWF31088.1|1084078_1084960_-|protease	protease HtpX	protease	NA	NA	NA	NA
AWF33177.1|1085153_1087202_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
AWF31030.1|1087221_1087908_-	proP effector	NA	NA	NA	NA	NA
AWF31634.1|1088004_1088502_-	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWF29462.1|1088748_1089918_+	inner membrane protein YebS	NA	NA	NA	NA	NA
AWF29645.1|1089886_1092520_+	mce related family protein	NA	NA	NA	NA	NA
AWF32630.1|1092642_1094040_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWF31215.1|1094146_1094386_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32815.1|1094420_1095065_-	serine/threonine-protein phosphatase 1	NA	Q8HA16	Enterobacteria_phage	48.1	1.3e-54
AWF31266.1|1095232_1096213_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31576.1|1096581_1096920_-	hypothetical protein	NA	NA	NA	NA	NA
AWF29887.1|1096936_1097806_-	inner membrane protein YebZ	NA	NA	NA	NA	NA
AWF29984.1|1097807_1098179_-	protein YobA	NA	NA	NA	NA	NA
AWF30365.1|1098316_1098547_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
AWF32926.1|1098889_1099309_+	putative yobB	NA	NA	NA	NA	NA
AWF28861.1|1099333_1099996_+	exodeoxyribonuclease 10	NA	NA	NA	NA	NA
AWF29657.1|1099977_1102053_-	prolyl oligopeptidase, N-terminal beta-propeller domain protein	NA	NA	NA	NA	NA
AWF31404.1|1102128_1102779_-	inner membrane protein YebE	NA	NA	NA	NA	NA
AWF30712.1|1102950_1104129_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
1104167:1104195	attL	GGCCGGGTAAGGCGCAGCCGCCACCCGGC	NA	NA	NA	NA
AWF32660.1|1104203_1104845_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AWF31583.1|1104884_1106696_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AWF29558.1|1106929_1108405_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
AWF32865.1|1108465_1108630_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33039.1|1108761_1109631_+	SIS domain protein	NA	NA	NA	NA	NA
AWF32205.1|1109745_1111188_+	pyruvate kinase	NA	NA	NA	NA	NA
AWF32993.1|1111231_1112203_-	lipid A biosynthesis (KDO)2-(lauroyl)-lipid IVA acyltransferase	NA	NA	NA	NA	NA
AWF29029.1|1112320_1113577_-	opacity-associated A LysM-like domain protein	NA	A8ATH6	Listeria_phage	40.9	1.1e-14
AWF29952.1|1113655_1114600_-	ABC superfamily high affinity Zn transport protein	NA	NA	NA	NA	NA
AWF29397.1|1114677_1115433_+	zinc import ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	3.0e-15
AWF29008.1|1115429_1116215_+	high-affinity zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
AWF31761.1|1116267_1117278_-	holliday junction DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.4e-07
AWF30771.1|1117286_1117901_-	holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AWF32595.1|1117981_1118503_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AWF30251.1|1118537_1119278_-	DNA-binding regulatory, YebC/PmpR family protein	NA	NA	NA	NA	NA
AWF32117.1|1119305_1119749_-	dihydroneopterin triphosphate pyrophosphatase	NA	NA	NA	NA	NA
AWF32623.1|1119750_1121523_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AWF33018.1|1121785_1122352_+	isochorismatase family protein	NA	NA	NA	NA	NA
AWF31666.1|1122705_1122945_+	dinI-like family protein	NA	K7PKR6	Enterobacteria_phage	100.0	7.4e-37
AWF30920.1|1123030_1123441_-	hemerythrin HHE cation binding domain protein	NA	NA	NA	NA	NA
AWF33089.1|1123916_1124195_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29307.1|1124289_1125537_-|tail	putative tail fiber	tail	G8C7K5	Escherichia_phage	48.8	9.5e-91
AWF29086.1|1125601_1126570_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.2	4.2e-54
AWF31511.1|1126573_1129372_-	hypothetical protein	NA	S4TTF5	Salmonella_phage	73.4	0.0e+00
AWF29942.1|1129371_1129653_-	putative phage protein	NA	S4TR39	Salmonella_phage	79.6	5.5e-39
AWF32053.1|1129776_1130334_-	hypothetical protein	NA	S4TND4	Salmonella_phage	83.2	1.3e-87
AWF29889.1|1130360_1130954_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	82.7	1.3e-93
AWF32950.1|1131018_1131888_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31406.1|1132238_1134650_-|tail	phage tail tape measure protein, lambda family	tail	K7PM62	Enterobacteria_phage	51.4	2.3e-189
AWF31248.1|1134762_1135158_-	hypothetical protein	NA	NA	NA	NA	NA
AWF30127.1|1135274_1135451_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	60.3	8.0e-12
AWF33126.1|1135561_1135942_-	hypothetical protein	NA	K7PJU9	Enterobacteria_phage	78.2	4.8e-46
AWF30144.1|1135995_1136436_-	structural protein 3	NA	A0A286S1Q8	Klebsiella_phage	71.3	3.5e-56
AWF30715.1|1136485_1136854_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28775.1|1136904_1137444_-	hypothetical protein	NA	Q9MCV1	Escherichia_phage	84.9	1.9e-80
AWF29242.1|1137436_1137553_-|head,tail	putative head-tail adaptor	head,tail	K7PH08	Enterobacteria_phage	89.2	1.6e-13
AWF29842.1|1137770_1137983_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	66.7	1.6e-11
AWF30459.1|1138046_1138373_-|head,tail	phage gp6-like head-tail connector family protein	head,tail	K7PKT4	Enterobacteria_phage	87.0	2.8e-50
AWF31866.1|1138415_1139627_-|capsid	phage major capsid protein, HK97 family	capsid	K7PM57	Enterobacteria_phage	87.2	8.9e-195
AWF28955.1|1139636_1140485_-|protease	clp protease family protein	protease	K7PH05	Enterobacteria_phage	92.1	2.4e-138
AWF31035.1|1140498_1141803_-|portal	phage portal protein, HK97 family	portal	K7PJU5	Enterobacteria_phage	93.5	8.1e-234
AWF29805.1|1141802_1143539_-	phage Terminase family protein	NA	K7PKT2	Enterobacteria_phage	100.0	0.0e+00
AWF29598.1|1143538_1143859_-|terminase	phage terminase, small subunit, P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	5.8e-53
AWF32962.1|1144327_1144456_+	putative membrane protein	NA	NA	NA	NA	NA
AWF32637.1|1144523_1144646_-	hypothetical protein	NA	NA	NA	NA	NA
AWF29577.1|1145090_1146548_-	putative glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	90.7	1.1e-271
AWF28910.1|1146565_1146793_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32564.1|1146803_1147481_-	hypothetical protein	NA	G8C7Q4	Escherichia_phage	55.6	7.3e-37
AWF32104.1|1147622_1147868_-	hypothetical protein	NA	NA	NA	NA	NA
AWF30587.1|1148758_1149016_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	52.7	5.1e-15
AWF32194.1|1149082_1149217_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.7	2.0e-15
AWF32592.1|1149221_1149491_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	3.1e-31
AWF31449.1|1149498_1150128_-	chitinase class I family protein	NA	G8C7W0	Escherichia_phage	87.6	1.0e-101
AWF32580.1|1150395_1150782_-	putative membrane protein	NA	A0A192Y8P2	Salmonella_phage	95.3	3.3e-58
AWF28817.1|1150889_1151012_-	hypothetical protein	NA	A0A0A0YRI9	Escherichia_phage	81.1	4.1e-07
AWF30927.1|1151041_1151467_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	82.3	3.6e-58
AWF28932.1|1151740_1152523_-	antitermination family protein	NA	F1C595	Cronobacter_phage	77.9	3.0e-111
AWF33301.1|1152519_1153497_-	zinc-binding domain of primase-helicase family protein	NA	F1C597	Cronobacter_phage	87.7	2.3e-169
AWF33096.1|1153493_1155104_-	helicase domain protein	NA	F1C598	Cronobacter_phage	85.3	8.9e-275
AWF28773.1|1156208_1156853_+	helix-turn-helix family protein	NA	F1C5C2	Cronobacter_phage	67.1	4.3e-79
AWF28990.1|1157412_1157544_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31689.1|1157723_1157948_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29437.1|1157948_1158329_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	71.8	3.9e-40
AWF32005.1|1158306_1158549_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	68.1	2.2e-20
AWF32972.1|1158616_1158739_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	78.4	6.7e-10
AWF31477.1|1158735_1159242_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	56.0	1.4e-53
AWF33163.1|1159254_1160115_+	hypothetical protein	NA	F1C5A3	Cronobacter_phage	80.2	3.4e-132
AWF30401.1|1160116_1160539_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31333.1|1160531_1160777_+	hypothetical protein	NA	Q8W657	Enterobacteria_phage	86.8	1.9e-35
AWF31305.1|1160832_1162146_+|integrase	phage integrase family protein	integrase	Q8W658	Enterobacteria_phage	86.9	2.6e-224
AWF29092.1|1162172_1162898_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.1e-58
AWF32211.1|1162949_1163345_+	inner membrane protein YecN	NA	NA	NA	NA	NA
AWF33178.1|1163385_1164129_+|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
1165104:1165132	attR	GCCGGGTGGCGGCTGCGCCTTACCCGGCC	NA	NA	NA	NA
>prophage 4
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	1325934	1333679	4891057		Bodo_saltans_virus(16.67%)	8	NA	NA
AWF30815.1|1325934_1326546_+	phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
AWF31983.1|1326584_1327565_-	chain length determinant protein	NA	NA	NA	NA	NA
AWF30152.1|1327756_1328761_+	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	A0A2K9L0I7	Tupanvirus	29.0	1.1e-33
AWF29344.1|1328809_1329976_-	nucleotide sugar dehydrogenase family protein	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
AWF31241.1|1330215_1331034_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.8	7.8e-94
AWF30940.1|1331097_1331991_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	55.9	2.3e-86
AWF29648.1|1332015_1332174_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28898.1|1332272_1333679_-	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.8e-37
>prophage 5
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	1823817	1841458	4891057	integrase,tail	Enterobacteria_phage(35.29%)	22	1832312:1832326	1849339:1849353
AWF29385.1|1823817_1824435_+	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	71.9	6.0e-62
AWF30979.1|1824400_1824979_-|tail	putative tail fiber	tail	K7PM99	Enterobacterial_phage	75.8	1.5e-51
AWF31515.1|1825042_1825537_-	host specificity J domain protein	NA	Q9MCR7	Enterobacteria_phage	94.3	1.6e-17
AWF33093.1|1826123_1826405_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32657.1|1827034_1827754_-	nlpC/P60 family protein	NA	K7PLS6	Enterobacteria_phage	97.0	4.0e-142
AWF30647.1|1828245_1828368_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32554.1|1829571_1829841_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	1.5e-30
AWF32434.1|1829848_1830478_-	chitinase class I family protein	NA	G8C7W0	Escherichia_phage	87.6	5.1e-101
AWF30605.1|1830477_1830693_-	hypothetical protein	NA	K7PKN9	Enterobacterial_phage	46.5	1.5e-12
AWF31714.1|1830745_1830982_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	84.2	1.4e-27
AWF29898.1|1831310_1832282_-	P63C domain protein	NA	A9YX09	Burkholderia_phage	47.6	2.2e-71
1832312:1832326	attL	GCATAATAAACAGCG	NA	NA	NA	NA
AWF31319.1|1832923_1833166_-	antitermination family protein	NA	M9NZB0	Enterobacteria_phage	69.6	3.0e-25
AWF32080.1|1833734_1834835_+	putative exonuclease VIII	NA	K7PJT5	Enterobacteria_phage	83.7	7.5e-140
AWF32000.1|1834844_1835930_+	recT family protein	NA	K7PKR8	Enterobacteria_phage	53.5	1.5e-105
AWF29220.1|1835964_1836576_+	putative upf86.8	NA	A0A077SLQ8	Escherichia_phage	50.5	6.1e-43
AWF31966.1|1836556_1836805_+	hypothetical protein	NA	K7PHF4	Enterobacteria_phage	93.6	8.0e-34
AWF29910.1|1836992_1837136_+	putative excisionase-like protein	NA	H6WRW8	Salmonella_phage	95.7	5.4e-19
AWF30990.1|1837113_1838343_-|integrase	phage integrase family protein	integrase	H6WRW7	Salmonella_phage	98.3	1.9e-240
AWF29231.1|1838774_1839137_-	sigma-E factor regulatory protein RseC	NA	NA	NA	NA	NA
AWF29860.1|1839247_1840171_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AWF31921.1|1840200_1840851_-	anti sigma-E RseA, N-terminal domain protein	NA	NA	NA	NA	NA
AWF33031.1|1840882_1841458_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
1849339:1849353	attR	CGCTGTTTATTATGC	NA	NA	NA	NA
>prophage 6
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	1888699	1898390	4891057	capsid,integrase	Enterobacteria_phage(83.33%)	13	1888627:1888650	1899331:1899354
1888627:1888650	attL	AATTGGTACACGTTTAGGTACACG	NA	NA	NA	NA
AWF29591.1|1888699_1889941_+|integrase	prophage CP4-57 integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	4.2e-107
AWF32135.1|1890022_1891285_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29321.1|1891287_1892328_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32470.1|1892443_1892587_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31024.1|1892592_1893156_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	66.3	3.5e-61
AWF29245.1|1893184_1893403_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	62.1	1.9e-15
AWF32613.1|1893405_1894149_-|capsid	putative phage capsid protein	capsid	NA	NA	NA	NA
AWF33252.1|1894178_1894367_+	hypothetical protein	NA	NA	NA	NA	NA
AWF30150.1|1894734_1894953_+	helix-turn-helix domain protein	NA	Q7M299	Enterobacteria_phage	72.2	1.5e-23
AWF31339.1|1895168_1895501_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	3.2e-30
AWF31109.1|1895497_1895725_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31867.1|1895721_1896042_+	putative p4 phage protein	NA	NA	NA	NA	NA
AWF29155.1|1896056_1898390_+	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.2	0.0e+00
1899331:1899354	attR	AATTGGTACACGTTTAGGTACACG	NA	NA	NA	NA
>prophage 7
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	2283107	2306628	4891057	transposase	uncultured_Caudovirales_phage(38.46%)	27	NA	NA
AWF31357.1|2283107_2284031_-|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	97.4	1.5e-173
AWF30721.1|2284229_2285555_+	pyridine nucleotide-disulfide oxidoreductase family protein	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	6.5e-114
AWF32243.1|2285780_2286008_+	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	97.3	5.4e-37
AWF30480.1|2286161_2286428_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	97.7	5.9e-43
AWF28763.1|2286867_2287320_+	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWF29830.1|2287316_2288270_+	fecR family protein	NA	NA	NA	NA	NA
AWF29164.1|2288356_2290681_+	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AWF32122.1|2290725_2291628_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF29249.1|2291624_2292623_+	ABC 3 transport family protein	NA	NA	NA	NA	NA
AWF30427.1|2292619_2293576_+	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
AWF31097.1|2293576_2294344_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AWF31900.1|2294442_2294736_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AWF31884.1|2294783_2294903_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31815.1|2295066_2295345_-	EAL domain protein	NA	NA	NA	NA	NA
AWF28860.1|2295618_2296641_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF31031.1|2296821_2297247_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
AWF29671.1|2297259_2298549_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
AWF32186.1|2298593_2298770_-	putative arsenical resistance operon repressor	NA	A0A2H4J145	uncultured_Caudovirales_phage	37.9	8.5e-06
AWF30410.1|2298999_2299698_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
AWF33313.1|2299826_2300132_-	transcriptional regulator PadR-like family protein	NA	NA	NA	NA	NA
AWF30840.1|2300142_2301348_-	chromate transporter, chromate ion transporter family protein	NA	NA	NA	NA	NA
AWF29265.1|2301523_2301925_-	putative DNA-invertase from lambdoid prophage Rac	NA	A0A286S1P7	Klebsiella_phage	34.6	1.1e-13
AWF29411.1|2301982_2302099_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29552.1|2302239_2302362_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31502.1|2302506_2304048_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	46.7	9.5e-125
AWF30178.1|2304266_2305271_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF31139.1|2305605_2306628_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	3634654	3649878	4891057	transposase	Shigella_phage(50.0%)	14	NA	NA
AWF31124.1|3634654_3635659_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF31276.1|3635993_3637016_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF29967.1|3637608_3638691_+	periplasmic binding and sugar binding domain of LacI family protein	NA	C6ZCU4	Enterobacteria_phage	97.5	5.5e-188
AWF32275.1|3638804_3641858_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.2	0.0e+00
AWF30665.1|3641909_3643163_+	lactose permease	NA	NA	NA	NA	NA
AWF29639.1|3643219_3643390_+	maltose acetyltransferase family protein	NA	NA	NA	NA	NA
AWF30644.1|3643383_3643650_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.9	3.5e-43
AWF28753.1|3643657_3643885_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	4.6e-36
AWF33213.1|3644267_3644528_-	hypothetical protein	NA	NA	NA	NA	NA
AWF31517.1|3644584_3646648_-	tonB-dependent copper receptor	NA	NA	NA	NA	NA
AWF31763.1|3646730_3647051_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32704.1|3647268_3647382_-	hypothetical protein	NA	NA	NA	NA	NA
AWF28866.1|3647516_3648539_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF31277.1|3648873_3649878_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 9
CP029126	Enterobacter hormaechei strain AR432 chromosome, complete genome	4891057	3653974	3678374	4891057	transposase,integrase	Shigella_phage(33.33%)	25	3656547:3656560	3679993:3680006
AWF33013.1|3653974_3654874_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
AWF29508.1|3654977_3655130_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32372.1|3655383_3655590_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32998.1|3655883_3656966_+	periplasmic binding and sugar binding domain of LacI family protein	NA	C6ZCU4	Enterobacteria_phage	96.4	4.0e-186
3656547:3656560	attL	GCCATGTCCGGTTT	NA	NA	NA	NA
AWF29335.1|3657093_3660159_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AWF33260.1|3660210_3661464_+	lactose permease	NA	NA	NA	NA	NA
AWF31372.1|3661520_3661691_+	maltose acetyltransferase family protein	NA	NA	NA	NA	NA
AWF32320.1|3661684_3661951_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.9	3.5e-43
AWF30223.1|3661958_3662186_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	4.6e-36
AWF30617.1|3662458_3662683_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.6	5.5e-34
AWF33140.1|3662664_3662865_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	86.4	5.3e-28
AWF30835.1|3662891_3663119_-	insA N-terminal domain protein	NA	Q71TE9	Escherichia_phage	94.7	2.1e-36
AWF31622.1|3663195_3663504_-	hypothetical protein	NA	NA	NA	NA	NA
AWF32346.1|3663901_3664270_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28851.1|3664715_3665081_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33212.1|3665165_3665813_+	hypothetical protein	NA	NA	NA	NA	NA
AWF32713.1|3665888_3666491_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31930.1|3666558_3666906_+	hypothetical protein	NA	NA	NA	NA	NA
AWF29115.1|3666987_3667974_+	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	3.8e-50
AWF30455.1|3668079_3669012_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31828.1|3669350_3671909_+	ATPase associated with various cellular activities family protein	NA	NA	NA	NA	NA
AWF30047.1|3671920_3673777_+	hypothetical protein	NA	NA	NA	NA	NA
AWF31146.1|3674087_3675596_+	description family protein	NA	A0A075DXT4	Acinetobacter_phage	31.5	8.3e-49
AWF29075.1|3675662_3677282_+	integrating conjugative element relaxase, PFGI-1 class	NA	NA	NA	NA	NA
AWF32144.1|3677342_3678374_+|integrase	phage integrase, N-terminal SAM-like domain protein	integrase	NA	NA	NA	NA
3679993:3680006	attR	GCCATGTCCGGTTT	NA	NA	NA	NA
