The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	388074	406514	5925399	tail	Klebsiella_phage(28.57%)	21	NA	NA
AWF34434.1|388074_391446_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	48.0	4.0e-136
AWF34023.1|391660_395203_-|tail	phage tail family protein	tail	Q6UAW1	Klebsiella_phage	64.0	0.0e+00
AWF34082.1|395212_395668_-	putative gp20	NA	K7P6V1	Enterobacteria_phage	63.6	4.1e-44
AWF38672.1|395692_395878_+	hypothetical protein	NA	NA	NA	NA	NA
AWF36503.1|395942_396656_-	nlpC/P60 family protein	NA	Q6UAW4	Klebsiella_phage	70.3	6.6e-105
AWF35821.1|396667_397420_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	67.1	2.0e-99
AWF35547.1|397416_397764_-|tail	phage minor tail family protein	tail	K7PJT2	Enterobacteria_phage	61.7	1.0e-34
AWF36741.1|397768_398005_-	hypothetical protein	NA	K7P7A9	Enterobacteria_phage	41.8	5.7e-05
AWF35581.1|399532_399991_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	51.1	7.9e-35
AWF38790.1|400134_400308_-	hypothetical protein	NA	A0A2I7R8F9	Vibrio_phage	71.8	2.8e-09
AWF38499.1|400757_400871_+	hypothetical protein	NA	NA	NA	NA	NA
AWF38747.1|401754_402018_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	69.0	9.1e-28
AWF35176.1|402180_402306_-	hypothetical protein	NA	NA	NA	NA	NA
AWF38295.1|402338_403127_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	5.6e-65
AWF34393.1|403119_403335_-	hypothetical protein	NA	NA	NA	NA	NA
AWF37293.1|403331_403934_-	hypothetical protein	NA	NA	NA	NA	NA
AWF36449.1|404020_404719_-	hypothetical protein	NA	S5FM81	Shigella_phage	41.8	1.7e-28
AWF34548.1|404821_404935_+	hypothetical protein	NA	NA	NA	NA	NA
AWF37162.1|405006_405123_-	hypothetical protein	NA	NA	NA	NA	NA
AWF35589.1|405275_405689_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	70.5	3.7e-44
AWF38268.1|406118_406514_+	helix-turn-helix family protein	NA	Q7Y5W5	Haemophilus_phage	47.9	5.8e-10
>prophage 2
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	435297	440852	5925399		Escherichia_phage(33.33%)	9	NA	NA
AWF36909.1|435297_436287_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
AWF33964.1|436412_436853_+	heat shock protein HslJ	NA	NA	NA	NA	NA
AWF36800.1|436849_437122_-	hypothetical protein	NA	NA	NA	NA	NA
AWF37431.1|437449_437815_-	hypothetical protein	NA	NA	NA	NA	NA
AWF36516.1|438045_438588_-	putative Peptidoglycan domain protein	NA	A0A0U2I1S0	Escherichia_phage	64.0	2.4e-67
AWF38182.1|438595_438868_-	hypothetical protein	NA	A0A0U2SHD1	Escherichia_phage	40.9	4.0e-10
AWF33895.1|438857_439250_-	putative membrane protein	NA	K7PHB9	Enterobacterial_phage	53.7	2.2e-25
AWF34617.1|439326_439515_-	putative n-like protein	NA	A0A0P0ZBT9	Stx2-converting_phage	47.5	8.0e-10
AWF34998.1|440150_440852_-	peptidase S24-like family protein	NA	K7PKK1	Enterobacteria_phage	40.0	5.1e-33
>prophage 3
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	1049169	1071394	5925399		Salmonella_phage(33.33%)	25	NA	NA
AWF37618.1|1049169_1049928_+	deoxyribose operon repressor	NA	A0A077SK06	Escherichia_phage	27.2	1.6e-11
AWF34905.1|1049958_1051161_-	D-alanyl-D-alanine carboxypeptidase DacC	NA	B6DZZ7	Stx2-converting_phage	48.2	4.2e-96
AWF34253.1|1051947_1052724_-	hypothetical protein	NA	NA	NA	NA	NA
AWF34662.1|1052726_1054571_-	GDSL-like Lipase/Acylhydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	55.0	2.7e-25
AWF34067.1|1054586_1055528_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	62.4	2.3e-20
AWF34344.1|1055527_1056301_-	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.1	2.7e-67
AWF37308.1|1056297_1057491_-	putative bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	74.7	8.6e-158
AWF37082.1|1057496_1057850_-	putative bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	77.8	5.6e-49
AWF38472.1|1057851_1058871_-	hypothetical protein	NA	A0A2H4JCJ1	uncultured_Caudovirales_phage	76.9	2.3e-71
AWF37323.1|1058888_1059383_-	putative bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.1	6.1e-49
AWF36118.1|1059394_1060594_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	55.3	2.2e-105
AWF33537.1|1060592_1060727_+	hypothetical protein	NA	NA	NA	NA	NA
AWF35996.1|1060855_1061389_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	54.6	9.4e-48
AWF38897.1|1061459_1062911_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.1	1.2e-190
AWF37751.1|1063350_1064445_-	hypothetical protein	NA	A0A077KAW0	Edwardsiella_phage	66.7	2.5e-140
AWF33667.1|1064781_1065051_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.3	3.2e-12
AWF35880.1|1065058_1065685_-	chitinase class I family protein	NA	F1C591	Cronobacter_phage	76.3	2.2e-88
AWF34044.1|1065700_1066390_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.3	2.3e-46
AWF33697.1|1066382_1066595_-	hypothetical protein	NA	NA	NA	NA	NA
AWF37291.1|1066591_1066885_-	faeA-like family protein	NA	NA	NA	NA	NA
AWF37861.1|1066897_1067974_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	43.2	4.3e-31
AWF34012.1|1067970_1068087_-	hypothetical protein	NA	NA	NA	NA	NA
AWF36044.1|1068238_1068664_-	hypothetical protein	NA	NA	NA	NA	NA
AWF35708.1|1069891_1070185_+	bacteriophage lambda Kil family protein	NA	NA	NA	NA	NA
AWF35065.1|1070707_1071394_+	putative upf86.8	NA	M1F3E2	Salmonella_phage	61.2	1.5e-69
>prophage 4
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	4515799	4582338	5925399	tRNA,lysis,integrase,capsid,terminase,head,plate,portal,tail	Erwinia_phage(31.91%)	73	4516940:4516968	4548622:4548650
AWF36594.1|4515799_4516567_+|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AWF34802.1|4516606_4516954_+	ribosomal protein L19	NA	NA	NA	NA	NA
4516940:4516968	attL	GAGCGTCTTAACTAAGATTCGCTTTCGCG	NA	NA	NA	NA
AWF38943.1|4517042_4517183_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33492.1|4517393_4518563_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	97.7	4.6e-204
AWF38492.1|4518559_4519045_-	phage P2 GpU family protein	NA	S4TUC3	Salmonella_phage	95.0	1.5e-81
AWF33639.1|4519056_4521498_-|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A0M3UL85	Salmonella_phage	89.1	0.0e+00
AWF37681.1|4521490_4521610_-	phage P2 GpE family protein	NA	O80316	Escherichia_phage	100.0	1.4e-15
AWF36538.1|4521642_4521978_-	mu-like prophage FluMu gp41 family protein	NA	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
AWF36942.1|4522041_4522560_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	5.0e-94
AWF33737.1|4522575_4523754_-|tail	phage tail sheath family protein	tail	Q37844	Escherichia_phage	95.7	1.4e-213
AWF37289.1|4523864_4524815_-|tail	phage tail-collar fiber family protein	tail	A0A248SL44	Klebsiella_phage	33.0	4.6e-21
AWF35278.1|4524953_4525715_-	hypothetical protein	NA	NA	NA	NA	NA
AWF37215.1|4525716_4527402_-	GDSL-like Lipase/Acylhydrolase family protein	NA	NA	NA	NA	NA
AWF39037.1|4527404_4527974_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	51.3	1.1e-49
AWF34985.1|4527999_4528908_-|plate	baseplate J-like family protein	plate	F1BUP3	Erwinia_phage	70.9	1.1e-112
AWF36245.1|4528912_4529260_-	lysozyme family protein	NA	Q7Y4D7	Escherichia_virus	74.8	5.4e-44
AWF38301.1|4529256_4529898_-|plate	baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	85.9	4.4e-100
AWF35341.1|4529966_4530416_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.0	1.5e-70
AWF35607.1|4530408_4530876_-|tail	P2 phage tail completion R family protein	tail	O80312	Escherichia_phage	97.4	5.1e-82
AWF36396.1|4530838_4531012_-	putative protein lysB	NA	Q6K1H9	Salmonella_virus	96.5	2.3e-24
AWF37744.1|4530983_4531391_-|lysis	phage lysis regulatory, LysB family protein	lysis	A0A218M4K2	Erwinia_phage	60.4	4.1e-35
AWF36535.1|4531393_4531825_-	putative protein lysA	NA	A0A218M4L6	Erwinia_phage	81.8	1.6e-61
AWF38125.1|4531821_4532298_-	phage lysozyme family protein	NA	A0A218M4K3	Erwinia_phage	96.8	1.1e-84
AWF35507.1|4532317_4532539_-	putative membrane protein	NA	A0A218M4L5	Erwinia_phage	97.3	3.2e-34
AWF36335.1|4532529_4532718_-	phage Tail Protein X family protein	NA	A0A218M4L8	Erwinia_phage	95.2	7.2e-27
AWF36405.1|4532732_4533242_-|head	phage head completion family protein	head	A0A218M4L7	Erwinia_phage	98.8	2.5e-90
AWF37140.1|4533335_4534058_-|terminase	phage small terminase subunit	terminase	S4TRV8	Salmonella_phage	92.1	5.4e-115
AWF36023.1|4534089_4535157_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	96.6	9.6e-193
AWF34460.1|4535232_4536087_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A218M4L9	Erwinia_phage	83.5	1.4e-130
AWF33832.1|4536252_4538022_+|terminase	ATPase subunit of terminase family protein	terminase	A0A218M4M1	Erwinia_phage	99.2	0.0e+00
AWF35325.1|4538021_4538768_+|terminase	terminase-like family protein	terminase	O80303	Escherichia_phage	94.8	8.1e-138
AWF36694.1|4538764_4539787_+|portal	phage portal protein, PBSX family	portal	A0A2I8TV74	Erwinia_phage	99.1	4.7e-197
AWF37997.1|4540264_4540498_-	dinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	98.7	8.0e-36
AWF36336.1|4540501_4540684_-	putative tumA	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
AWF36352.1|4540803_4542873_-	bacteriophage replication protein A	NA	A0A218M4H2	Erwinia_phage	92.3	0.0e+00
AWF33933.1|4543294_4543567_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	73.3	6.3e-32
AWF34792.1|4543563_4544145_-	exonuclease family protein	NA	A0A1S6L012	Salmonella_phage	78.2	6.8e-84
AWF33591.1|4544141_4544369_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A0M4S5Q7	Salmonella_phage	80.6	5.6e-26
AWF36265.1|4544368_4544596_-	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	97.3	2.2e-30
AWF35863.1|4544663_4545002_-	putative prophage protein	NA	A0A218M4I7	Erwinia_phage	93.8	2.1e-53
AWF33486.1|4544965_4545166_-	hypothetical protein	NA	Q6K1F7	Salmonella_virus	100.0	1.2e-32
AWF35793.1|4545173_4545683_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
AWF39040.1|4545715_4546087_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	99.2	1.4e-61
AWF37719.1|4547056_4547461_+	putative exported protein	NA	NA	NA	NA	NA
AWF38544.1|4547490_4548540_+|integrase	phage integrase family protein	integrase	A0A0M4S6G4	Salmonella_phage	90.3	1.8e-188
AWF38152.1|4548756_4549194_+	hypothetical protein	NA	NA	NA	NA	NA
4548622:4548650	attR	GAGCGTCTTAACTAAGATTCGCTTTCGCG	NA	NA	NA	NA
AWF35750.1|4549247_4550618_+	pepSY-associated TM helix family protein	NA	NA	NA	NA	NA
AWF36244.1|4550622_4551105_-	ompA family protein	NA	NA	NA	NA	NA
AWF33772.1|4551116_4552256_-	putative diguanylate cyclase YfiN	NA	NA	NA	NA	NA
AWF35061.1|4552332_4552734_-	hypothetical protein	NA	NA	NA	NA	NA
AWF37346.1|4552841_4553015_-	hypothetical protein	NA	NA	NA	NA	NA
AWF36032.1|4553185_4554256_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	8.1e-91
AWF38055.1|4554265_4555387_+	T-protein	NA	NA	NA	NA	NA
AWF33741.1|4555456_4556329_+	SMP-30/Gluconolaconase/LRE-like region family protein	NA	NA	NA	NA	NA
AWF35281.1|4556325_4557486_-	P-protein	NA	NA	NA	NA	NA
AWF38425.1|4557747_4558083_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AWF36298.1|4558354_4559014_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWF34923.1|4559302_4560205_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AWF38061.1|4560360_4560933_+	multi-copper polyphenol oxidoreductase laccase family protein	NA	NA	NA	NA	NA
AWF35034.1|4561060_4563634_+	ATP-dependent chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	1.8e-128
AWF36828.1|4569249_4569363_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33900.1|4569568_4570024_+	hypothetical protein	NA	E3SMI8	Prochlorococcus_phage	46.7	3.3e-33
AWF37334.1|4570297_4571596_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	30.5	1.2e-43
AWF33524.1|4571598_4571871_-	hypothetical protein	NA	NA	NA	NA	NA
AWF38172.1|4571965_4573321_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWF36415.1|4573414_4576093_-	succinyl-CoA ligase like flavodoxin domain protein	NA	NA	NA	NA	NA
AWF38209.1|4576128_4576827_-	DTW domain protein	NA	NA	NA	NA	NA
AWF34258.1|4576896_4577322_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.0	1.6e-13
AWF34760.1|4577525_4578599_+	RNA 2'-O ribose methyltransferase substrate binding family protein	NA	NA	NA	NA	NA
AWF37459.1|4578704_4579394_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.7e-55
AWF37953.1|4579705_4580089_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
AWF37781.1|4580134_4581466_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
AWF37365.1|4581597_4582338_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 5
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5120033	5133706	5925399		Enterobacteria_phage(20.0%)	13	NA	NA
AWF34764.1|5120033_5120951_+	capsular polysaccharide synthesis family protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	36.2	7.1e-27
AWF33540.1|5120985_5121945_+	acyltransferase family protein	NA	NA	NA	NA	NA
AWF35105.1|5122250_5123657_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	7.3e-39
AWF37260.1|5123869_5125285_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.5	5.6e-55
AWF38640.1|5125307_5126678_+	phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III family protein	NA	A0A127AWJ1	Bacillus_phage	26.4	7.1e-31
AWF38569.1|5126772_5127837_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.9e-104
AWF36115.1|5127848_5128718_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.3	1.5e-103
AWF36677.1|5128749_5129640_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	6.9e-27
AWF36992.1|5129654_5130209_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	1.6e-50
AWF34759.1|5130382_5131549_+	nucleotide sugar dehydrogenase family protein	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	7.0e-112
AWF37084.1|5131928_5132093_+	hypothetical protein	NA	NA	NA	NA	NA
AWF35676.1|5132111_5132234_-	putative membrane protein	NA	NA	NA	NA	NA
AWF38589.1|5132701_5133706_-	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	6.8e-31
>prophage 6
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5299846	5321160	5925399	tail,integrase,lysis	Pectobacterium_phage(31.25%)	20	5299659:5299718	5321414:5321481
5299659:5299718	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGG	NA	NA	NA	NA
AWF36702.1|5299846_5300863_-|integrase	phage integrase family protein	integrase	H9C152	Pectobacterium_phage	64.5	2.8e-125
AWF36982.1|5300846_5301092_-	hypothetical protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
AWF37172.1|5301301_5301487_-	hypothetical protein	NA	NA	NA	NA	NA
AWF36482.1|5301488_5302055_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	7.9e-53
AWF34192.1|5302054_5304208_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	6.9e-97
AWF37453.1|5304285_5304456_+	hypothetical protein	NA	NA	NA	NA	NA
AWF38363.1|5305789_5306236_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
AWF37664.1|5306319_5306478_+	hypothetical protein	NA	NA	NA	NA	NA
AWF37738.1|5306480_5307473_+	putative replication protein	NA	A0A067ZIA1	Vibrio_phage	52.3	9.1e-28
AWF35036.1|5307469_5308393_+	acetyltransferase family protein	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	40.7	2.5e-16
AWF37645.1|5308455_5308884_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	47.0	1.3e-10
AWF35809.1|5308889_5311604_+	putative lytic transglycosylase	NA	G9L6D3	Escherichia_phage	58.5	1.8e-288
AWF37028.1|5311678_5314498_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	72.3	0.0e+00
AWF35549.1|5315065_5315407_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	2.0e-19
AWF36533.1|5315403_5317014_+	hypothetical protein	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.8	1.2e-226
AWF36688.1|5317031_5319683_+|tail	phage T7 tail fiber family protein	tail	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	40.9	1.5e-45
AWF36501.1|5319691_5319970_+	hypothetical protein	NA	NA	NA	NA	NA
AWF37659.1|5320059_5320284_+|lysis	lysis S family protein	lysis	A0A0P0ZFW5	Escherichia_phage	70.1	1.6e-20
AWF35349.1|5320267_5320804_+	phage lysozyme family protein	NA	K7PM52	Enterobacteria_phage	78.0	6.1e-79
AWF36123.1|5320800_5321160_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	44.0	1.3e-16
5321414:5321481	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATTGGGATAAAGC	NA	NA	NA	NA
>prophage 7
CP029128	Klebsiella oxytoca strain AR380 chromosome, complete genome	5925399	5341969	5384012	5925399	tRNA,lysis,integrase,terminase	Escherichia_phage(43.24%)	53	5344611:5344625	5365633:5365647
AWF35755.1|5341969_5343703_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.3e-85
AWF38692.1|5343932_5344502_+	protein YecM	NA	NA	NA	NA	NA
AWF38774.1|5344578_5345322_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
5344611:5344625	attL	GGAGTGCGCGCTGGA	NA	NA	NA	NA
AWF36683.1|5345620_5346643_-|tRNA	tRNA (mo5U34)-methyltransferase	tRNA	NA	NA	NA	NA
AWF38632.1|5346639_5347383_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	29.1	1.5e-22
AWF36185.1|5347422_5347818_-	inner membrane protein YecN	NA	NA	NA	NA	NA
AWF34464.1|5347871_5348597_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	83.5	1.9e-59
AWF35989.1|5348647_5349907_-|integrase	phage integrase family protein	integrase	A0A286S1S8	Klebsiella_phage	89.7	4.3e-224
AWF33424.1|5349949_5350141_-	hypothetical protein	NA	A0A286S2A4	Klebsiella_phage	91.4	5.2e-25
AWF37023.1|5350354_5350570_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	A0A0N7C211	Escherichia_phage	50.0	5.2e-13
AWF33620.1|5350786_5352811_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	46.1	3.8e-113
AWF34751.1|5352962_5353643_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.9	1.8e-123
AWF38873.1|5353639_5354470_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.8	2.9e-67
AWF34299.1|5354500_5354785_-	hypothetical protein	NA	G8C7T1	Escherichia_phage	77.7	4.7e-38
AWF38808.1|5354792_5355764_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.7	5.6e-38
AWF36453.1|5355852_5356011_-	hypothetical protein	NA	NA	NA	NA	NA
AWF34310.1|5356039_5356228_-	hypothetical protein	NA	NA	NA	NA	NA
AWF35336.1|5356226_5356364_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33980.1|5357921_5358068_+	hypothetical protein	NA	NA	NA	NA	NA
AWF35984.1|5358060_5358960_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	54.5	9.2e-88
AWF34603.1|5358949_5360380_+	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	67.2	4.0e-186
AWF35978.1|5360379_5360682_+	hypothetical protein	NA	NA	NA	NA	NA
AWF35181.1|5360678_5361104_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	65.9	1.3e-20
AWF33932.1|5361943_5362435_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	70.7	1.9e-26
AWF36988.1|5362434_5362950_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	73.3	2.9e-70
AWF35388.1|5362946_5363645_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	57.1	8.4e-12
AWF35526.1|5364358_5364616_+	hot	NA	G8C7V1	Escherichia_phage	71.4	6.0e-24
AWF36008.1|5364806_5365256_+	protein ninB	NA	Q8VNP6	Enterobacteria_phage	52.4	9.7e-38
AWF33848.1|5365272_5365419_+	putative NinE-like protein from lambdoid prophage DLP12	NA	G8C7V4	Escherichia_phage	76.6	3.5e-13
AWF35621.1|5365411_5365702_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.2e-44
5365633:5365647	attR	GGAGTGCGCGCTGGA	NA	NA	NA	NA
AWF33828.1|5365698_5366061_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	83.1	5.6e-52
AWF34853.1|5366057_5366198_+	hypothetical protein	NA	NA	NA	NA	NA
AWF37048.1|5366194_5366695_+	hypothetical protein	NA	G8C7V7	Escherichia_phage	92.7	6.7e-88
AWF35583.1|5367194_5367338_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	88.4	7.9e-18
AWF34765.1|5367315_5367813_+	lysozyme RrrD	NA	A0A1V0E5Q7	Salmonella_phage	86.1	3.9e-80
AWF35417.1|5367809_5368271_+|lysis	bacteriophage lysis family protein	lysis	M9NYX9	Enterobacteria_phage	64.7	1.0e-45
AWF38855.1|5368509_5368635_+	putative membrane protein	NA	NA	NA	NA	NA
AWF36090.1|5368721_5369462_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.9	1.9e-14
AWF36932.1|5369465_5370797_+|terminase	terminase-like family protein	terminase	A0A0U2JTW9	Escherichia_phage	59.7	3.5e-152
AWF34387.1|5370808_5372227_+	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	36.5	3.6e-86
AWF34665.1|5372223_5373045_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	40.8	2.0e-52
AWF35200.1|5373081_5374671_+	hypothetical protein	NA	NA	NA	NA	NA
AWF36980.1|5374686_5375547_+	hypothetical protein	NA	NA	NA	NA	NA
AWF36522.1|5375560_5376592_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.3e-73
AWF35869.1|5376663_5377146_+	hypothetical protein	NA	NA	NA	NA	NA
AWF35941.1|5377142_5377571_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	1.4e-22
AWF33574.1|5377567_5378002_+	hypothetical protein	NA	NA	NA	NA	NA
AWF36842.1|5377985_5378924_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	8.5e-52
AWF36179.1|5378928_5380323_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	35.5	2.5e-68
AWF38011.1|5380326_5380764_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	6.4e-26
AWF38872.1|5380767_5381340_+	hypothetical protein	NA	NA	NA	NA	NA
AWF37106.1|5381463_5383284_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	38.2	3.7e-19
AWF37857.1|5383286_5384012_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.5	7.1e-30
>prophage 1
CP029127	Klebsiella oxytoca strain AR380 plasmid unnamed1, complete sequence	78352	87	55747	78352	integrase,transposase	Macacine_betaherpesvirus(15.0%)	58	8585:8600	56989:57004
AWF33362.1|87_300_-|transposase	transposase family protein	transposase	U5P429	Shigella_phage	54.5	3.9e-05
AWF33373.1|554_839_-|transposase	transposase family protein	transposase	U5P4I9	Shigella_phage	43.7	2.0e-12
AWF33337.1|1027_1996_+|transposase	transposase family protein	transposase	Q75QL1	Wolbachia_phage	33.8	7.5e-27
AWF33390.1|2717_3752_+	biotin synthase	NA	NA	NA	NA	NA
AWF33358.1|4164_4440_+	homeo-like domain protein	NA	NA	NA	NA	NA
AWF33378.1|4482_4749_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF33368.1|4844_5594_+	HTH-like domain protein	NA	S5WIU1	Leptospira_phage	40.3	1.5e-46
AWF33376.1|5953_6139_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33380.1|6819_7005_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33393.1|7113_7881_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.1	9.2e-28
AWF33370.1|8532_9285_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	86.6	3.1e-121
8585:8600	attL	TTCCGGCCTTTCTTCT	NA	NA	NA	NA
AWF33328.1|9853_10036_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33345.1|10008_10428_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF33400.1|10515_10746_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33397.1|11318_12452_+	chaperone of endosialidase family protein	NA	A0A1Z1LZI1	Serratia_phage	26.7	9.7e-18
AWF33354.1|12532_14650_+	colicin-D	NA	NA	NA	NA	NA
AWF33402.1|14796_14913_+	bacterial self-protective colicin-like immunity family protein	NA	NA	NA	NA	NA
AWF33360.1|15629_15773_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33401.1|15832_16441_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33344.1|16562_17288_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.3	1.5e-51
AWF33327.1|17432_18302_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	56.2	3.0e-67
AWF33336.1|18418_18553_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33349.1|19771_19963_-	putative lexA DNA-binding domain protein	NA	A0A222YXS3	Escherichia_phage	45.0	6.4e-07
AWF33374.1|20629_21901_-	hypothetical protein	NA	F1C5A5	Cronobacter_phage	64.0	9.2e-158
AWF33391.1|21900_22290_-	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	55.1	5.8e-31
AWF33366.1|22288_22432_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33346.1|22620_22764_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33399.1|23272_24562_+	DNA methylase family protein	NA	A0A2K9VH43	Faecalibacterium_phage	35.0	1.5e-19
AWF33363.1|24590_24839_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AWF33364.1|25186_25357_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33352.1|25517_26141_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33389.1|26146_26797_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33387.1|26793_27102_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33383.1|27199_27757_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	33.8	5.3e-17
AWF33388.1|27956_28610_-	FCD domain protein	NA	NA	NA	NA	NA
AWF33372.1|28756_30043_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWF33329.1|30098_30866_-	putative hexonate dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	27.6	6.4e-21
AWF33342.1|31203_32457_+	putative dehydratase	NA	Q6A202	Oenococcus_phage	29.7	3.9e-44
AWF33394.1|32554_33196_-	resolvase, N terminal domain protein	NA	NA	NA	NA	NA
AWF33343.1|33363_36351_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	53.2	2.1e-293
AWF33341.1|36856_37030_+	hypothetical protein	NA	NA	NA	NA	NA
AWF33379.1|37046_38210_+	ycaO-like family protein	NA	NA	NA	NA	NA
AWF33381.1|38219_38945_+	putative membrane protein	NA	NA	NA	NA	NA
AWF33367.1|38941_39670_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	2.4e-09
AWF33405.1|40575_41580_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF33353.1|42495_43359_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWF33404.1|44579_45296_+	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWF33335.1|45448_45826_-	lysE type translocator family protein	NA	NA	NA	NA	NA
AWF33333.1|46087_47038_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33396.1|47348_47480_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33403.1|47877_48030_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33338.1|48006_48711_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	94.0	2.0e-130
AWF33334.1|50375_50507_-	hypothetical protein	NA	NA	NA	NA	NA
AWF33347.1|50708_51311_+	fimbrial family protein	NA	NA	NA	NA	NA
AWF33375.1|51387_52089_+	gram-negative pili assembly chaperone, C-terminal domain protein	NA	NA	NA	NA	NA
AWF33331.1|52211_54791_+	papC C-terminal domain protein	NA	NA	NA	NA	NA
AWF33356.1|54885_55452_+	fimbrial family protein	NA	NA	NA	NA	NA
AWF33348.1|55531_55747_+|transposase	transposase, Mutator family protein	transposase	A0A220NQR7	Corynebacterium_phage	51.9	3.5e-09
56989:57004	attR	TTCCGGCCTTTCTTCT	NA	NA	NA	NA
