The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	1341507	1354689	4695904		Escherichia_phage(50.0%)	13	NA	NA
AWF28097.1|1341507_1342269_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AWF25711.1|1342262_1342889_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWF26807.1|1343028_1344168_+	peptidase M23 family protein	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWF24798.1|1344230_1344623_+	sigma-70 factor, region 1.2 family protein	NA	NA	NA	NA	NA
AWF26964.1|1344703_1345222_+	sigma-70, region 4 family protein	NA	I1ZBD5	Salisaeta_icosahedral_phage	31.8	1.5e-13
AWF27904.1|1345315_1346635_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
AWF26366.1|1346768_1347545_-	putative hydroxypyruvate isomerase YgbM	NA	NA	NA	NA	NA
AWF25622.1|1347549_1348188_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWF28154.1|1348184_1349447_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWF28531.1|1349443_1350352_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWF24379.1|1350547_1351315_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWF28527.1|1351365_1352022_-	serine/threonine-protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AWF24777.1|1352127_1354689_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	1427570	1436904	4695904	transposase	Shigella_phage(33.33%)	7	NA	NA
AWF27722.1|1427570_1427936_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AWF27205.1|1427959_1428799_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	99.3	5.1e-165
AWF28486.1|1428769_1429639_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
AWF25723.1|1430445_1430823_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	97.6	3.5e-65
AWF25396.1|1430868_1434099_-	type I site-specific deoxyribonuclease, HsdR family protein	NA	A0A220A398	Liberibacter_phage	28.5	2.8e-62
AWF24823.1|1434166_1435360_-	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	34.7	5.4e-19
AWF25820.1|1435356_1436904_-	methyltransferase domain protein	NA	A0A2H4PQP4	Staphylococcus_phage	27.6	4.2e-48
>prophage 3
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	1965040	1974482	4695904		Enterobacteria_phage(85.71%)	9	NA	NA
AWF26082.1|1965040_1965967_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
AWF24647.1|1965971_1966703_+	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWF24892.1|1966850_1967582_-	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWF24186.1|1967803_1969489_+	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWF24375.1|1969485_1970205_+	response regulator	NA	NA	NA	NA	NA
AWF28565.1|1970251_1970722_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWF26958.1|1970762_1971224_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
AWF27236.1|1971348_1973349_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
AWF25798.1|1973345_1974482_-	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	2543045	2557148	4695904	integrase	Escherichia_phage(22.22%)	16	2540749:2540762	2553114:2553127
2540749:2540762	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
AWF25900.1|2543045_2545472_-	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AWF27806.1|2545670_2545976_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24715.1|2546170_2546794_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24528.1|2546796_2547357_-	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWF25060.1|2547391_2547733_-	hypothetical protein	NA	NA	NA	NA	NA
AWF25359.1|2547867_2548194_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWF24144.1|2548399_2549614_+	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWF24829.1|2549625_2550645_+	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWF26206.1|2550832_2552113_-|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
AWF28350.1|2552147_2552384_-	hypothetical protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AWF27263.1|2552471_2554943_-	putative exonuclease VIII	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
2553114:2553127	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
AWF24420.1|2555036_2555228_-	hypothetical protein	NA	NA	NA	NA	NA
AWF25794.1|2555224_2555413_-	dicB family protein	NA	NA	NA	NA	NA
AWF28329.1|2555556_2555739_+	hypothetical protein	NA	NA	NA	NA	NA
AWF27864.1|2555719_2556685_+	putative ybl78	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
AWF27487.1|2556725_2557148_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
>prophage 5
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	2564076	2571468	4695904		Enterobacteria_phage(50.0%)	7	NA	NA
AWF26497.1|2564076_2565126_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AWF27083.1|2565246_2565513_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	62.2	7.8e-19
AWF28268.1|2565509_2566331_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AWF25515.1|2566845_2566962_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25967.1|2567223_2569239_+	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
AWF26592.1|2569309_2569705_+	outer membrane beta-barrel domain protein	NA	A5LH44	Enterobacteria_phage	97.4	6.1e-60
AWF25712.1|2569704_2571468_+	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	85.2	1.8e-204
>prophage 6
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	2973073	2983851	4695904	transposase,integrase	Enterobacteria_phage(27.27%)	12	2971046:2971069	2982554:2982577
2971046:2971069	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AWF26446.1|2973073_2974891_-	phoH-like family protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.0e-26
AWF26299.1|2976070_2976574_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	2.6e-84
AWF25357.1|2976818_2977397_-	phage replication protein O, N-terminal domain	NA	A0A0M5M7Y1	Salmonella_phage	50.0	3.1e-36
AWF28369.1|2977393_2977933_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AWF24152.1|2978121_2978427_+	putative bacteriophage recombination protein	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.3e-43
AWF28302.1|2978423_2979104_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AWF25441.1|2979094_2979259_+	hypothetical protein	NA	M1FJ61	Enterobacteria_phage	88.9	7.9e-22
AWF25064.1|2979255_2980320_+	DGQHR domain protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AWF25950.1|2980739_2980979_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AWF28621.1|2981118_2981355_+	excisionase-like family protein	NA	NA	NA	NA	NA
AWF27149.1|2981344_2982487_+|integrase	phage integrase family protein	integrase	O21929	Phage_21	99.7	8.1e-206
AWF26132.1|2982600_2983851_-	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	100.0	3.8e-23
2982554:2982577	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 7
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	3298227	3306997	4695904	integrase	Salmonella_phage(88.89%)	11	3297897:3297910	3307039:3307052
3297897:3297910	attL	AAAACAATAAGTTA	NA	NA	NA	NA
AWF27878.1|3298227_3298416_-	putative levan regulatory protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AWF24887.1|3298574_3300968_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AWF28605.1|3300964_3301822_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AWF27801.1|3301818_3302046_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AWF24089.1|3302045_3302279_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AWF26878.1|3302346_3302688_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AWF26978.1|3302710_3302935_-	putative cell division blocking protein	NA	NA	NA	NA	NA
AWF26636.1|3303109_3303619_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AWF26867.1|3303961_3304897_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.8e-30
AWF27710.1|3304908_3305853_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24998.1|3305944_3306997_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3307039:3307052	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	3374112	3412836	4695904	lysis,transposase,integrase,terminase	Enterobacteria_phage(48.28%)	54	3388496:3388510	3412910:3412924
AWF27986.1|3374112_3374322_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF25142.1|3374322_3374616_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	87.9	7.2e-42
AWF24179.1|3374838_3374952_-	conserved inner membrane domain protein	NA	NA	NA	NA	NA
AWF25631.1|3375249_3375894_-	inner membrane protein YbhL	NA	NA	NA	NA	NA
AWF27254.1|3376090_3376543_-	molybdopterin synthase catalytic subunit	NA	NA	NA	NA	NA
AWF25189.1|3376544_3376790_-	molybdopterin converting factor, subunit 1	NA	NA	NA	NA	NA
AWF27194.1|3376782_3377268_-	molybdenum cofactor biosynthesis protein C	NA	NA	NA	NA	NA
AWF28116.1|3377270_3377783_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
AWF27890.1|3377804_3378794_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AWF24094.1|3379190_3380099_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AWF24419.1|3380290_3382312_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWF26509.1|3382890_3383568_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AWF24211.1|3383560_3384316_-	malonyl-CoA O-methyltransferase BioC	NA	NA	NA	NA	NA
AWF27772.1|3384302_3385457_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AWF25704.1|3385453_3386494_-	biotin synthase	NA	NA	NA	NA	NA
AWF26460.1|3386637_3387870_+	adenosylmethionine-8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.3e-19
AWF24855.1|3387928_3388405_+	hypothetical protein	NA	NA	NA	NA	NA
3388496:3388510	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AWF26614.1|3389150_3390482_+	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AWF26545.1|3391376_3391550_+	putative adoMet-dependent methyltransferase DLP12 prophage	NA	NA	NA	NA	NA
AWF25111.1|3391787_3392360_-	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	95.8	1.2e-96
AWF27040.1|3392440_3393001_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AWF27217.1|3393140_3393284_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24477.1|3393449_3393623_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	94.1	2.5e-10
AWF27498.1|3394581_3395049_-|lysis	bacteriophage lysis family protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AWF25803.1|3395045_3395543_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AWF24901.1|3395542_3395758_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AWF26513.1|3395945_3396116_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF26249.1|3396541_3396676_-	putative araC-type regulatory protein from bacteriophage origin	NA	NA	NA	NA	NA
AWF25927.1|3397027_3397987_-	hypothetical protein	NA	NA	NA	NA	NA
AWF27611.1|3398260_3398704_+	outer membrane lipoprotein blc	NA	A0A1W6JNX6	Morganella_phage	56.7	6.6e-47
AWF28177.1|3398859_3399237_-	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AWF25630.1|3399322_3399463_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AWF25353.1|3399459_3399822_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AWF24597.1|3399818_3400109_-	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AWF24219.1|3400271_3400727_-	putative phage protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AWF24145.1|3401018_3401132_-	hypothetical protein	NA	NA	NA	NA	NA
AWF27977.1|3401366_3401870_-	putative uDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AWF25380.1|3402414_3402570_+	hypothetical protein	NA	NA	NA	NA	NA
AWF27948.1|3402701_3403193_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.4	7.8e-89
AWF27733.1|3403294_3403471_-	replication domain protein	NA	A0A0M5M7Y1	Salmonella_phage	85.7	2.9e-06
AWF27239.1|3403467_3404007_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AWF28207.1|3404076_3404307_-	helix-turn-helix family protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AWF26396.1|3404345_3405101_+	helix-turn-helix family protein	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWF26251.1|3405223_3405973_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25059.1|3405969_3406797_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25981.1|3407305_3407512_+	putative phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWF27140.1|3407587_3407884_+	host-nuclease inhibitor protein gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWF24834.1|3407889_3408675_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWF24920.1|3408671_3409352_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AWF25179.1|3409581_3409695_+	hypothetical protein	NA	A0A0K2FJ42	Enterobacteria_phage	94.6	4.3e-11
AWF24944.1|3409771_3409987_+	putative ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AWF26951.1|3410517_3410667_-	putative transmembrane protein	NA	NA	NA	NA	NA
AWF27947.1|3411362_3411530_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AWF27425.1|3411765_3412836_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3412910:3412924	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 9
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4196055	4218730	4695904	tail,integrase	Escherichia_phage(56.25%)	34	4198867:4198886	4218961:4218980
AWF27278.1|4196055_4196217_-	hypothetical protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
AWF27739.1|4196343_4196949_-	osmotically-inducible protein Y	NA	NA	NA	NA	NA
AWF25017.1|4197341_4198916_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
4198867:4198886	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
AWF25609.1|4198868_4199033_+	hypothetical protein	NA	NA	NA	NA	NA
AWF27381.1|4199480_4199777_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
AWF27157.1|4199830_4199959_+	hypothetical protein	NA	A0A291AWY7	Escherichia_phage	100.0	8.0e-14
AWF27850.1|4200112_4200616_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	100.0	1.1e-90
AWF27118.1|4200671_4200800_-	hypothetical protein	NA	A0A291AWY8	Escherichia_phage	100.0	2.4e-18
AWF25778.1|4201140_4201260_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	84.4	1.2e-08
AWF28617.1|4201571_4202534_+|tail	putative tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
AWF25040.1|4202537_4203065_+|tail	caudovirales tail fiber assembly family protein	tail	A0A077SK10	Escherichia_phage	98.3	1.9e-93
AWF26274.1|4203093_4203627_-|tail	caudovirales tail fiber assembly family protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
AWF25243.1|4203629_4203968_-|tail	putative phage tail fiber protein	tail	A0A222YYI1	Escherichia_phage	98.2	2.1e-61
AWF25014.1|4204083_4204284_-	hypothetical protein	NA	A5LH80	Enterobacteria_phage	98.5	3.7e-29
AWF27852.1|4204483_4204675_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.9e-28
AWF27789.1|4204946_4205060_-	hypothetical protein	NA	A0A291AX11	Escherichia_phage	97.3	2.9e-15
AWF27771.1|4205189_4205942_-	antitermination family protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
AWF24876.1|4205955_4206945_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AWF27212.1|4206952_4207309_-	putative holliday junction resolvase domain protein	NA	A0A291AX14	Escherichia_phage	95.9	2.0e-33
AWF28465.1|4207305_4207632_-	lexA DNA binding domain protein	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWF28187.1|4207631_4208120_-	perC transcriptional activator family protein	NA	A0A291AWV6	Escherichia_phage	100.0	2.9e-88
AWF28107.1|4208122_4208941_-	helix-turn-helix domain protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
AWF27490.1|4208937_4209174_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
AWF27383.1|4209166_4210003_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	100.0	1.0e-152
AWF27499.1|4209999_4210551_-	putative dNA-binding transcriptional regulator	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
AWF26792.1|4210594_4210795_-	hypothetical protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWF28233.1|4211266_4211560_+	peptidase S24-like family protein	NA	U5P0T5	Shigella_phage	100.0	3.1e-53
AWF26178.1|4212226_4212589_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWF25765.1|4212654_4213479_+	hypothetical protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
AWF24364.1|4213607_4214144_+	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
AWF25499.1|4214227_4214497_+	putative phage protein	NA	U5P092	Shigella_phage	98.9	4.7e-48
AWF27125.1|4214496_4215117_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
AWF25129.1|4215549_4217250_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
AWF27229.1|4217506_4218730_-|integrase	phage integrase family protein	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
4218961:4218980	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 10
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4283021	4300436	4695904	transposase,integrase	Stx2-converting_phage(37.5%)	23	4272627:4272642	4303441:4303456
4272627:4272642	attL	ACCACGTCAATGGCAT	NA	NA	NA	NA
AWF24395.1|4283021_4283618_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AWF27475.1|4284095_4284698_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AWF27464.1|4286444_4286870_+	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AWF26660.1|4286889_4287996_+	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWF25304.1|4288243_4289041_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	54.4	5.0e-77
AWF27012.1|4289048_4289699_-	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWF27980.1|4289750_4289873_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24636.1|4290044_4290263_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25125.1|4290642_4290969_-	hypothetical protein	NA	A0A1S6UA20	Serratia_phage	49.0	1.4e-17
AWF26287.1|4290931_4291099_-	is2 element domain protein	NA	Q9ZXG3	Shigella_phage	98.0	8.0e-22
AWF25754.1|4291122_4291488_-|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AWF26990.1|4291949_4292090_+	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
AWF28100.1|4292433_4292559_-	putative membrane protein	NA	NA	NA	NA	NA
AWF28452.1|4292805_4293375_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24168.1|4293768_4293942_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25036.1|4293929_4294364_+	hypothetical protein	NA	NA	NA	NA	NA
AWF26449.1|4294542_4294671_+	hypothetical protein	NA	NA	NA	NA	NA
AWF24229.1|4295095_4295443_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWF25818.1|4295492_4296878_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AWF27413.1|4297116_4298475_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AWF28166.1|4298871_4299045_+	hypothetical protein	NA	NA	NA	NA	NA
AWF27356.1|4299207_4299465_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AWF25833.1|4300226_4300436_-|transposase	putative transposase	transposase	NA	NA	NA	NA
4303441:4303456	attR	ATGCCATTGACGTGGT	NA	NA	NA	NA
>prophage 11
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4307036	4313595	4695904		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
AWF24449.1|4307036_4307993_+	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWF28238.1|4308025_4308166_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24351.1|4308149_4308761_+	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.5	6.6e-05
AWF24643.1|4309318_4309576_-	hypothetical protein	NA	NA	NA	NA	NA
AWF24283.1|4309897_4310479_-	HTH-like domain protein	NA	Q716C2	Shigella_phage	96.5	5.0e-95
AWF28530.1|4310627_4311779_+	homeo-like domain protein	NA	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AWF26196.1|4312524_4312722_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	54.2	6.4e-10
AWF27347.1|4312770_4313595_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 12
CP029122	Escherichia coli strain AR434 chromosome, complete genome	4695904	4557435	4580356	4695904	lysis,portal,integrase	Shigella_phage(36.0%)	32	4548700:4548713	4567418:4567431
4548700:4548713	attL	GTTACCAGATGAAA	NA	NA	NA	NA
AWF28496.1|4557435_4558533_+|integrase	phage integrase family protein	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
AWF25669.1|4558593_4558842_+	dinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
AWF24165.1|4559593_4560964_+	reverse transcriptase family protein	NA	NA	NA	NA	NA
AWF25208.1|4561071_4561206_-	putative membrane protein	NA	NA	NA	NA	NA
AWF27251.1|4561221_4561365_-	hypothetical protein	NA	NA	NA	NA	NA
AWF26737.1|4561401_4563555_-	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	53.6	1.4e-211
AWF25811.1|4563551_4563665_-	hypothetical protein	NA	NA	NA	NA	NA
AWF25390.1|4563706_4564132_+	hypothetical protein	NA	NA	NA	NA	NA
AWF25159.1|4564249_4564663_-|portal	phage portal, lambda family protein	portal	A5LH29	Enterobacteria_phage	100.0	2.8e-71
AWF24686.1|4564805_4565012_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	100.0	3.6e-32
AWF26858.1|4565088_4566141_-	DNA methylase family protein	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AWF27035.1|4566290_4566509_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	2.0e-28
AWF27187.1|4566749_4567898_+	37-kD nucleoid-associated bacterial family protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	1.2e-12
4567418:4567431	attR	GTTACCAGATGAAA	NA	NA	NA	NA
AWF24103.1|4567894_4569121_+	hypothetical protein	NA	NA	NA	NA	NA
AWF26508.1|4569113_4569458_-	phage antitermination Q family protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
AWF28411.1|4569475_4570465_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
AWF27011.1|4570472_4571270_-	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
AWF28567.1|4571289_4571487_-	endodeoxyribonuclease RusA family protein	NA	A5LH74	Enterobacteria_phage	96.9	1.1e-30
AWF26728.1|4571675_4572002_-	lexA DNA binding domain protein	NA	A5LH73	Enterobacteria_phage	98.1	6.6e-52
AWF25650.1|4571998_4572652_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
AWF28352.1|4572651_4573140_-	perC transcriptional activator family protein	NA	U5P0U0	Shigella_phage	97.5	2.1e-86
AWF24417.1|4573142_4573961_-	helix-turn-helix domain protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
AWF28634.1|4573957_4574194_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
AWF28199.1|4574186_4575023_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	2.6e-137
AWF26655.1|4575019_4575571_-	putative e14 prophage DNA-binding transcriptional regulator	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
AWF28104.1|4575614_4575815_-	hypothetical protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWF25976.1|4576286_4576580_+	peptidase S24-like family protein	NA	U5P0T5	Shigella_phage	100.0	3.1e-53
AWF28555.1|4577246_4577609_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AWF26265.1|4577674_4578499_+	hypothetical protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
AWF26869.1|4578715_4579468_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28032.1|4579504_4579774_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
AWF24170.1|4579807_4580356_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
>prophage 1
CP029123	Escherichia coli strain AR434 plasmid unnamed1, complete sequence	97471	2205	49895	97471	integrase,transposase	Escherichia_phage(31.25%)	39	19131:19146	47124:47139
AWF28675.1|2205_2910_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AWF28655.1|2900_3749_+	initiator Replication family protein	NA	A0A218MNI2	uncultured_virus	43.3	3.3e-47
AWF28672.1|4389_4911_-	hypothetical protein	NA	NA	NA	NA	NA
AWF28719.1|4968_5745_-	dihydrofolate reductase, type IV domain protein	NA	A0A1C9LW38	Vibrio_phage	40.6	4.0e-15
AWF28712.1|5913_6618_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF28682.1|7625_9641_+|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
AWF28662.1|9835_10270_+	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF28705.1|10348_11353_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF28731.1|11758_11875_+	putative membrane protein	NA	NA	NA	NA	NA
AWF28703.1|12483_13209_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28658.1|13341_17595_+	RHS repeat-associated core domain protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AWF28726.1|17707_18007_+	hypothetical protein	NA	NA	NA	NA	NA
AWF28651.1|18378_19083_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
AWF28713.1|19130_19571_+|transposase	putative transposaseTniA	transposase	NA	NA	NA	NA
19131:19146	attL	GTGCCCGCCGATGCGC	NA	NA	NA	NA
AWF28666.1|19753_19993_+	bacterial TniB family protein	NA	NA	NA	NA	NA
AWF28700.1|20592_21717_-	hypothetical protein	NA	NA	NA	NA	NA
AWF28670.1|22078_23215_-	hypothetical protein	NA	NA	NA	NA	NA
AWF28704.1|23265_23493_-	putative membrane protein	NA	NA	NA	NA	NA
AWF28699.1|24744_25605_-	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AWF28653.1|25737_26403_-	DDE domain protein	NA	S5WIU1	Leptospira_phage	28.2	1.6e-12
AWF28697.1|26564_26870_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF28683.1|26923_27694_-	AAA domain protein	NA	NA	NA	NA	NA
AWF28707.1|27686_29747_-	transposon Tn7 transposition protein TnsB	NA	NA	NA	NA	NA
AWF28647.1|29760_30588_-	transposon Tn7 transposition protein TnsA	NA	NA	NA	NA	NA
AWF28714.1|30718_31183_+	bacterial TniB family protein	NA	NA	NA	NA	NA
AWF28680.1|31233_32778_-	HTH-like domain protein	NA	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AWF28664.1|32909_34424_+	winged helix-turn-helix DNA-binding family protein	NA	A0A2L1IVA1	Escherichia_phage	24.4	1.2e-15
AWF28701.1|34431_35196_+	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	2.7e-32
AWF28722.1|36358_37198_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWF28676.1|37752_38601_+	DDE_Tnp_1-associated family protein	NA	NA	NA	NA	NA
AWF28733.1|38663_38879_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF28673.1|39038_39938_+	beta-lactamase enzyme family protein	NA	NA	NA	NA	NA
AWF28695.1|40671_41700_-	tetracycline resistance protein, class C	NA	NA	NA	NA	NA
AWF28689.1|41887_42727_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWF28679.1|43236_43755_-	aminoglycoside N(6')-acetyltransferase type 1	NA	NA	NA	NA	NA
AWF28684.1|43960_44974_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
AWF28715.1|45279_45837_+	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWF28678.1|46211_48812_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	75.4	0.0e+00
47124:47139	attR	GTGCCCGCCGATGCGC	NA	NA	NA	NA
AWF28706.1|48890_49895_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
