The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	82346	91190	4219380		Caulobacter_phage(50.0%)	9	NA	NA
AWF42496.1|82346_83492_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
AWF41911.1|83884_84469_+	bacterial stress family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
AWF42281.1|84601_85630_+	bacterial stress family protein	NA	NA	NA	NA	NA
AWF40969.1|85654_86110_+	terB	NA	NA	NA	NA	NA
AWF42488.1|86144_87170_+	integral membrane, TerC family protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
AWF40912.1|87237_87816_+	bacterial stress family protein	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
AWF42098.1|87892_88468_+	bacterial stress family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AWF41300.1|88564_89245_-	HAD phosphoserine phosphatase-like hydrolase, IB family protein	NA	NA	NA	NA	NA
AWF42306.1|89645_91190_+	methyl-accepting chemotaxis (MCP) signaling domain protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.0e-11
>prophage 2
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	647579	687124	4219380	head,terminase,lysis	Burkholderia_phage(20.51%)	54	NA	NA
AWF40142.1|647579_648080_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	8.0e-41
AWF41968.1|648079_650047_-	putative exonuclease	NA	H9C157	Pectobacterium_phage	39.8	7.6e-119
AWF41216.1|650061_650346_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42597.1|650357_650690_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	38.1	3.6e-05
AWF39616.1|650947_651148_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39635.1|651144_651537_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40074.1|651878_652535_-	helix-turn-helix domain protein	NA	H9C160	Pectobacterium_phage	35.3	2.2e-30
AWF39790.1|652626_652812_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	60.0	1.9e-08
AWF41589.1|652852_653308_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	5.8e-30
AWF41233.1|653367_653550_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.9	2.2e-12
AWF42493.1|653551_654418_+	bacterial regulatory, gntR family protein	NA	Q8W642	Enterobacteria_phage	59.7	3.1e-32
AWF41252.1|654410_655004_+	istB-like ATP binding family protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.4e-44
AWF40132.1|654996_656370_+	dnaB-like helicase N terminal domain protein	NA	A0A192Y673	Salmonella_phage	45.4	4.2e-100
AWF41766.1|656797_657601_+	D12 class N6 adenine-specific DNA methyltransferase family protein	NA	A0A0K1LM14	Caulobacter_phage	46.1	9.2e-63
AWF42982.1|657781_657949_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	52.7	9.8e-12
AWF40111.1|658026_658620_+	hypothetical protein	NA	K7PKS6	Enterobacteria_phage	54.7	4.3e-57
AWF42478.1|658631_658943_+	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	5.9e-34
AWF39450.1|658930_659464_+	hypothetical protein	NA	Q5TJL7	Enterobacteria_phage	51.9	6.1e-39
AWF42859.1|659714_660731_+	37-kD nucleoid-associated bacterial family protein	NA	NA	NA	NA	NA
AWF41442.1|660803_661946_+	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	28.1	5.5e-29
AWF41351.1|662156_662420_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	45.3	1.8e-15
AWF41260.1|662419_662890_+	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	59.9	6.8e-50
AWF40559.1|663065_663494_+|lysis	bacteriophage lysis family protein	lysis	A0A1P8DTG0	Proteus_phage	73.5	2.7e-45
AWF42492.1|663613_663805_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	53.4	3.6e-10
AWF42504.1|663874_664873_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	37.0	8.2e-37
AWF43040.1|664949_665066_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41451.1|665080_666685_+|terminase	phage terminase large subunit	terminase	A9YWZ6	Burkholderia_phage	64.1	1.2e-199
AWF42336.1|666836_668192_+	hypothetical protein	NA	A0A2H4P6S9	Pseudomonas_phage	43.2	3.9e-98
AWF40900.1|668229_668943_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.7	1.4e-33
AWF42797.1|668939_670199_+	hypothetical protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
AWF40581.1|670198_670696_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39628.1|670722_671763_+	hypothetical protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
AWF42316.1|671934_672174_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41044.1|672176_672608_+	hypothetical protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
AWF41361.1|672607_673066_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	8.5e-13
AWF42472.1|673065_673437_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41568.1|673423_673939_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41016.1|673947_675435_+	hypothetical protein	NA	A0A088C3U1	Shewanella_sp._phage	38.3	7.9e-84
AWF42459.1|675445_675898_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	3.4e-22
AWF41420.1|675937_676396_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
AWF42599.1|676479_678774_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	27.7	1.4e-18
AWF40094.1|678770_679298_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41738.1|679297_679615_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
AWF39875.1|679583_680396_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
AWF39681.1|680398_681091_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
AWF41003.1|681087_681432_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39979.1|681424_682612_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	1.1e-69
AWF42187.1|682608_683265_+	hypothetical protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
AWF40105.1|683270_684710_+	carbohydrate binding domain protein	NA	A0A2K9V2I0	Shigella_phage	42.3	2.2e-30
AWF41931.1|684839_685394_-	short C-terminal domain protein	NA	NA	NA	NA	NA
AWF39886.1|685497_685773_-	putative phage protein	NA	NA	NA	NA	NA
AWF41148.1|685797_686043_-	dinI-like family protein	NA	NA	NA	NA	NA
AWF41582.1|686116_686272_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42368.1|686593_687124_+	cytidine and deoxycytidylate deaminase zinc-binding region family protein	NA	S4VYT2	Pandoravirus	31.5	1.4e-06
>prophage 3
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	886941	905803	4219380	plate,holin,lysis	Burkholderia_phage(26.67%)	22	NA	NA
AWF41776.1|886941_887757_+	antitermination family protein	NA	M9NZB0	Enterobacteria_phage	43.4	1.6e-54
AWF40042.1|888188_888437_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	53.8	8.9e-17
AWF42140.1|888439_888844_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
AWF41364.1|888873_889290_+|lysis	bacteriophage lysis family protein	lysis	NA	NA	NA	NA
AWF41485.1|889326_889839_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42146.1|889847_891335_+	hypothetical protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
AWF40992.1|891345_891798_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40601.1|891857_892316_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
AWF41697.1|892398_894702_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.8	4.4e-17
AWF41959.1|894704_895199_+	putative phage protein	NA	NA	NA	NA	NA
AWF42817.1|895204_895525_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42263.1|895493_896306_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AWF42122.1|896308_897001_+|plate	putative phage baseplate protein	plate	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
AWF41476.1|896997_897342_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39889.1|897334_898522_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
AWF42081.1|898518_899175_+	hypothetical protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
AWF41109.1|899180_900416_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
AWF41204.1|900555_900735_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40311.1|901303_901846_+	hypothetical protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
AWF41532.1|901961_902738_-	DMSO reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
AWF42083.1|902741_903359_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	68.3	4.4e-89
AWF40524.1|903370_905803_-	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 4
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1265223	1393338	4219380	terminase,lysis,protease,portal,head,tail,capsid,tRNA,integrase,transposase	Proteus_phage(18.48%)	174	1268344:1268398	1321186:1321240
AWF39793.1|1265223_1266219_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
AWF41613.1|1266417_1266756_-	hypothetical protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
AWF42699.1|1266748_1266925_-	putative phage protein	NA	NA	NA	NA	NA
AWF39393.1|1267314_1267536_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41753.1|1267689_1268118_-	ASCH domain protein	NA	R9VWB9	Serratia_phage	43.5	5.9e-08
AWF39541.1|1268186_1268366_-	hypothetical protein	NA	NA	NA	NA	NA
1268344:1268398	attL	TCTTCTTTGAGTTTATCTGTCATATCTATCTCCTGTTTGCATCCTTGCACTGAGT	NA	NA	NA	NA
AWF41629.1|1268433_1268862_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	73.9	4.7e-50
AWF41531.1|1268851_1269550_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.8	7.0e-75
AWF39576.1|1269546_1270287_-	recombinase, phage RecT family protein	NA	A0A2L1IV84	Escherichia_phage	61.2	1.6e-77
AWF39349.1|1270427_1270631_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	97.0	3.1e-28
AWF41845.1|1270806_1270989_-	hypothetical protein	NA	A0A1P8DTH8	Proteus_phage	85.0	2.8e-20
AWF39213.1|1271337_1271553_+	putative phage protein	NA	NA	NA	NA	NA
AWF42636.1|1271952_1272087_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40325.1|1272677_1273646_-	serine dehydrogenase ase family protein	NA	NA	NA	NA	NA
AWF41052.1|1273783_1274509_-	helix-turn-helix family protein	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
AWF41406.1|1274614_1274842_+	helix-turn-helix family protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
AWF42886.1|1275053_1275332_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	39.5	2.7e-06
AWF42892.1|1275428_1275602_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42270.1|1275613_1276366_+	helix-turn-helix domain protein	NA	A5LH71	Enterobacteria_phage	50.5	9.6e-22
AWF40612.1|1276365_1277751_+	replicative DNA helicase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
AWF42893.1|1277772_1278108_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	38.7	2.3e-23
AWF39834.1|1278241_1278625_+	putative phage protein	NA	A0A2I7QR39	Vibrio_phage	36.7	4.1e-13
AWF39599.1|1279029_1279167_+	crossover junction endodeoxyribonuclease RusA superfamily protein	NA	NA	NA	NA	NA
AWF40744.1|1279183_1279339_+	endodeoxyribonuclease RusA family protein	NA	G8C7V6	Escherichia_phage	85.7	1.7e-18
AWF41179.1|1279338_1279971_+	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
AWF42701.1|1280474_1280804_+	inner membrane protein YagU	NA	NA	NA	NA	NA
AWF42386.1|1280962_1281385_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40632.1|1281438_1281708_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
AWF41492.1|1281707_1282178_+	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	61.2	2.2e-48
AWF42232.1|1282159_1282318_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40033.1|1282320_1282782_+|lysis	bacteriophage lysis family protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
AWF41958.1|1283479_1283602_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	59.0	3.4e-06
AWF42681.1|1283703_1283868_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40190.1|1283947_1284556_+	putative dNA repair protein RecN	NA	A0A077KBY7	Edwardsiella_phage	68.0	8.2e-64
AWF40437.1|1284558_1286046_+|terminase	putative phage terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	89.3	2.6e-265
AWF39822.1|1286045_1287416_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	2.0e-118
AWF40875.1|1287436_1288534_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	51.7	9.5e-103
AWF41435.1|1288645_1289407_+	putative phage protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	2.0e-67
AWF40622.1|1289420_1290374_+|capsid	putative major capsid protein	capsid	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
AWF39566.1|1290547_1290661_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42614.1|1290699_1291179_+	putative phage protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
AWF43003.1|1291220_1291532_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	50.6	5.4e-19
AWF40223.1|1291548_1292115_+	putative gp12	NA	G8C7Q1	Escherichia_phage	51.3	3.8e-47
AWF39687.1|1292111_1292513_+	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AWF41976.1|1292558_1293215_+|tail	phage tail family protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
AWF41333.1|1293266_1293572_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
AWF41535.1|1293586_1293874_+	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	9.0e-13
AWF41810.1|1294291_1294633_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	3.1e-36
AWF39245.1|1294646_1294829_-	putative orf59a protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
AWF42178.1|1295297_1295423_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42746.1|1295436_1295895_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41901.1|1296154_1296991_-	putative antirepressor protein	NA	I6S627	Salmonella_phage	59.6	1.7e-72
AWF41538.1|1297155_1297545_+	helix-turn-helix family protein	NA	NA	NA	NA	NA
AWF41524.1|1297958_1298099_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41092.1|1298091_1298484_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40984.1|1298551_1298785_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41212.1|1298910_1299732_+	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
AWF42153.1|1299792_1302723_+|tail	phage tail tape measure protein, lambda family	tail	K7PMB9	Enterobacterial_phage	35.5	1.1e-132
AWF42420.1|1302869_1303025_+	putative phage protein	NA	NA	NA	NA	NA
AWF40211.1|1303387_1303729_+|tail	phage minor tail family protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
AWF41992.1|1303725_1304469_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
AWF41642.1|1304465_1305176_+	nlpC/P60 family protein	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
AWF39753.1|1305172_1305778_+|tail	bacteriophage lambda tail assembly I family protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
AWF43022.1|1305829_1310023_+	hypothetical protein	NA	F1C571	Cronobacter_phage	54.4	2.2e-301
AWF39815.1|1310028_1310385_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40100.1|1310344_1311001_+	putative phage protein	NA	NA	NA	NA	NA
AWF39704.1|1311050_1311311_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
AWF40289.1|1311530_1311911_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42918.1|1312019_1312289_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF42227.1|1312425_1313508_-	fimbrial family protein	NA	NA	NA	NA	NA
AWF41507.1|1313517_1316052_-	papC C-terminal domain protein	NA	NA	NA	NA	NA
AWF40022.1|1316061_1316742_-	gram-negative pili assembly chaperone, C-terminal domain protein	NA	NA	NA	NA	NA
AWF41144.1|1316852_1317398_-	fimbrial family protein	NA	NA	NA	NA	NA
AWF40114.1|1317628_1317781_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41229.1|1317891_1318032_-	hot	NA	A0A1P8DTI0	Proteus_phage	93.5	7.2e-16
AWF41025.1|1318306_1319302_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	5.4e-73
AWF39304.1|1319500_1319839_-	hypothetical protein	NA	A0A1P8DTH6	Proteus_phage	45.0	1.3e-13
AWF41238.1|1319831_1320008_-	putative phage protein	NA	NA	NA	NA	NA
AWF41529.1|1320165_1320411_-	putative phage protein	NA	NA	NA	NA	NA
AWF42339.1|1320403_1320673_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	53.9	4.1e-15
AWF41576.1|1320672_1320852_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40172.1|1320881_1321010_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40491.1|1321241_1321427_-	hypothetical protein	NA	NA	NA	NA	NA
1321186:1321240	attR	TCTTCTTTGAGTTTATCTGTCATATCTATCTCCTGTTTGCATCCTTGCACTGAGT	NA	NA	NA	NA
AWF41100.1|1321595_1322093_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	68.4	5.7e-47
AWF41630.1|1322085_1322619_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.9	4.8e-52
AWF41517.1|1322675_1323503_-	hypothetical protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
AWF42463.1|1323568_1323943_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	70.6	7.1e-42
AWF41634.1|1324046_1324733_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	32.5	2.5e-16
AWF40909.1|1325244_1325877_-	repressor protein C2	NA	K7PLZ5	Enterobacterial_phage	44.8	3.9e-40
AWF42300.1|1325979_1326171_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42055.1|1326222_1326885_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41365.1|1326900_1327359_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
AWF42461.1|1327645_1327825_+	hypothetical protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
AWF41272.1|1327837_1328899_+	conserved phage family protein	NA	H2DE83	Erwinia_phage	55.3	7.9e-30
AWF40720.1|1328898_1329285_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	64.0	2.4e-45
AWF39203.1|1329533_1329929_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41733.1|1330001_1330385_+	endodeoxyribonuclease RusA family protein	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
AWF40668.1|1330403_1331207_+	kilA-N domain protein	NA	A0A1W6JP13	Morganella_phage	62.7	4.4e-89
AWF41014.1|1331203_1332229_+	hypothetical protein	NA	A0A1W6JP62	Morganella_phage	47.7	9.9e-86
AWF39284.1|1332256_1332937_+	phage antitermination Q family protein	NA	A0A1W6JP37	Morganella_phage	50.0	3.6e-52
AWF42767.1|1333095_1333290_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40447.1|1333363_1334386_+	DNA methylase family protein	NA	A0A1W6JP25	Morganella_phage	70.1	5.3e-132
AWF41544.1|1334638_1335061_+	putative phage protein	NA	NA	NA	NA	NA
AWF41386.1|1335217_1335553_+	membrane-bound lysozyme-inhibitor of c-type lysozyme family protein	NA	NA	NA	NA	NA
AWF40302.1|1335633_1335870_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41520.1|1335823_1336081_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40387.1|1336225_1336489_+	putative potassium channel protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
AWF42385.1|1336488_1336959_+	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	61.2	6.8e-50
AWF42237.1|1337101_1337563_+|lysis	bacteriophage lysis family protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
AWF40054.1|1337794_1337944_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40426.1|1338211_1338796_+	putative phage protein	NA	H6WRU8	Salmonella_phage	41.0	2.4e-20
AWF40934.1|1338882_1339002_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40753.1|1339033_1339342_+	putative sb55	NA	Q8HA83	Salmonella_phage	68.0	2.2e-33
AWF42112.1|1339374_1339713_+	HNH endonuclease family protein	NA	F1C587	Cronobacter_phage	67.0	7.1e-41
AWF40791.1|1339715_1339928_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
AWF40332.1|1340052_1340520_+|terminase	phage terminase, small subunit, P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
AWF41413.1|1340545_1342216_+	phage Terminase family protein	NA	A0A0U2C138	Paracoccus_phage	46.2	9.9e-144
AWF40337.1|1342216_1343548_+|portal	phage portal protein, HK97 family	portal	A0A1P8DTI5	Proteus_phage	76.7	2.7e-200
AWF42099.1|1343544_1344396_+|protease	clp protease family protein	protease	A0A1P8DTI2	Proteus_phage	84.6	5.4e-130
AWF42025.1|1344407_1345622_+|capsid	phage major capsid protein, HK97 family	capsid	A0A1P8DTJ7	Proteus_phage	89.4	1.9e-200
AWF42773.1|1345667_1345886_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	81.0	6.4e-11
AWF39897.1|1345885_1346212_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
AWF42829.1|1346220_1346550_+|head,tail	phage head-tail joining family protein	head,tail	B5WZS5	Pseudomonas_phage	38.7	1.1e-11
AWF39901.1|1346542_1347013_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.1	1.3e-11
AWF39867.1|1347018_1347360_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39442.1|1347447_1348035_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42253.1|1348099_1348516_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42579.1|1348560_1348791_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40982.1|1348831_1352119_+|tail	phage tail tape measure protein, lambda family	tail	Q8W6T6	Burkholderia_virus	40.2	9.6e-50
AWF40975.1|1352119_1352716_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	3.5e-51
AWF39522.1|1352715_1353297_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
AWF40955.1|1353335_1353614_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42558.1|1353645_1354044_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
AWF42604.1|1354043_1357769_+	hypothetical protein	NA	Q7Y3Z3	Yersinia_phage	51.8	3.4e-200
AWF42745.1|1358090_1358777_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41969.1|1358773_1359040_+	hypothetical protein	NA	NA	NA	NA	NA
AWF43054.1|1359056_1359317_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
AWF39836.1|1359536_1359926_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41807.1|1360018_1360324_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF39592.1|1360714_1360975_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42798.1|1360979_1361210_-	hot	NA	A0A1P8DTI0	Proteus_phage	92.1	1.2e-31
AWF41278.1|1361487_1361826_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AWF39853.1|1361977_1362277_-|transposase	transposase IS200 like family protein	transposase	A0A1S5RHE3	Helicobacter_phage	64.2	1.1e-29
AWF40081.1|1362416_1363625_+|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	80.5	2.4e-187
AWF40180.1|1363695_1364334_-	ribonuclease T	NA	NA	NA	NA	NA
AWF42655.1|1364429_1364819_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
AWF42033.1|1365140_1365257_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42617.1|1365719_1366148_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
AWF42956.1|1366492_1366960_-	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
AWF41518.1|1367180_1368293_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42548.1|1368336_1368990_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AWF39496.1|1369120_1370395_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
AWF39823.1|1370515_1371385_+	pyridoxal kinase	NA	NA	NA	NA	NA
AWF40615.1|1371463_1372075_-	glutathione S-transferase GST-6.0	NA	NA	NA	NA	NA
AWF40361.1|1372293_1373082_-	enoyl-[acyl-carrier-protein] reductase [NADH] FabI	NA	NA	NA	NA	NA
AWF40643.1|1373290_1374100_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
AWF39381.1|1374089_1375052_-	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G9BWD6	Planktothrix_phage	24.1	5.5e-06
AWF40769.1|1375090_1375984_-	peptide transport system permease protein SapC	NA	NA	NA	NA	NA
AWF40128.1|1375970_1376936_-	peptide transport system permease protein SapB	NA	NA	NA	NA	NA
AWF42416.1|1376932_1378597_-	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWF39432.1|1378904_1379909_-	psp operon transcriptional activator	NA	NA	NA	NA	NA
AWF42763.1|1380125_1380794_+	phage shock protein A	NA	NA	NA	NA	NA
AWF41460.1|1380869_1381061_+	phage shock protein B	NA	NA	NA	NA	NA
AWF40592.1|1381066_1381417_+	phage shock protein C	NA	NA	NA	NA	NA
AWF41302.1|1381739_1383134_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41818.1|1383130_1384177_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42412.1|1384640_1385063_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42801.1|1385199_1386765_+	transcriptional regulatory protein TyrR	NA	NA	NA	NA	NA
AWF41704.1|1386864_1387368_-	putative thiol peroxidase	NA	NA	NA	NA	NA
AWF42766.1|1387593_1389213_+	periplasmic murein peptide-binding protein	NA	NA	NA	NA	NA
AWF41735.1|1389569_1390130_-	outer membrane beta-barrel domain protein	NA	NA	NA	NA	NA
AWF41070.1|1390422_1390677_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41760.1|1391119_1392103_+	zinc transport protein ZntB	NA	NA	NA	NA	NA
AWF40317.1|1392417_1393338_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
>prophage 5
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	1782616	1801188	4219380	tail,integrase	Proteus_phage(26.67%)	24	1787190:1787206	1800941:1800957
AWF39763.1|1782616_1782754_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	81.4	7.8e-15
AWF41508.1|1782832_1782967_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42833.1|1783148_1783301_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	Q77Z09	Phage_21	92.0	6.8e-20
AWF42239.1|1783806_1784769_+	reverse transcriptase family protein	NA	NA	NA	NA	NA
AWF42119.1|1784872_1786339_+	recF/RecN/SMC N terminal domain protein	NA	C7BGE8	Burkholderia_phage	34.5	5.0e-14
AWF40708.1|1786335_1786965_+	hypothetical protein	NA	NA	NA	NA	NA
1787190:1787206	attL	AATAATAAATAACATAC	NA	NA	NA	NA
AWF41090.1|1787771_1787906_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41863.1|1787883_1788438_-|tail	putative tail fiber	tail	A0A1P8DTJ0	Proteus_phage	81.3	6.5e-68
AWF40411.1|1788462_1789047_-	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	70.0	4.0e-23
AWF40380.1|1789047_1789371_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	62.3	1.2e-26
AWF41615.1|1789387_1789654_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41402.1|1789650_1790337_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42953.1|1790658_1792758_-	hypothetical protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	50.2	1.4e-131
AWF39597.1|1792873_1793263_-	putative membrane protein	NA	S4TRS4	Salmonella_phage	35.0	2.1e-12
AWF43008.1|1793654_1794671_-	DNA methylase family protein	NA	A0A1W6JP25	Morganella_phage	66.2	3.0e-127
AWF41823.1|1794972_1795131_-	hypothetical protein	NA	NA	NA	NA	NA
AWF39367.1|1795485_1795758_+	winged helix-turn-helix DNA-binding family protein	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
AWF41847.1|1796175_1796436_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF42241.1|1796657_1797056_-	phage antitermination Q family protein	NA	B6SCZ7	Bacteriophage	55.3	4.6e-31
AWF40048.1|1797068_1798142_-	conserved phage family protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	4.9e-27
AWF42563.1|1798460_1799120_+	helix-turn-helix domain protein	NA	H9C160	Pectobacterium_phage	44.0	4.9e-46
AWF39436.1|1799361_1799619_+	excisionase-like family protein	NA	NA	NA	NA	NA
AWF39511.1|1799665_1800727_+|integrase	phage integrase family protein	integrase	O21925	Phage_21	59.3	2.7e-118
AWF39312.1|1801023_1801188_-	isocitrate/isopropylmalate dehydrogenase family protein	NA	Q77Z09	Phage_21	83.3	1.4e-18
1800941:1800957	attR	GTATGTTATTTATTATT	NA	NA	NA	NA
>prophage 6
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2202731	2258273	4219380	terminase,lysis,transposase,tail,capsid,tRNA	Cronobacter_phage(25.0%)	72	NA	NA
AWF40575.1|2202731_2203154_-|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	82.7	1.2e-61
AWF39926.1|2203284_2203491_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40584.1|2203844_2204138_-	plasmid stabilization system family protein	NA	NA	NA	NA	NA
AWF41702.1|2204130_2204373_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42586.1|2204529_2205012_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	51.7	1.6e-38
AWF40436.1|2205168_2206812_-	phosphoglucomutase, alpha-D-glucose phosphate-specific	NA	NA	NA	NA	NA
AWF40598.1|2206886_2207438_-	negative modulator of initiation of replication	NA	NA	NA	NA	NA
AWF39806.1|2207902_2208688_+	esterase YbfF	NA	A0A1L5C1K3	Mycobacterium_phage	36.1	1.0e-05
AWF39840.1|2208886_2209186_+	ribbon-helix-helix, copG family protein	NA	NA	NA	NA	NA
AWF41210.1|2209344_2209872_+	flavodoxin	NA	NA	NA	NA	NA
AWF41139.1|2210062_2210509_+	ferric uptake regulation protein	NA	NA	NA	NA	NA
AWF41209.1|2210664_2210868_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41383.1|2210960_2212355_-	chitoporin	NA	NA	NA	NA	NA
AWF39289.1|2212992_2214660_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
AWF39665.1|2214902_2215133_+	hot	NA	A0A1P8DTI0	Proteus_phage	92.1	1.2e-31
AWF39906.1|2215137_2215251_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41641.1|2215492_2215747_-	colicin-E3 immunity protein	NA	NA	NA	NA	NA
AWF42126.1|2215757_2215898_-	cytotoxic family protein	NA	NA	NA	NA	NA
AWF40136.1|2215964_2216222_-	colicin-E8 immunity protein	NA	NA	NA	NA	NA
AWF41001.1|2216224_2218147_-	colicin-E2	NA	NA	NA	NA	NA
AWF42782.1|2218519_2219206_-	putative phage protein	NA	NA	NA	NA	NA
AWF42256.1|2219497_2223691_-	hypothetical protein	NA	F1C571	Cronobacter_phage	54.4	2.2e-301
AWF42211.1|2223742_2224330_-|tail	bacteriophage lambda tail assembly I family protein	tail	F1C572	Cronobacter_phage	60.4	2.9e-58
AWF42581.1|2224326_2225037_-	nlpC/P60 family protein	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
AWF41456.1|2225033_2225777_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.4e-86
AWF43050.1|2225773_2226115_-|tail	phage minor tail family protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
AWF40025.1|2226336_2226459_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40404.1|2226478_2226721_-	putative phage protein	NA	NA	NA	NA	NA
AWF42440.1|2226808_2227021_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41297.1|2227043_2229983_-|tail	phage tail tape measure protein, lambda family	tail	A0A2P0WA05	Enterobacter_phage	35.4	1.2e-141
AWF40441.1|2230042_2230912_-	hypothetical protein	NA	NA	NA	NA	NA
AWF40431.1|2230949_2231843_-	ftsk gamma domain protein	NA	NA	NA	NA	NA
AWF42008.1|2231839_2231971_-	putative phage regulatory protein	NA	NA	NA	NA	NA
AWF39415.1|2232210_2232372_+	hicB family protein	NA	NA	NA	NA	NA
AWF39439.1|2232525_2233275_+	putative antirepressor protein	NA	G0ZNF0	Cronobacter_phage	45.2	4.4e-59
AWF39861.1|2233547_2234381_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	28.9	1.1e-26
AWF39679.1|2234883_2235066_+	putative orf59a protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
AWF39890.1|2235079_2235421_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	3.1e-36
AWF42700.1|2235837_2236125_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
AWF41797.1|2236139_2236445_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
AWF42500.1|2236496_2237153_-|tail	phage tail family protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
AWF41452.1|2237198_2237600_-	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AWF42173.1|2237596_2238163_-	putative gp12	NA	G8C7Q1	Escherichia_phage	51.3	8.5e-47
AWF42569.1|2238179_2238491_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	46.9	3.2e-16
AWF39776.1|2238532_2239012_-	putative phage protein	NA	G8C7P9	Escherichia_phage	47.7	2.9e-32
AWF39539.1|2239051_2239165_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41339.1|2239338_2240292_-|capsid	putative major capsid protein	capsid	A0A1B0VMF8	Pseudomonas_phage	71.2	2.4e-126
AWF40972.1|2240305_2241079_-	putative phage protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.7	3.5e-67
AWF41307.1|2241161_2241749_-	hypothetical protein	NA	NA	NA	NA	NA
AWF39329.1|2241765_2242845_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	50.8	1.5e-100
AWF42169.1|2242865_2244236_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.4	2.8e-120
AWF41597.1|2244235_2245735_-|terminase	terminase-like family protein	terminase	G8C7P3	Escherichia_phage	86.6	3.4e-268
AWF40383.1|2245806_2246373_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	64.1	1.8e-57
AWF40364.1|2246440_2246668_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41587.1|2246727_2246883_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42848.1|2246879_2246996_-	hypothetical protein	NA	NA	NA	NA	NA
AWF41869.1|2247082_2247667_-	BRO family, N-terminal domain protein	NA	Q3LZN7	Bacteriophage	48.2	3.3e-22
AWF41314.1|2248011_2248437_-|lysis	bacteriophage lysis family protein	lysis	M1FJ79	Enterobacteria_phage	34.1	2.6e-08
AWF39365.1|2248615_2249086_-	phage lysozyme family protein	NA	A0A1W6JNW4	Morganella_phage	61.2	2.6e-49
AWF40764.1|2249085_2249349_-	putative potassium channel protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
AWF39266.1|2249421_2249844_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42663.1|2251043_2251244_-	cold shock protein CspA	NA	A0A1W6JNX5	Morganella_phage	75.8	6.7e-23
AWF40547.1|2251840_2252299_-	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWF41627.1|2252538_2253171_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	33.8	2.1e-22
AWF39469.1|2253170_2253326_-	endodeoxyribonuclease RusA family protein	NA	G8C7V6	Escherichia_phage	87.8	7.7e-19
AWF42609.1|2253892_2254276_-	putative phage protein	NA	A0A2I7QR39	Vibrio_phage	36.7	4.1e-13
AWF39567.1|2254367_2255753_-	replicative DNA helicase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
AWF43030.1|2255752_2256505_-	helix-turn-helix domain protein	NA	H9C164	Pectobacterium_phage	33.5	1.3e-21
AWF42931.1|2256516_2256690_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42572.1|2256786_2257134_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	3.4e-06
AWF42071.1|2257297_2257507_-	helix-turn-helix family protein	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
AWF39558.1|2257655_2258273_+	repressor protein CI	NA	A0A1P8DTH0	Proteus_phage	98.0	2.9e-117
>prophage 7
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2261725	2268440	4219380	integrase	Salmonella_phage(33.33%)	12	2254264:2254277	2276600:2276613
2254264:2254277	attL	TACCTGTTGTCACG	NA	NA	NA	NA
AWF41578.1|2261725_2262268_+	hypothetical protein	NA	A0A1B1W2E3	Salmonella_phage	38.5	1.8e-33
AWF41450.1|2262381_2262606_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42911.1|2262694_2262850_+	putative phage protein	NA	NA	NA	NA	NA
AWF41094.1|2262914_2263112_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41081.1|2263579_2264464_+	AAA domain protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	1.9e-61
AWF42193.1|2264453_2264993_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	8.1e-55
AWF41303.1|2265032_2265215_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41996.1|2265283_2265709_+	ASCH domain protein	NA	A0A077SLQ8	Escherichia_phage	50.0	1.4e-09
AWF41227.1|2265771_2266026_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41469.1|2266463_2266589_+	putative phage protein	NA	NA	NA	NA	NA
AWF42210.1|2266901_2267240_+	hypothetical protein	NA	A0A1P8DTH6	Proteus_phage	45.0	1.9e-14
AWF41825.1|2267438_2268440_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	43.1	9.1e-68
2276600:2276613	attR	CGTGACAACAGGTA	NA	NA	NA	NA
>prophage 8
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	2304355	2316317	4219380		Mycobacterium_phage(25.0%)	14	NA	NA
AWF41318.1|2304355_2305567_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
AWF42029.1|2305822_2306029_+	hypothetical protein	NA	NA	NA	NA	NA
AWF42788.1|2306401_2307031_+	lipoyl(octanoyl) transferase	NA	NA	NA	NA	NA
AWF40242.1|2307132_2308098_+	lipoyl synthase	NA	NA	NA	NA	NA
AWF41588.1|2308113_2308488_+	protein CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AWF40442.1|2308962_2309082_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39489.1|2309379_2309520_-	hypothetical protein	NA	NA	NA	NA	NA
AWF42864.1|2309556_2309766_-	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
AWF40402.1|2309963_2310437_-	methylated-DNA-[]-cysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
AWF42912.1|2310718_2310943_+	glutaredoxin-like NrdH family protein	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AWF41758.1|2310954_2311359_+	nrdI protein	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
AWF39197.1|2311432_2313514_+	ribonucleoside-diphosphate reductase, alpha subunit	NA	V9VI16	Lactococcus_phage	51.6	4.8e-204
AWF42484.1|2313539_2314508_+	ribonucleotide reductase, small chain family protein	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
AWF41051.1|2315117_2316317_+	glycine betaine/L-proline transport ATP binding subunit	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 9
CP029133	Proteus mirabilis strain AR379 chromosome, complete genome	4219380	3687802	3696649	4219380	integrase	Morganella_phage(50.0%)	11	3678052:3678066	3700895:3700909
3678052:3678066	attL	AGTGTATTTTTTAAT	NA	NA	NA	NA
AWF40689.1|3687802_3689014_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	68.7	2.3e-158
AWF41854.1|3689227_3689887_+	hypothetical protein	NA	NA	NA	NA	NA
AWF41839.1|3690066_3690285_+	helix-turn-helix domain protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	4.3e-07
AWF41338.1|3690284_3690677_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	58.7	2.5e-29
AWF40755.1|3690989_3691784_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	48.3	1.7e-24
AWF41610.1|3691783_3692422_+	icd-like domain protein	NA	NA	NA	NA	NA
AWF40153.1|3692577_3692808_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40329.1|3692800_3692998_+	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	66.0	3.2e-09
AWF41692.1|3692985_3693294_+	hypothetical protein	NA	NA	NA	NA	NA
AWF39646.1|3693293_3693836_+	hypothetical protein	NA	NA	NA	NA	NA
AWF40607.1|3693931_3696649_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	67.4	0.0e+00
3700895:3700909	attR	ATTAAAAAATACACT	NA	NA	NA	NA
