The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	17850	80601	4875835	transposase,integrase	Stx2-converting_phage(44.44%)	47	36633:36692	80762:80862
AWF18411.1|17850_18198_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AWF15782.1|18247_18658_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.4	4.7e-63
AWF18662.1|18667_19849_+|transposase	helix-turn-helix domain of transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	86.8	1.0e-190
AWF16476.1|20737_21340_-	putative aec62	NA	NA	NA	NA	NA
AWF17792.1|21433_21640_-	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWF15641.1|23166_23736_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15017.1|23995_24397_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18608.1|24384_24795_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16938.1|25600_26458_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF17401.1|26798_26966_+	gamma-glutamyltranspeptidase family protein	NA	NA	NA	NA	NA
AWF18277.1|26956_27070_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17900.1|27109_28144_-	putative phosphotriesterase	NA	NA	NA	NA	NA
AWF15073.1|28146_28383_-	putative membrane protein	NA	NA	NA	NA	NA
AWF14560.1|28503_29112_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15724.1|29168_29927_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17124.1|29940_30888_-	pfkB carbohydrate kinase family protein	NA	NA	NA	NA	NA
AWF14522.1|30884_31154_-	HTH domain protein	NA	NA	NA	NA	NA
AWF18242.1|31349_31466_-|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	71.4	1.2e-08
AWF16707.1|32575_32740_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18050.1|32930_33053_+	cobalamin biosynthesis family protein	NA	NA	NA	NA	NA
AWF17089.1|33204_33750_+	bifunctional adenosylcobalamin biosynthesis protein CobU	NA	NA	NA	NA	NA
AWF15030.1|33746_34490_+	cobalamin 5'-phosphate synthase	NA	NA	NA	NA	NA
AWF15721.1|34501_35581_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AWF14446.1|35645_36578_+	putative L,D-transpeptidase ErfK/SrfK	NA	NA	NA	NA	NA
36633:36692	attL	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACC	NA	NA	NA	NA
AWF16192.1|37035_37953_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF15757.1|38054_39005_+	HTH-type transcriptional regulator cbl	NA	NA	NA	NA	NA
AWF14507.1|39311_40766_+	MATE efflux family protein	NA	NA	NA	NA	NA
AWF17570.1|41046_41190_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14662.1|41397_42114_-	putative transcriptional regulatory protein YeeN	NA	NA	NA	NA	NA
AWF14999.1|42456_43911_-	AMP nucleosidase	NA	NA	NA	NA	NA
AWF17704.1|44012_45329_-	H+ symporter family protein	NA	NA	NA	NA	NA
AWF15897.1|45643_46696_+	glycosyltransferase 9 family protein	NA	NA	NA	NA	NA
AWF14743.1|46951_48781_-	Ig-like domain family protein	NA	NA	NA	NA	NA
AWF14655.1|48816_48945_-	putative bacterial Ig-like domain protein	NA	NA	NA	NA	NA
AWF16142.1|48913_49624_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17492.1|50315_52337_-	pesticin receptor	NA	NA	NA	NA	NA
AWF15650.1|52467_54045_-	AMP-binding enzyme family protein	NA	NA	NA	NA	NA
AWF16747.1|54048_54852_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AWF18014.1|54848_55949_-	yersiniabactin biosynthetic protein YbtU	NA	NA	NA	NA	NA
AWF17673.1|55945_65437_-	methyltransferase family protein	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AWF16172.1|65524_71632_-	amino acid adenylation domain protein	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
AWF16253.1|71822_72782_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF17285.1|73038_74751_+	ABC transporter family protein	NA	W8CYL7	Bacillus_phage	27.3	1.0e-31
AWF18148.1|74737_76540_+	ABC transporter family protein	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
AWF15311.1|76532_77813_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWF16795.1|77840_79145_+	salicylate synthase	NA	NA	NA	NA	NA
AWF14673.1|79338_80601_-|integrase	phage integrase family protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	2.6e-72
80762:80862	attR	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCGTGTGAACGGGGCGCATATTA	NA	NA	NA	NA
>prophage 2
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	198401	248448	4875835	holin,tRNA,protease,transposase,tail	Moraxella_phage(22.22%)	55	NA	NA
AWF17842.1|198401_200462_+|protease	protease 2	protease	NA	NA	NA	NA
AWF17299.1|200458_201121_-	exodeoxyribonuclease 10	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AWF14424.1|201144_201801_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AWF17616.1|201902_202133_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AWF16419.1|202271_202646_+	protein YobA	NA	NA	NA	NA	NA
AWF17517.1|202649_203522_+	inner membrane protein YebZ	NA	NA	NA	NA	NA
AWF18320.1|203537_203876_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16918.1|204271_204928_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
AWF14249.1|204928_205120_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16699.1|205224_205461_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17291.1|205578_207024_-	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AWF18642.1|207097_209731_-	mce related family protein	NA	NA	NA	NA	NA
AWF17175.1|209699_210878_-	inner membrane protein YebS	NA	NA	NA	NA	NA
AWF14381.1|211112_211610_+	free methionine-R-sulfoxide reductase	NA	NA	NA	NA	NA
AWF16673.1|211706_212405_+	proP effector	NA	NA	NA	NA	NA
AWF15820.1|212424_214473_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
AWF17188.1|214667_215546_+|protease	protease HtpX	protease	NA	NA	NA	NA
AWF17719.1|215591_216965_-	transmembrane secretion effector family protein	NA	NA	NA	NA	NA
AWF15258.1|217141_217933_+	transcriptional regulator KdgR	NA	NA	NA	NA	NA
AWF14818.1|218075_218291_-	yobH-like family protein	NA	NA	NA	NA	NA
AWF14236.1|218473_218617_+	protein MgrB	NA	NA	NA	NA	NA
AWF17213.1|218691_218979_+	yebO-like family protein	NA	NA	NA	NA	NA
AWF14343.1|219647_219791_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16695.1|219803_220013_+	cold shock-like protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AWF15184.1|220178_220988_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AWF16188.1|220984_221551_-	putative manganese efflux pump MntP	NA	NA	NA	NA	NA
AWF17549.1|221979_222438_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17050.1|222492_223344_-	PTS system, mannose/fructose/sorbose, IID component family protein	NA	NA	NA	NA	NA
AWF17036.1|223356_224157_-	PTS system, mannose/fructose/sorbose, IIC component family protein	NA	NA	NA	NA	NA
AWF17871.1|224219_225191_-	PTS system mannose-specific EIIAB component	NA	NA	NA	NA	NA
AWF14345.1|225653_227210_+	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AWF14230.1|227213_228812_-	CSS motif domain associated with EAL family protein	NA	NA	NA	NA	NA
AWF18076.1|228942_230241_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWF17349.1|230490_231069_-	NUDIX domain protein	NA	NA	NA	NA	NA
AWF18399.1|231072_232434_-	aminodeoxychorismate synthase, component I	NA	S4VT78	Pandoravirus	33.4	3.4e-41
AWF16690.1|232507_232687_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18234.1|232806_233106_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16923.1|233356_233473_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14518.1|233528_233873_-	endoribonuclease L-PSP family protein	NA	NA	NA	NA	NA
AWF17827.1|234004_235915_+	DEAD_2 family protein	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AWF17359.1|235972_236668_+|tRNA	tRNA threonylcarbamoyl adenosine modification protein YeaZ	tRNA	NA	NA	NA	NA
AWF17569.1|236707_237289_+	outer membrane lipo, Slp family protein	NA	NA	NA	NA	NA
AWF15119.1|237574_239179_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AWF14855.1|239260_240376_+	ribonuclease D	NA	NA	NA	NA	NA
AWF18337.1|240429_241395_-	2Fe-2S iron-sulfur cluster binding domain protein	NA	NA	NA	NA	NA
AWF18199.1|241450_242575_-	ring hydroxylating alpha subunit family protein	NA	NA	NA	NA	NA
AWF15377.1|242606_244217_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	NA	NA	NA	NA
AWF16832.1|244467_245553_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
AWF14054.1|245655_246579_+	HTH-type transcriptional regulator DmlR	NA	NA	NA	NA	NA
AWF18560.1|246705_247344_+	leucine efflux protein	NA	NA	NA	NA	NA
AWF17447.1|247411_247546_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18304.1|247516_247876_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16464.1|247879_248068_+	YoaG domain protein	NA	NA	NA	NA	NA
AWF14197.1|248022_248139_-|transposase	putative transposase IS200 like protein	transposase	NA	NA	NA	NA
AWF16295.1|248295_248448_-|transposase	putative transposase IS200 like protein	transposase	NA	NA	NA	NA
>prophage 3
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	472730	526049	4875835	lysis,holin,head,integrase,protease,terminase,portal,tail,capsid	Enterobacteria_phage(48.84%)	61	468894:468907	481254:481267
468894:468907	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
AWF14825.1|472730_473612_-	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	49.3	4.5e-63
AWF14425.1|473810_474116_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15556.1|474310_474934_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15387.1|474936_475497_-	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWF17233.1|475531_475873_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15553.1|476007_476334_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWF14420.1|476539_477754_+	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWF16520.1|477765_478785_+	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AWF18441.1|478972_480253_-|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
AWF18283.1|480287_480539_-	hypothetical protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWF17761.1|480611_483083_-	exonuclease family protein	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
481254:481267	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
AWF16322.1|483176_483368_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15277.1|483364_483658_-	dicB family protein	NA	NA	NA	NA	NA
AWF14930.1|483953_484106_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17082.1|484092_484308_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16590.1|484337_484466_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17489.1|484467_484704_-	hypothetical protein	NA	M4QQ57	Salicola_phage	51.1	1.4e-06
AWF17618.1|484888_485098_-	putative dNA-binding helix-turn-helix protein	NA	NA	NA	NA	NA
AWF18396.1|485673_486099_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14614.1|486170_487241_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AWF18379.1|487281_487704_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AWF18063.1|488044_490042_+|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
AWF16840.1|490126_491383_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14760.1|491513_492395_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF18461.1|492391_493084_-	chaC-like family protein	NA	NA	NA	NA	NA
AWF14794.1|493095_494295_-	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AWF16689.1|495618_496668_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
AWF14123.1|496788_497055_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	62.2	7.8e-19
AWF17551.1|497051_497873_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
AWF16149.1|498772_498904_+	hypothetical protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AWF15649.1|500077_500245_+	tolA C-terminal family protein	NA	NA	NA	NA	NA
AWF14075.1|500505_500712_+|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	95.6	1.8e-31
AWF14257.1|500711_501209_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AWF18302.1|501205_501667_+|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AWF15302.1|501698_501992_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AWF14386.1|502937_503483_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AWF15573.1|503637_505383_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AWF16336.1|505379_505586_+|head,tail	head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
AWF17123.1|505582_507184_+|portal	phage portal protein, lambda family	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.8e-307
AWF14834.1|507164_508484_+|protease	clp protease family protein	protease	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
AWF16000.1|508493_508826_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWF16490.1|508881_509907_+|capsid	phage major capsid E family protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AWF18225.1|509948_510344_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AWF14106.1|510355_510709_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AWF15707.1|510720_511299_+|tail	prophage minor tail Z family protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AWF15517.1|511295_511691_+|tail	minor tail protein U	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AWF15980.1|511719_512439_+|tail	major tail protein V	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	3.3e-128
AWF17535.1|512454_512877_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AWF15499.1|512858_513293_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AWF17201.1|513285_515847_+|tail	phage tail tape measure protein, lambda family	tail	A0A2R9YJM8	Escherichia_phage	90.8	0.0e+00
AWF14237.1|515843_516173_+|tail	phage minor tail family protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AWF16405.1|516172_516871_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.0e-134
AWF15201.1|517020_517620_+	nlpC/P60 family protein	NA	K7PLW1	Enterobacteria_phage	97.5	1.1e-118
AWF14800.1|517616_518189_+|tail	bacteriophage lambda tail assembly I family protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	3.0e-84
AWF16360.1|518249_521663_+	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AWF16692.1|521732_522332_+	ompA-like transmembrane domain protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
AWF18625.1|522332_522506_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	98.2	4.3e-26
AWF16811.1|522893_523643_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17576.1|523666_523801_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17662.1|523761_525468_+|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	56.9	6.9e-76
AWF14127.1|525467_526049_+|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 4
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	745361	799045	4875835	lysis,coat,tRNA,integrase,terminase,tail	Escherichia_phage(48.94%)	60	766725:766741	804646:804662
AWF17321.1|745361_746321_+	major Facilitator Superfamily protein	NA	S4TR35	Salmonella_phage	88.7	3.6e-146
AWF18633.1|747222_747831_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	93.2	3.8e-101
AWF14563.1|747830_749819_-|tail	phage tail fiber repeat family protein	tail	X2KTY7	Enterobacteria_phage	58.0	6.0e-188
AWF18397.1|749779_749914_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17669.1|749937_750687_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17440.1|751074_751248_+	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	98.2	1.2e-25
AWF15546.1|751248_751848_-	ompA-like transmembrane domain protein	NA	Q687E7	Enterobacteria_phage	98.0	4.4e-110
AWF17733.1|751914_755313_-	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
AWF17305.1|755373_755922_-|tail	bacteriophage lambda tail assembly I family protein	tail	K7PH50	Enterobacteria_phage	91.8	2.5e-88
AWF14435.1|755918_756518_-	nlpC/P60 family protein	NA	C6ZCZ3	Enterobacteria_phage	94.0	2.6e-115
AWF15624.1|756667_757366_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	2.4e-131
AWF17750.1|757365_757662_-|tail	phage minor tail family protein	tail	H6WZM2	Escherichia_phage	52.0	1.8e-24
AWF16893.1|757696_760930_-|tail	phage tail tape measure protein, lambda family	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	2.4e-114
AWF15189.1|761095_761227_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18220.1|761403_761853_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15222.1|761913_762876_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	1.0e-55
AWF17307.1|762902_763256_-	bacteriophage related domain of unknown function family protein	NA	NA	NA	NA	NA
AWF14218.1|763291_763672_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
AWF16510.1|764055_764364_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18342.1|764454_764631_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
AWF15718.1|764673_765813_-|coat	P22 coat family protein	coat	G8C7P7	Escherichia_phage	74.7	7.4e-159
AWF16114.1|765911_766676_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	6.6e-87
766725:766741	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
AWF18243.1|766780_767893_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.5	2.3e-112
AWF16608.1|767876_769283_-	hypothetical protein	NA	G8C7P4	Escherichia_phage	68.5	8.8e-186
AWF14966.1|769285_770542_-|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	2.6e-141
AWF14185.1|770567_771662_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	7.7e-113
AWF17538.1|771665_771875_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17992.1|771852_772785_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
AWF14327.1|772777_773572_-	parB-like nuclease domain protein	NA	U3PCR3	Lactobacillus_phage	40.8	9.7e-49
AWF16604.1|773709_775167_-	trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AWF14253.1|775304_775769_-|lysis	bacteriophage lysis family protein	lysis	A0A0K2FJD0	Enterobacteria_phage	95.4	1.6e-72
AWF15668.1|775765_776263_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
AWF18638.1|776262_776469_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	100.0	3.6e-32
AWF17881.1|777762_778305_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
AWF17730.1|778301_778592_-	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
AWF15925.1|778591_779191_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.9e-105
AWF18147.1|780195_780402_+	tellurite resistance protein B	NA	NA	NA	NA	NA
AWF14886.1|780745_780922_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14125.1|781014_781584_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18152.1|782362_782785_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	6.5e-60
AWF16361.1|782800_783562_-	feoC like transcriptional regulator family protein	NA	A0A0U2SAW4	Escherichia_phage	89.3	3.8e-119
AWF14646.1|783584_784331_-	istB-like ATP binding family protein	NA	V5UQI5	Shigella_phage	79.3	3.4e-112
AWF18122.1|784337_785195_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	74.1	1.5e-74
AWF14150.1|785207_785630_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	97.1	8.2e-71
AWF15295.1|785626_785881_-	putative 8.4 kDa cro protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
AWF15144.1|785960_786380_+	helix-turn-helix family protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AWF18160.1|786670_786805_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16463.1|786815_786968_+	hypothetical protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
AWF16496.1|787378_787600_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.0e-37
AWF16952.1|787593_787770_+	prokaryotic metallothionein family protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	1.1e-24
AWF15659.1|787844_788120_+	putative phage protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
AWF15780.1|788221_790822_+	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	62.8	1.5e-247
AWF14645.1|790814_791624_+	protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
AWF18331.1|791867_792056_+	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	7.2e-27
AWF18213.1|792155_792371_+	putative excisionase	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AWF15052.1|792372_793608_+|integrase	phage integrase family protein	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
AWF17257.1|793659_794595_+|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
AWF16298.1|794723_796097_-	ATP-independent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AWF18354.1|796574_797558_-	zinc transport protein ZntB	NA	NA	NA	NA	NA
AWF18041.1|797812_799045_+	putative diguanylate cyclase YdaM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
804646:804662	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 5
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	1822504	1871328	4875835	holin,transposase,integrase	Staphylococcus_phage(12.5%)	44	1825531:1825547	1872982:1872998
AWF17911.1|1822504_1823485_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF15774.1|1823852_1825739_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
1825531:1825547	attL	GCCAGCGCCTCTGGTTG	NA	NA	NA	NA
AWF16430.1|1825778_1827230_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWF18036.1|1827263_1828433_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
AWF15338.1|1828477_1829368_-	methylisocitrate lyase	NA	NA	NA	NA	NA
AWF14503.1|1829606_1831193_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
AWF15873.1|1831144_1831264_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14628.1|1831290_1831566_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17283.1|1831751_1832384_+	homoserine/Threonine efflux family protein	NA	NA	NA	NA	NA
AWF17334.1|1832825_1832996_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17497.1|1833058_1833874_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14212.1|1834116_1835166_-	hypothetical protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
AWF16316.1|1835252_1836209_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AWF18537.1|1836205_1837177_-	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
AWF15566.1|1837169_1838654_-	heme ABC exporter, ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
AWF16075.1|1838702_1839686_-	putative LACI-type transcriptional regulator	NA	NA	NA	NA	NA
AWF16844.1|1839939_1840380_-	ASCH domain protein	NA	NA	NA	NA	NA
AWF14492.1|1840648_1842031_-	amidohydrolase family protein	NA	NA	NA	NA	NA
AWF17507.1|1842040_1842991_-	amino acid kinase family protein	NA	NA	NA	NA	NA
AWF14596.1|1843133_1844552_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17594.1|1844551_1846099_-	coA-ligase family protein	NA	NA	NA	NA	NA
AWF14965.1|1846088_1846952_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16970.1|1846991_1847597_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
AWF14782.1|1847854_1848352_+	hypothetical protein	NA	NA	NA	NA	NA
AWF18423.1|1848443_1849376_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF14660.1|1849417_1850506_-	cyclic di-GMP phosphodiesterase YahA	NA	NA	NA	NA	NA
AWF15725.1|1851380_1853414_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AWF15913.1|1853542_1854130_+	transcriptional repressor BetI	NA	NA	NA	NA	NA
AWF14879.1|1854143_1855616_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWF16064.1|1855629_1857300_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AWF15312.1|1857748_1857865_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16810.1|1858498_1858618_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWF17608.1|1858779_1858938_+|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	78.7	2.1e-16
AWF18635.1|1859267_1860062_+	bacterial regulatory, luxR family protein	NA	NA	NA	NA	NA
AWF15955.1|1860425_1860977_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15614.1|1861018_1863316_+	outer membrane autotransporter barrel domain protein	NA	NA	NA	NA	NA
AWF15728.1|1863499_1864165_+	G-rich domain on tyrosine kinase family protein	NA	NA	NA	NA	NA
AWF18425.1|1864214_1864337_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14892.1|1864410_1865106_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18656.1|1865098_1866526_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWF14222.1|1866536_1867256_-	cysteine-rich domain protein	NA	NA	NA	NA	NA
AWF14480.1|1867785_1868640_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF14611.1|1868865_1870110_+	pyridine nucleotide-disulfide oxidoreductase family protein	NA	A0A2K5B2C5	Erysipelothrix_phage	47.5	5.2e-105
AWF15169.1|1870119_1871328_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
1872982:1872998	attR	GCCAGCGCCTCTGGTTG	NA	NA	NA	NA
>prophage 6
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	1892409	1904493	4875835	head,transposase,capsid	Enterobacteria_phage(77.78%)	15	NA	NA
AWF18658.1|1892409_1894608_+|head	aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain protein	head	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AWF17829.1|1894617_1895574_+	xdhC Rossmann domain protein	NA	NA	NA	NA	NA
AWF14549.1|1895552_1895963_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF16310.1|1896374_1896521_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15197.1|1896501_1896627_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16042.1|1896581_1898915_-	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AWF14360.1|1898929_1899250_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15403.1|1899385_1899841_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
AWF18292.1|1899833_1900121_-	putative derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AWF17346.1|1900113_1900713_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
AWF18085.1|1900709_1900928_-	helix-turn-helix domain protein	NA	Q7M299	Enterobacteria_phage	100.0	2.6e-36
AWF16627.1|1901527_1902262_+|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
AWF17566.1|1902258_1902759_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
AWF18489.1|1902832_1903405_+	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AWF18236.1|1903989_1904493_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
>prophage 7
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	2371431	2422232	4875835	transposase,integrase,tRNA	uncultured_marine_virus(18.18%)	53	2363278:2363293	2415087:2415102
2363278:2363293	attL	CATCATCTTCTTCTGG	NA	NA	NA	NA
AWF14091.1|2371431_2371731_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF18472.1|2371916_2372093_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14250.1|2372456_2372996_+	H-NS histone family protein	NA	NA	NA	NA	NA
AWF14918.1|2373408_2373540_+	putative membrane protein	NA	NA	NA	NA	NA
AWF14484.1|2374487_2374625_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16121.1|2374694_2375903_+|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWF18494.1|2375912_2376038_-	bacterial regulatory helix-turn-helix, lysR family protein	NA	NA	NA	NA	NA
AWF15970.1|2376268_2377417_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AWF17923.1|2377629_2377755_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17148.1|2378064_2378238_+	putative monooxygenase	NA	NA	NA	NA	NA
AWF15384.1|2378230_2378617_+	ACT domain protein	NA	NA	NA	NA	NA
AWF16677.1|2379993_2381199_+	tetracycline resistance protein, class B	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AWF16017.1|2381311_2381905_-	transposon Tn10 TetC protein	NA	NA	NA	NA	NA
AWF18325.1|2381992_2382409_+	transposon Tn10 TetD protein	NA	NA	NA	NA	NA
AWF15503.1|2382418_2383627_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWF18086.1|2383742_2384210_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14932.1|2384456_2385032_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14066.1|2385103_2385337_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWF17180.1|2385333_2385492_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15895.1|2385579_2386128_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17411.1|2386146_2386491_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	38.4	3.1e-07
AWF17485.1|2386487_2386661_-	proQ activator of osmoprotectant transporter ProP superfamily protein	NA	NA	NA	NA	NA
AWF14316.1|2386756_2386909_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17845.1|2387123_2388209_+	DGQHR domain protein	NA	NA	NA	NA	NA
AWF17020.1|2388205_2389840_+	putative sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
AWF17933.1|2389937_2391830_+	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
AWF14290.1|2391829_2392186_+	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
AWF16629.1|2392244_2392838_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14277.1|2393567_2393864_+	hypothetical protein	NA	NA	NA	NA	NA
AWF17589.1|2393972_2399027_-	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
AWF14890.1|2399007_2400333_-	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
AWF15232.1|2400337_2401987_-	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
AWF15366.1|2402599_2403340_+	ompA-like transmembrane domain protein	NA	NA	NA	NA	NA
AWF17400.1|2403449_2403659_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18376.1|2403744_2405013_+	sulfatase family protein	NA	NA	NA	NA	NA
AWF15796.1|2405127_2405253_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14201.1|2405336_2406602_-|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
AWF17206.1|2407399_2408902_+	AAA-like domain protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
AWF16987.1|2409020_2410103_-	lipopolysaccharide export system permease protein LptG	NA	NA	NA	NA	NA
AWF14050.1|2410102_2411110_-	lipopolysaccharide export system permease protein LptF	NA	NA	NA	NA	NA
AWF16422.1|2411116_2411245_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16288.1|2411469_2412981_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AWF18542.1|2413114_2413558_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWF15975.1|2413557_2416413_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
2415087:2415102	attR	CATCATCTTCTTCTGG	NA	NA	NA	NA
AWF17322.1|2416468_2416687_-	inner membrane YjgN domain protein	NA	NA	NA	NA	NA
AWF16483.1|2416756_2417260_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF17759.1|2417519_2418023_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWF15332.1|2418068_2418485_-	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AWF18001.1|2418646_2419651_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWF17853.1|2419751_2419982_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14121.1|2419968_2421312_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16870.1|2421434_2421671_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17394.1|2421728_2422232_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
>prophage 8
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	2428216	2456101	4875835	transposase,integrase	Escherichia_phage(25.0%)	35	2421713:2421772	2445339:2445957
2421713:2421772	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
AWF15364.1|2428216_2429152_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	47.1	2.8e-71
AWF15958.1|2429426_2429945_+	aminoglycoside N(6')-acetyltransferase type 1	NA	NA	NA	NA	NA
AWF15743.1|2430039_2430672_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AWF16408.1|2430755_2431214_+	dihydrofolate reductase type 1	NA	A0A140HLG8	Bacillus_phage	32.9	2.5e-17
AWF18615.1|2432315_2433155_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AWF14745.1|2433456_2433675_-	hypothetical protein	NA	NA	NA	NA	NA
AWF14517.1|2433957_2434722_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	2.7e-32
AWF14585.1|2434729_2436244_-	winged helix-turn-helix DNA-binding family protein	NA	A0A2L1IVA1	Escherichia_phage	24.4	1.2e-15
AWF17645.1|2436435_2437071_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF18200.1|2437303_2437681_+|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	44.0	1.1e-21
AWF17467.1|2437803_2437917_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF15234.1|2437966_2438827_-	bacterial TniB family protein	NA	NA	NA	NA	NA
AWF17593.1|2438829_2440242_-|transposase	mu transposase, C-terminal family protein	transposase	NA	NA	NA	NA
AWF17385.1|2440553_2440793_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16812.1|2440747_2441251_-	EAL domain protein	NA	NA	NA	NA	NA
AWF14400.1|2441286_2441523_-	merE family protein	NA	NA	NA	NA	NA
AWF17516.1|2441519_2441882_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWF14754.1|2441899_2443522_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.4e-39
AWF14450.1|2443645_2444068_-	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWF18555.1|2444103_2444379_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AWF18497.1|2444392_2444743_-	merT mercuric transport family protein	NA	NA	NA	NA	NA
AWF17600.1|2444814_2445249_+	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF15968.1|2445354_2445858_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF16634.1|2445989_2448995_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
2445339:2445957	attR	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
AWF16601.1|2449320_2449716_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	99.2	1.2e-63
AWF14477.1|2449898_2450759_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWF14453.1|2451035_2451245_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17555.1|2451389_2451983_-	bacterial regulatory, tetR family protein	NA	NA	NA	NA	NA
AWF17508.1|2452053_2452767_+	enoyl-(Acyl carrier) reductase family protein	NA	NA	NA	NA	NA
AWF18245.1|2452897_2453293_+	endoribonuclease L-PSP family protein	NA	NA	NA	NA	NA
AWF15084.1|2453397_2453535_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15044.1|2453711_2454647_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AWF15162.1|2454659_2455121_+	aspartate carbamoyltransferase, regulatory subunit	NA	NA	NA	NA	NA
AWF16129.1|2455193_2455580_+	enamine/imine deaminase	NA	NA	NA	NA	NA
AWF16748.1|2455645_2456101_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 9
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	3931011	4000555	4875835	head,transposase,integrase,tRNA	Escherichia_phage(23.81%)	60	3969090:3969149	3992723:3993340
AWF17137.1|3931011_3932529_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AWF16718.1|3932571_3933120_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AWF17720.1|3933242_3933368_-	putative membrane protein	NA	NA	NA	NA	NA
AWF15560.1|3933369_3934581_-	putative purine permease YgfU	NA	Q9KX94	Enterobacteria_phage	27.3	1.7e-23
AWF17229.1|3935238_3937173_+	glutamate synthase, small subunit domain protein	NA	NA	NA	NA	NA
AWF17118.1|3937172_3937661_+	4Fe-4S dicluster domain protein	NA	NA	NA	NA	NA
AWF15631.1|3937696_3939064_-	permease family protein	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
AWF18028.1|3939099_3940416_-	guanine deaminase	NA	NA	NA	NA	NA
AWF15679.1|3940433_3941834_-	uracil-xanthine permease family protein	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
AWF18083.1|3941998_3944869_-	[2Fe-2S] binding domain protein	NA	NA	NA	NA	NA
AWF14396.1|3944865_3945645_-	FAD binding domain in molybdopterin dehydrogenase family protein	NA	NA	NA	NA	NA
AWF15878.1|3945695_3947024_-	protein SsnA	NA	NA	NA	NA	NA
AWF17391.1|3947026_3950125_-	putative selenate reductase, YgfK subunit	NA	NA	NA	NA	NA
AWF17562.1|3950446_3951025_-	molybdenum hydroxylase accessory protein, YgfJ family	NA	NA	NA	NA	NA
AWF15811.1|3951418_3951898_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
AWF14370.1|3951945_3953571_+	xdhC Rossmann domain protein	NA	NA	NA	NA	NA
AWF18499.1|3953611_3954544_-	carbamate kinase	NA	NA	NA	NA	NA
AWF16884.1|3954591_3955977_-	dihydropyrimidinase	NA	NA	NA	NA	NA
AWF17451.1|3956029_3957241_-	peptidase M20/M25/M40 family protein	NA	NA	NA	NA	NA
AWF18237.1|3957298_3958495_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
AWF16354.1|3958552_3959740_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18588.1|3960248_3961997_+	bacterial regulatory, Fis family protein	NA	NA	NA	NA	NA
AWF18031.1|3962036_3962516_-	[2Fe-2S] binding domain protein	NA	NA	NA	NA	NA
AWF16934.1|3962512_3963391_-	FAD binding domain in molybdopterin dehydrogenase family protein	NA	NA	NA	NA	NA
AWF15723.1|3963401_3965660_-|head	aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain protein	head	NA	NA	NA	NA
AWF16846.1|3966113_3966869_+	peptidase M23 family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
AWF17665.1|3967254_3968865_+	glycosyl hydrolases 15 family protein	NA	NA	NA	NA	NA
3969090:3969149	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AWF15015.1|3969104_3969608_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF16913.1|3970080_3970740_+	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AWF18383.1|3970940_3971318_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AWF17241.1|3971384_3974351_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AWF17315.1|3974353_3974914_-	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWF17397.1|3975039_3975390_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18310.1|3975592_3976528_-|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	47.1	2.8e-71
AWF17967.1|3976802_3977321_+	aminoglycoside N(6')-acetyltransferase type 1	NA	NA	NA	NA	NA
AWF17502.1|3977415_3978048_+	chloramphenicol acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AWF16642.1|3978131_3978590_+	dihydrofolate reductase type 1	NA	A0A140HLG8	Bacillus_phage	32.9	2.5e-17
AWF16522.1|3978549_3978741_-	hypothetical protein	NA	NA	NA	NA	NA
AWF16455.1|3978999_3979185_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16106.1|3979692_3980532_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AWF15186.1|3981334_3982099_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	2.7e-32
AWF15497.1|3982106_3983621_-	winged helix-turn-helix DNA-binding family protein	NA	A0A2L1IVA1	Escherichia_phage	24.4	1.2e-15
AWF14306.1|3983812_3985297_+	HTH-like domain protein	NA	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
AWF17010.1|3985347_3986208_-	bacterial TniB family protein	NA	NA	NA	NA	NA
AWF17138.1|3986210_3987623_-|transposase	mu transposase, C-terminal family protein	transposase	NA	NA	NA	NA
AWF17752.1|3987964_3988633_-	EAL domain protein	NA	NA	NA	NA	NA
AWF16051.1|3988668_3988905_-	merE family protein	NA	NA	NA	NA	NA
AWF18408.1|3988901_3989264_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWF18010.1|3989281_3990904_-	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.4e-39
AWF14752.1|3991027_3991450_-	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWF17778.1|3991485_3991761_-	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AWF18546.1|3991774_3992125_-	merT mercuric transport family protein	NA	NA	NA	NA	NA
AWF18431.1|3992196_3992631_+	hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWF14363.1|3992737_3993241_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF14119.1|3993372_3996378_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
3992723:3993340	attR	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACGTATCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAATGGCGGAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCGGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAG	NA	NA	NA	NA
AWF18481.1|3996703_3997099_+	transposon Tn3 resolvase	NA	Q1MVP4	Enterobacteria_phage	99.2	1.2e-63
AWF18636.1|3997281_3998142_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWF15133.1|3998589_3998745_+	putative type III secretion protein EprI	NA	NA	NA	NA	NA
AWF17057.1|3998972_3999137_+	putative type III secretion protein EprJ	NA	NA	NA	NA	NA
AWF18434.1|3999346_4000555_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 10
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4137370	4144510	4875835		Escherichia_phage(83.33%)	6	NA	NA
AWF18668.1|4137370_4138009_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWF14182.1|4138005_4139268_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
AWF16401.1|4139264_4140173_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AWF17337.1|4140368_4141136_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AWF16078.1|4141186_4141843_-	serine/threonine-protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AWF14891.1|4141948_4144510_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 11
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4214541	4278752	4875835	lysis,tRNA,head,integrase,terminase,portal,transposase,tail	Enterobacteria_phage(52.83%)	73	4221945:4222004	4249244:4250574
AWF17807.1|4214541_4214841_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF17596.1|4214837_4215704_+	DDE domain protein	NA	A0A0P0I4A4	Acinetobacter_phage	40.6	1.8e-51
AWF17182.1|4215855_4217574_+	histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
AWF15646.1|4217575_4219174_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	98.3	4.3e-306
AWF14558.1|4219852_4221082_-|integrase	phage integrase family protein	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
4221945:4222004	attL	ACTGATGAATCCCCTAATGATTTTTATCAAAATCATTAAGTTAAGGTAGATACACATCTT	NA	NA	NA	NA
AWF15191.1|4222052_4223261_+|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWF17044.1|4223468_4224644_-|integrase	phage integrase family protein	integrase	I6PDJ1	Cronobacter_phage	67.5	3.9e-147
AWF15714.1|4224604_4224811_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
AWF18224.1|4224870_4225029_-	hypothetical protein	NA	A0A0H4J3C0	Shigella_phage	51.9	3.4e-06
AWF17355.1|4225082_4225424_-	putative phage protein	NA	K7PH61	Enterobacteria_phage	97.3	7.3e-62
AWF14289.1|4225435_4225972_-	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	97.8	2.0e-98
AWF16981.1|4227497_4227758_-	peptidase S24-like family protein	NA	U5P0T5	Shigella_phage	100.0	5.1e-47
AWF16919.1|4227828_4227969_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16565.1|4228262_4228463_+	hypothetical protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
AWF16307.1|4228506_4229064_+	putative dNA-binding transcriptional regulator	NA	S5FXP0	Shigella_phage	95.7	2.6e-96
AWF17941.1|4229239_4229419_+	hypothetical protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AWF16609.1|4229408_4230350_+	helix-turn-helix domain protein	NA	U5P0A0	Shigella_phage	93.3	7.5e-141
AWF15373.1|4230713_4230848_+	hypothetical protein	NA	NA	NA	NA	NA
AWF14571.1|4230840_4231494_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
AWF18267.1|4231490_4231817_+	lexA DNA binding domain protein	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
AWF16312.1|4231813_4232203_+	endodeoxyribonuclease RusA family protein	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
AWF15602.1|4232222_4233020_+	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
AWF16568.1|4233099_4234017_+	hypothetical protein	NA	A5LH76	Enterobacteria_phage	99.3	3.3e-181
AWF14961.1|4234034_4234400_+	phage antitermination Q family protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
AWF15159.1|4234484_4234685_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18361.1|4235019_4235133_+	hypothetical protein	NA	NA	NA	NA	NA
AWF15314.1|4235201_4235405_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
AWF18511.1|4235555_4236608_+	DNA methylase family protein	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
AWF15758.1|4236683_4236890_+|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	100.0	3.6e-32
AWF15607.1|4236889_4237387_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
AWF15426.1|4237383_4237851_+|lysis	bacteriophage lysis family protein	lysis	A0A291AWW3	Escherichia_phage	99.4	2.9e-77
AWF15827.1|4237838_4237991_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
AWF17736.1|4238666_4239161_+	hypothetical protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AWF18365.1|4239160_4241263_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
AWF18312.1|4241259_4241472_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AWF14746.1|4241471_4242980_+|portal	phage portal protein, lambda family	portal	A5LH29	Enterobacteria_phage	100.0	3.1e-290
AWF18524.1|4242993_4244952_+|head	mu-like prophage major head subunit gpT family protein	head	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AWF15940.1|4245038_4245362_+	hypothetical protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
AWF17445.1|4245354_4245630_+	ATP-binding sugar transporter from pro-phage family protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AWF18287.1|4245641_4246220_+|tail	prophage minor tail Z family protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
AWF15478.1|4246216_4246618_+|tail	phage minor tail U family protein	tail	A5LH34	Enterobacteria_phage	98.5	7.0e-72
AWF15993.1|4246628_4247372_+	bacterial Ig-like domain family protein	NA	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
AWF16428.1|4247432_4247819_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
AWF16292.1|4247839_4247977_+|tail	minor tail T family protein	tail	A5LH37	Enterobacteria_phage	100.0	6.8e-19
AWF15611.1|4247986_4249195_-|transposase	transposase DDE domain protein	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AWF16446.1|4249342_4249495_+|tail	minor tail T family protein	tail	A5LH37	Enterobacteria_phage	98.0	3.6e-21
AWF14781.1|4249466_4252523_+|tail	phage tail tape measure protein, lambda family	tail	A5LH38	Enterobacteria_phage	97.8	0.0e+00
4249244:4250574	attR	AAGATGTGTATCTACCTTAACTTAATGATTTTGATAAAAATCATTAGGGGATTCATCAGTGCGCAGTTTGCCTCGCTGAAGGCATTGATCGTGAGAATGGTGTCCGGAAGCAGTGATGCTGCGGTGGCTGATTTCAGCCTTTTACCGGAAGAGAACGGGATACCGGAGCGAACGGACGAAGAACTGATGCATCTTGGGGAAGGTATTTCCGGAGGTGTGCGTTATGGACCAGATAGCCAACCTGGTCATTGATTTGGGGATTGATGCGGCAGAGTTTAAAAATGAAATTCCCCGTATCAAAAACCTTCTGAATGGTGCCGCCTGCGATGCAGAACGGTCGTCTGCCCGTATGCAGCGTTTTATGGAGCGTCAGACTCAGGCCGCCCGGCAGACAACGCAGGCGGCTTCTTCGGCTGCAACAGCCGCATCCGTCCATGCGCAGACGGTGGAGAAGAACGCACAGGCTCATGAACGCATGGCCCGCGAGGTGGAGAAAACCCGCCAGCGCATGGAGGCGCTGAGCCAGAAAATGCGCGAGGAACAGGCGCAGGCCATGGCTCTGGCGGAGGCTCAGGATAAAGCGGCTGCTGCGTTTTATCGTCAGATTGACAGTGTGAAACAGGCCAGTGCGGGGCTGCAGGAATTACAGCGTATTCAGCAGCAGATCCGACAGGCCAGAAACAGTGGCGGGATTGGTCAGCAGGATTATCTGGCGCTGATTTCTGAGGTTACGGCGAAAACCCGTGTTCTTACACAGGCTGAGGAAGAGGCTACCCGACAGAAAGTGGCGTTTATCCGTCAGCTTAAAGAGCAGGCAACCCGCCAGAATCTTTCTTCTTCTGAGTTGCTTCGTGCTAAGGCTGCCCAGCTGGGGGTAAGCAGTGCTGCAGAAGTGTATATCCGCAAAATGGAGCAGGCAGGAAAAGCCACGCATTCGCTGGGGCTGAAAAGTGCAGCGGCCCGCCAGGAGATAGGCGTTCTGATAGGTGAACTGGCTCGCGGCAATTTAGGTGCGCTGAGGGGATCCGGGATAACGCTGGCTAACCGTGCCGGATGGATAGACACACTGATGTCACCGAAAGGCATGATGCTGGGCGGGGTTATTGGCGGTATTGCCGCGGCCGTCTATGGTCTGGGTAAAGCCTGGTATGACGGTCAGAAGGAGGGGGAAGAATTTAACCGCCAGTTGTCGCTGACGGGGCATTATGCCGGAGTCACTGCCGGGCAGCTGTGGACGCTTAGTCGTGCTATTTCCGGGAATGGTATCACGCAAAATGCTGCAGCCGGTGCGCTGGCTCAGGTGGTGGGGAGTGGTGCATTTCGTGGAAACG	NA	NA	NA	NA
AWF15445.1|4252522_4252852_+|tail	phage minor tail family protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
AWF18002.1|4252861_4253560_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
AWF15598.1|4253709_4254309_+	nlpC/P60 family protein	NA	A0A291AWX4	Escherichia_phage	97.0	9.7e-118
AWF15315.1|4254389_4254854_+	putative gifsy-1 prophage VtiI	NA	K7PH50	Enterobacteria_phage	98.1	3.2e-76
AWF17195.1|4254914_4257590_+	hypothetical protein	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
AWF17909.1|4257562_4258312_+	hypothetical protein	NA	Q687E8	Enterobacteria_phage	91.2	2.5e-123
AWF16589.1|4258378_4258978_+	ompA-like transmembrane domain protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
AWF16243.1|4258978_4259152_-	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	100.0	1.9e-26
AWF18072.1|4259539_4260289_-	hypothetical protein	NA	NA	NA	NA	NA
AWF18574.1|4260407_4262069_+|tail	phage tail fiber repeat family protein	tail	U5N099	Enterobacteria_phage	56.9	5.2e-76
AWF15397.1|4262068_4262653_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	1.9e-105
AWF17192.1|4263207_4265196_+	description family protein	NA	NA	NA	NA	NA
AWF14535.1|4266280_4267201_-	hypothetical protein	NA	NA	NA	NA	NA
AWF17081.1|4267945_4268428_-	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AWF18222.1|4268598_4269036_+	ribosome association toxin RatA	NA	NA	NA	NA	NA
AWF17850.1|4269025_4269316_+	hypothetical protein	NA	NA	NA	NA	NA
AWF16375.1|4269377_4269719_-	smpA / OmlA family protein	NA	NA	NA	NA	NA
AWF16305.1|4269867_4271529_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWF18553.1|4271614_4272421_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWF16863.1|4272615_4273209_+	protein GrpE	NA	NA	NA	NA	NA
AWF14255.1|4273263_4274505_-	hypothetical protein	NA	NA	NA	NA	NA
AWF15789.1|4274570_4275362_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWF18433.1|4275528_4276890_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWF14231.1|4277138_4277387_+	ribosomal protein S16	NA	NA	NA	NA	NA
AWF15518.1|4277405_4277954_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AWF16102.1|4277984_4278752_+|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 12
CP029111	Escherichia coli strain AR436 chromosome, complete genome	4875835	4772952	4782394	4875835		Enterobacteria_phage(85.71%)	9	NA	NA
AWF18378.1|4772952_4773879_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWF18030.1|4773883_4774615_+	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWF16805.1|4774762_4775494_-	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWF14984.1|4775715_4777401_+	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWF15550.1|4777397_4778117_+	response regulator	NA	NA	NA	NA	NA
AWF15217.1|4778163_4778634_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWF18221.1|4778674_4779136_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWF18589.1|4779260_4781261_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AWF14927.1|4781257_4782394_-	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
