The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	2576	27210	4688906	terminase,lysis,integrase	Enterobacteria_phage(46.15%)	37	1922:1936	27284:27298
1922:1936	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
AWF12351.1|2576_3908_+	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AWF09878.1|5213_5786_-	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	95.8	1.2e-96
AWF12007.1|5866_6427_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AWF13179.1|6566_6710_-	hypothetical protein	NA	NA	NA	NA	NA
AWF12426.1|6875_7049_+	hypothetical protein	NA	A0A0K2FIR8	Escherichia_phage	94.1	2.5e-10
AWF10031.1|7867_8020_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AWF13385.1|8007_8475_-|lysis	bacteriophage lysis family protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AWF13221.1|8471_8969_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AWF11424.1|8968_9175_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	98.5	3.6e-32
AWF13766.1|9371_9542_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF12794.1|9967_10102_-	putative araC-type regulatory protein from bacteriophage origin	NA	NA	NA	NA	NA
AWF13339.1|10453_11413_-	hypothetical protein	NA	NA	NA	NA	NA
AWF10067.1|11605_12130_+	outer membrane lipoprotein blc	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AWF09935.1|12285_12495_-	phage antitermination Q family protein	NA	A0A088CD47	Shigella_phage	79.7	8.5e-21
AWF12418.1|12606_12729_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12032.1|12748_12886_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.3	9.2e-08
AWF12874.1|12885_13248_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
AWF12561.1|13244_13535_-	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AWF10131.1|13697_13997_-	putative phage protein	NA	I6PD71	Cronobacter_phage	68.7	2.3e-35
AWF11390.1|14444_14558_-	hypothetical protein	NA	NA	NA	NA	NA
AWF11753.1|14792_15353_-	putative uDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AWF12254.1|15837_16131_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AWF13759.1|16127_16829_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AWF12518.1|16825_17755_-	phage replication protein O, N-terminal domain	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
AWF11203.1|17841_18381_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AWF09751.1|18719_19475_+	helix-turn-helix family protein	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AWF11471.1|19597_20347_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12131.1|20343_21171_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13677.1|21679_21886_+	putative phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AWF12281.1|21961_22258_+	host-nuclease inhibitor protein gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AWF13040.1|22263_23049_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AWF13056.1|23045_23726_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AWF11999.1|23919_24069_+	hypothetical protein	NA	A0A0P0ZC49	Stx2-converting_phage	98.0	1.7e-18
AWF09929.1|24145_24361_+	putative ybl17	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
AWF11407.1|24891_25041_-	putative transmembrane protein	NA	NA	NA	NA	NA
AWF11885.1|25721_25850_-	hypothetical protein	NA	NA	NA	NA	NA
AWF11275.1|26139_27210_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
27284:27298	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 2
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	475107	541180	4688906	integrase,protease,portal,head,lysis,holin	Shigella_phage(30.0%)	62	511805:511864	537265:537324
AWF11541.1|475107_477141_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AWF12902.1|477269_477857_+	transcriptional repressor BetI	NA	NA	NA	NA	NA
AWF09690.1|477879_479343_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWF09628.1|479356_481027_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AWF09641.1|481239_481908_+	G-rich domain on tyrosine kinase family protein	NA	NA	NA	NA	NA
AWF10275.1|482150_482846_-	hypothetical protein	NA	NA	NA	NA	NA
AWF11755.1|482838_484266_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AWF10593.1|484276_484996_-	cysteine-rich domain protein	NA	NA	NA	NA	NA
AWF11606.1|485523_486378_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF12099.1|486603_487929_+	UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain protein	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AWF09615.1|488037_488274_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11322.1|488285_488879_+	inner membrane protein YkgB	NA	NA	NA	NA	NA
AWF09500.1|489685_490321_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF09555.1|490277_490436_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09800.1|490460_494717_-	ytkA-like family protein	NA	NA	NA	NA	NA
AWF11893.1|495750_495864_-	hypothetical protein	NA	NA	NA	NA	NA
AWF12203.1|496296_496560_+	ribosomal protein L31	NA	NA	NA	NA	NA
AWF11157.1|496559_496700_+	ribosomal protein L36	NA	NA	NA	NA	NA
AWF13800.1|497784_498327_+	HTH-type transcriptional regulator MatA	NA	NA	NA	NA	NA
AWF11473.1|498401_498989_+	fimbrillin MatB	NA	NA	NA	NA	NA
AWF13255.1|499046_499715_+	hypothetical protein	NA	NA	NA	NA	NA
AWF10762.1|499740_502266_+	hypothetical protein	NA	NA	NA	NA	NA
AWF10380.1|502327_503899_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11994.1|503921_504578_+	gram-negative pili assembly chaperone, N-terminal domain protein	NA	NA	NA	NA	NA
AWF09434.1|504921_505035_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12250.1|505467_506082_-	inner membrane protein YagU	NA	NA	NA	NA	NA
AWF09683.1|506194_506320_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11264.1|506499_507189_+	tat (twin-arginine translocation) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AWF10810.1|507185_508142_+	FAD binding domain in molybdopterin dehydrogenase family protein	NA	NA	NA	NA	NA
AWF12572.1|508138_510337_+|head	aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain protein	head	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
AWF11337.1|510346_511303_+	xdhC Rossmann domain protein	NA	NA	NA	NA	NA
AWF11013.1|511281_511692_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF11126.1|511654_511804_+	hypothetical protein	NA	NA	NA	NA	NA
511805:511864	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWF13815.1|512374_513154_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09511.1|514295_515570_-	AAA domain protein	NA	NA	NA	NA	NA
AWF11400.1|515960_516533_-	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	84.7	9.7e-83
AWF11167.1|518733_519222_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12327.1|519609_519783_+	hypothetical protein	NA	Q6H9T0	Enterobacteria_phage	96.5	2.8e-25
AWF12762.1|519783_520227_-	outer membrane beta-barrel domain protein	NA	A5LH44	Enterobacteria_phage	95.9	1.7e-79
AWF12260.1|520289_521078_-|protease	clp protease family protein	protease	A0A291AWT6	Escherichia_phage	99.2	1.8e-140
AWF12775.1|521091_522600_-|portal	phage portal protein, lambda family	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
AWF12989.1|522626_523124_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
AWF10648.1|523123_523330_-|lysis	lysis S family protein	lysis	A5LH82	Enterobacteria_phage	100.0	3.6e-32
AWF13033.1|523406_524459_-	DNA methylase family protein	NA	A5LH81	Enterobacteria_phage	99.7	3.6e-208
AWF11041.1|524608_524803_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
AWF12171.1|525051_526212_+	hypothetical protein	NA	A0A0R6PJX3	Moraxella_phage	37.0	6.4e-57
AWF13693.1|526872_527913_-	DNA (cytosine-5-)-methyltransferase family protein	NA	A0A0R6PG08	Moraxella_phage	50.9	8.7e-98
AWF11251.1|528363_529269_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	99.0	1.7e-177
AWF12271.1|529360_529699_-	hypothetical protein	NA	A0A291AWV6	Escherichia_phage	97.0	4.9e-50
AWF13679.1|529710_530652_-	helix-turn-helix domain protein	NA	U5P0A0	Shigella_phage	92.7	1.1e-139
AWF12681.1|530996_531554_-	putative dNA-binding transcriptional regulator	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
AWF11065.1|531546_531786_-	helix-turn-helix domain protein	NA	K7PJQ8	Enterobacteria_phage	98.7	1.7e-36
AWF10443.1|531904_532597_+	helix-turn-helix family protein	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
AWF10938.1|533299_533662_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWF12956.1|533727_534552_+	hypothetical protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
AWF13540.1|534679_535216_+	hypothetical protein	NA	S5MW55	Escherichia_phage	98.9	1.4e-99
AWF13158.1|535272_535569_+	putative phage protein	NA	U5P092	Shigella_phage	98.0	1.6e-52
AWF09883.1|535568_535874_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	1.5e-50
AWF10395.1|536100_537264_+|integrase	phage integrase family protein	integrase	U5P434	Shigella_phage	100.0	2.4e-229
AWF13059.1|537468_538722_-	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
537265:537324	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWF10120.1|538733_539837_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AWF10941.1|540124_541180_+	outer membrane pore protein E	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 3
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	841683	858727	4688906	tail,integrase	Escherichia_phage(38.46%)	13	847264:847278	860708:860722
AWF09768.1|841683_845385_-	carboxypeptidase regulatory-like domain protein	NA	A0A2D1UII2	Escherichia_phage	85.5	0.0e+00
AWF12945.1|845449_846049_-	outer membrane beta-barrel domain protein	NA	H6WZM8	Escherichia_phage	96.5	1.6e-107
AWF13412.1|846117_849597_-	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
847264:847278	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
AWF10920.1|849657_850200_-|tail	bacteriophage lambda tail assembly I family protein	tail	A0A291AWV5	Escherichia_phage	83.5	2.9e-76
AWF11599.1|850196_850832_-	nlpC/P60 family protein	NA	A0A0K2FIQ5	Escherichia_phage	98.6	2.4e-127
AWF10669.1|850945_851374_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.3	3.1e-78
AWF13627.1|851571_851934_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AWF09556.1|851999_852824_+	hypothetical protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
AWF13667.1|852951_853488_+	hypothetical protein	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
AWF13912.1|853499_853841_+	putative phage protein	NA	K7PH61	Enterobacteria_phage	97.3	1.4e-60
AWF12784.1|853840_854461_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	89.8	9.1e-111
AWF11823.1|854788_857395_-	HNH endonuclease family protein	NA	A0A1S6KZY3	Salmonella_phage	41.1	1.7e-20
AWF10007.1|857503_858727_-|integrase	phage integrase family protein	integrase	A5LH57	Enterobacteria_phage	98.3	1.8e-235
860708:860722	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 4
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	923018	936875	4688906	transposase,integrase	Stx2-converting_phage(37.5%)	19	923461:923474	928378:928391
AWF13690.1|923018_923615_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
923461:923474	attL	TCCTGATAATGCAG	NA	NA	NA	NA
AWF13798.1|924092_924695_-|integrase	phage integrase family protein	integrase	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AWF09453.1|926441_926867_+	putative N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AWF10861.1|926886_927993_+	mutarotase, YjhT family protein	NA	NA	NA	NA	NA
AWF11186.1|928240_929038_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	54.4	5.0e-77
928378:928391	attR	TCCTGATAATGCAG	NA	NA	NA	NA
AWF10722.1|929045_929696_-	HNH endonuclease family protein	NA	NA	NA	NA	NA
AWF11086.1|929747_929870_-	hypothetical protein	NA	NA	NA	NA	NA
AWF13169.1|930041_930260_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12017.1|930639_930903_-	hypothetical protein	NA	A0A1S6UA20	Serratia_phage	50.6	8.8e-15
AWF10723.1|930928_931162_-|transposase	putative transposase	transposase	Q9ZXG3	Shigella_phage	100.0	6.8e-35
AWF09803.1|931119_931485_-|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AWF11189.1|931946_932087_+	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
AWF13925.1|932430_932568_-	putative membrane protein	NA	NA	NA	NA	NA
AWF10350.1|932802_933372_+	hypothetical protein	NA	NA	NA	NA	NA
AWF10868.1|933537_933939_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11965.1|933926_934361_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12797.1|934539_934668_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11393.1|935092_935440_+|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AWF13242.1|935489_936875_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
>prophage 5
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	948992	955551	4688906		uncultured_Caudovirales_phage(16.67%)	7	NA	NA
AWF10664.1|948992_949949_+	fe(3+) dicitrate transport system permease protein FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AWF13395.1|949949_950717_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AWF13088.1|951274_951418_-	hypothetical protein	NA	NA	NA	NA	NA
AWF12081.1|951853_952453_-	HTH-like domain protein	NA	S5FNT8	Shigella_phage	97.2	1.2e-99
AWF11088.1|952583_953735_+	homeo-like domain protein	NA	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AWF11073.1|954297_954678_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	60.8	1.1e-37
AWF10565.1|954726_955551_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 6
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	2666187	2679370	4688906		Escherichia_phage(50.0%)	12	NA	NA
AWF10980.1|2666187_2666949_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AWF11381.1|2666942_2667569_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AWF13856.1|2667708_2668848_+	peptidase M23 family protein	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AWF12419.1|2668910_2669903_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AWF13743.1|2669996_2671361_-	inner membrane permease YgbN	NA	NA	NA	NA	NA
AWF13134.1|2671449_2672226_-	putative hydroxypyruvate isomerase YgbM	NA	NA	NA	NA	NA
AWF10575.1|2672230_2672827_-	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	74.6	2.3e-79
AWF09942.1|2672865_2674128_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWF13298.1|2674124_2674979_-	NAD binding domain of 6-phosphogluconate dehydrogenase family protein	NA	A0A077SLF7	Escherichia_phage	77.4	4.2e-114
AWF13896.1|2675264_2675996_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	56.2	2.8e-66
AWF13565.1|2676046_2676703_-	serine/threonine-protein phosphatase 2	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AWF11574.1|2676808_2679370_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 7
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	2752251	2761585	4688906	transposase	Shigella_phage(33.33%)	7	NA	NA
AWF09713.1|2752251_2752617_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AWF10922.1|2752574_2753480_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
AWF10069.1|2753450_2754320_-	ankyrin repeats family protein	NA	NA	NA	NA	NA
AWF12508.1|2755126_2755504_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	97.6	3.5e-65
AWF13101.1|2755549_2758789_-	type I site-specific deoxyribonuclease, HsdR family protein	NA	A0A220A398	Liberibacter_phage	28.5	3.7e-62
AWF09553.1|2758847_2760041_-	type I restriction modification DNA specificity domain protein	NA	A0A2H4PQP5	Staphylococcus_phage	34.7	5.4e-19
AWF09813.1|2760037_2761585_-	methyltransferase domain protein	NA	A0A2H4PQP4	Staphylococcus_phage	27.6	4.2e-48
>prophage 8
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3288397	3297839	4688906		Enterobacteria_phage(87.5%)	10	NA	NA
AWF10953.1|3288397_3289324_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AWF13311.1|3289328_3290060_+	putative osmoprotectant uptake system permease protein YehW	NA	NA	NA	NA	NA
AWF11787.1|3290207_3290939_-	merR regulatory family protein	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AWF12091.1|3291160_3292846_+	putative sensor-like histidine kinase YehU	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AWF10215.1|3292842_3293562_+	response regulator	NA	NA	NA	NA	NA
AWF12195.1|3293608_3294079_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWF10315.1|3294119_3294581_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWF11097.1|3294705_3295368_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	94.6	1.0e-112
AWF13462.1|3295377_3296706_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.8	2.8e-250
AWF10635.1|3296702_3297839_-	VWA domain containing CoxE-like family protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 9
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3382967	3424325	4688906	transposase,integrase	Shigella_phage(26.67%)	42	3410246:3410259	3424829:3424842
AWF12208.1|3382967_3383906_+	glycosyltransferase sugar-binding region containing DXD motif family protein	NA	A0A0U3TLF2	Cucumis_melo_alphaendornavirus	32.7	2.7e-05
AWF12301.1|3383907_3385191_+	polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
AWF11227.1|3385347_3386715_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.9e-36
AWF12689.1|3386905_3388072_+	nucleotide sugar dehydrogenase family protein	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AWF10352.1|3388482_3388986_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	1.1e-93
AWF10063.1|3389485_3389632_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13373.1|3389911_3390673_+	nucleotidyl transferase family protein	NA	A0A1V0SH58	Hokovirus	32.5	4.8e-21
AWF11810.1|3390657_3391326_+	nucleotidyl transferase family protein	NA	A0A1V0SH58	Hokovirus	30.6	3.3e-26
AWF10975.1|3391349_3392726_+	phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III family protein	NA	A0A127AWJ1	Bacillus_phage	26.6	1.1e-31
AWF13058.1|3392727_3393522_+	ABC-2 type transporter family protein	NA	NA	NA	NA	NA
AWF11907.1|3393521_3394736_+	ABC transporter family protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	4.1e-14
AWF13400.1|3394735_3396013_+	methionine biosynthesis MetW family protein	NA	NA	NA	NA	NA
AWF12331.1|3396015_3399657_+	glycosyltransferase Family 4 family protein	NA	A0A218MKE2	uncultured_virus	29.6	1.5e-22
AWF09977.1|3399720_3400866_+	glycosyl transferases group 1 family protein	NA	NA	NA	NA	NA
AWF11811.1|3400875_3401991_+	glycosyltransferase Family 4 family protein	NA	NA	NA	NA	NA
AWF09936.1|3402029_3402638_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
AWF09685.1|3402631_3403408_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
AWF10210.1|3403389_3404127_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AWF13338.1|3404126_3404717_-	imidazole glycerol phosphate synthase, glutamine amidotransferase subunit	NA	NA	NA	NA	NA
AWF12949.1|3404716_3405784_-	histidine biosynthesis bifunctional protein HisB	NA	NA	NA	NA	NA
AWF11392.1|3405783_3406854_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
AWF13588.1|3406850_3408155_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
AWF11600.1|3408160_3409060_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
AWF12959.1|3409423_3409552_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11366.1|3409681_3410506_+	NADH(P)-binding family protein	NA	NA	NA	NA	NA
3410246:3410259	attL	CATTTAGAAGATGT	NA	NA	NA	NA
AWF11242.1|3410551_3411481_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF11439.1|3411611_3411749_-	hypothetical protein	NA	NA	NA	NA	NA
AWF11212.1|3411747_3413106_+	low-affinity putrescine importer PlaP	NA	NA	NA	NA	NA
AWF11989.1|3413175_3413679_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	1.1e-93
AWF11061.1|3414140_3414884_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13402.1|3414897_3415125_+	sirA-like family protein	NA	NA	NA	NA	NA
AWF11268.1|3415167_3416595_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AWF13461.1|3416803_3417970_+	D-alanyl-D-alanine carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	2.1e-225
AWF09873.1|3418088_3418562_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
AWF10491.1|3418760_3419819_+	inner membrane protein YeeA	NA	NA	NA	NA	NA
AWF13905.1|3419783_3419900_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09594.1|3419990_3420320_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13330.1|3421056_3421404_-|transposase	transposase IS116/IS110/IS902 family protein	transposase	NA	NA	NA	NA
AWF12976.1|3421387_3421528_-	hypothetical protein	NA	NA	NA	NA	NA
AWF13116.1|3422149_3422956_-|integrase	integrase core domain protein	integrase	W5R8L2	Staphylococcus_phage	36.1	1.1e-34
AWF09860.1|3423257_3423614_-|transposase	transposase family protein	transposase	U5P4I9	Shigella_phage	92.5	4.4e-33
AWF09805.1|3423821_3424325_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	98.8	6.3e-94
3424829:3424842	attR	ACATCTTCTAAATG	NA	NA	NA	NA
>prophage 10
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3452692	3466393	4688906	transposase	Bacillus_phage(22.22%)	14	NA	NA
AWF09368.1|3452692_3453364_+	putative transcriptional regulatory protein YedW	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
AWF13197.1|3453363_3454722_+	putative sensor-like histidine kinase YedV	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
AWF10820.1|3454829_3455681_-	molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AWF11618.1|3455701_3455845_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09735.1|3456272_3457022_-	outer membrane porin protein OmpD	NA	Q1MVN1	Enterobacteria_phage	50.2	6.8e-68
AWF10011.1|3457235_3457601_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	99.2	6.2e-59
AWF12796.1|3457558_3458464_+	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	99.7	3.3e-178
AWF11221.1|3459636_3460332_+	hypothetical protein	NA	S4W232	Pandoravirus	28.2	4.7e-07
AWF11096.1|3460398_3461817_+	DNA (cytosine-5-)-methyltransferase family protein	NA	E5E3X6	Burkholderia_phage	55.8	9.4e-103
AWF13262.1|3461797_3462268_+	very short patch repair protein	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
AWF09522.1|3462256_3463177_-	hypothetical protein	NA	NA	NA	NA	NA
AWF13345.1|3463355_3464267_+	inner membrane protein YedI	NA	NA	NA	NA	NA
AWF11890.1|3464345_3464528_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12130.1|3464716_3466393_+	diguanylate cyclase domain protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 11
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3532291	3560494	4688906	terminase,tRNA,integrase	Escherichia_phage(22.86%)	51	3534247:3534266	3560667:3560686
AWF10049.1|3532291_3533035_-|tRNA	tRNA (cmo5U34)-methyltransferase	tRNA	F5B419	Synechococcus_phage	30.0	3.5e-24
AWF13827.1|3533075_3533471_-	inner membrane protein YecN	NA	NA	NA	NA	NA
AWF12112.1|3533523_3534249_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.8e-71
3534247:3534266	attL	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
AWF11490.1|3534299_3535559_-|integrase	phage integrase family protein	integrase	A0A286S1S8	Klebsiella_phage	90.6	2.7e-226
AWF11034.1|3535601_3535793_-	hypothetical protein	NA	A0A286S2A4	Klebsiella_phage	93.1	1.4e-25
AWF10438.1|3535868_3536003_-	hypothetical protein	NA	NA	NA	NA	NA
AWF12776.1|3536006_3536225_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	A0A0K2FI84	Escherichia_phage	56.6	7.8e-09
AWF13028.1|3536221_3536422_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09619.1|3536418_3536544_-	hypothetical protein	NA	NA	NA	NA	NA
AWF10703.1|3536576_3536780_+	putative orf-90	NA	T1S9K2	Salmonella_phage	78.5	1.2e-22
AWF11824.1|3536776_3536890_+	putative mosaic protein	NA	A0A1U8QWK2	Salmonella_phage	67.6	6.9e-09
AWF11193.1|3536886_3537270_+	ead domain protein	NA	A0A1V0E5L5	Salmonella_phage	61.5	1.0e-11
AWF10071.1|3537411_3537555_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09902.1|3537674_3537860_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13660.1|3537896_3538079_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11528.1|3538075_3538339_+	hot	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
AWF13367.1|3538445_3538781_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	43.1	4.7e-21
AWF10054.1|3538831_3539611_-	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
AWF10093.1|3539610_3540633_-	helix-turn-helix family protein	NA	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWF12205.1|3540689_3541001_+	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	67.0	8.2e-28
AWF11744.1|3541209_3541500_+	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	88.5	3.1e-45
AWF09891.1|3541496_3541859_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	82.4	4.3e-52
AWF11748.1|3541855_3541996_+	putative gifsy-1 Prophage Protein	NA	NA	NA	NA	NA
AWF12904.1|3542007_3542682_+	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	54.6	3.5e-55
AWF09445.1|3542924_3543041_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09870.1|3543125_3543437_+	putative membrane protein	NA	A0A286N2Q5	Klebsiella_phage	88.3	1.2e-42
AWF12444.1|3543433_3543973_+	putative Peptidoglycan domain protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	5.3e-99
AWF12414.1|3543969_3544317_+	putative membrane protein	NA	A0A286N2Q7	Klebsiella_phage	71.3	1.2e-35
AWF11103.1|3544313_3544589_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	2.1e-06
AWF09589.1|3544605_3544737_+	hypothetical protein	NA	G8C7W2	Escherichia_phage	88.9	1.6e-12
AWF10939.1|3544993_3545143_+	hypothetical protein	NA	NA	NA	NA	NA
AWF10154.1|3545139_3545406_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13840.1|3545575_3546004_+	hypothetical protein	NA	NA	NA	NA	NA
AWF10204.1|3546062_3546839_+|terminase	putative phage terminase small subunit	terminase	A0A077KBY7	Edwardsiella_phage	66.0	8.4e-13
AWF12714.1|3546789_3548190_+|terminase	phage terminase, large subunit, PBSX family	terminase	A0A077KAW0	Edwardsiella_phage	69.0	2.1e-187
AWF10912.1|3548412_3549864_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	2.5e-191
AWF13808.1|3549934_3550468_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	55.8	6.8e-46
AWF09672.1|3551193_3552180_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	47.4	1.4e-73
AWF11578.1|3552183_3552678_+	putative bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWF11968.1|3552695_3553631_+	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	3.5e-138
AWF10283.1|3553670_3553952_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12973.1|3554007_3554340_+	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	62.9	1.1e-30
AWF09812.1|3554336_3554843_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13448.1|3554842_3555229_+	putative phage protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
AWF11560.1|3555323_3555764_+	putative bacteriophage protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWF12767.1|3555767_3556658_+	hypothetical protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	51.4	2.5e-69
AWF13726.1|3556639_3557539_+	hypothetical protein	NA	A0A2H4J9P7	uncultured_Caudovirales_phage	61.3	2.7e-31
AWF13314.1|3557538_3557709_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11048.1|3557853_3559875_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	6.9e-107
AWF13331.1|3559883_3560063_+	hypothetical protein	NA	NA	NA	NA	NA
AWF11971.1|3560176_3560494_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
3560667:3560686	attR	CACGCAGTTAAAGTGGCGGG	NA	NA	NA	NA
>prophage 12
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3842651	3856754	4688906	integrase	Escherichia_phage(22.22%)	16	3840355:3840368	3852720:3852733
3840355:3840368	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
AWF11693.1|3842651_3845057_-	anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family protein	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
AWF13860.1|3845276_3845582_-	hypothetical protein	NA	NA	NA	NA	NA
AWF10919.1|3845776_3846400_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09417.1|3846402_3846963_-	spermidine N(1)-acetyltransferase	NA	NA	NA	NA	NA
AWF10609.1|3846997_3847339_-	hypothetical protein	NA	NA	NA	NA	NA
AWF13306.1|3847473_3847800_+	hypothetical protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AWF12751.1|3848005_3849220_+	mandelate racemase / muconate lactonizing enzyme, C-terminal domain protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWF10217.1|3849231_3850251_+	zinc-binding dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWF13875.1|3850438_3851719_-|integrase	phage integrase family protein	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
AWF09726.1|3851753_3851990_-	hypothetical protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AWF10694.1|3852077_3854549_-	putative exonuclease VIII	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
3852720:3852733	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
AWF13445.1|3854642_3854834_-	hypothetical protein	NA	NA	NA	NA	NA
AWF13165.1|3854830_3855019_-	dicB family protein	NA	NA	NA	NA	NA
AWF11398.1|3855162_3855345_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12329.1|3855325_3856291_+	putative ybl78	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
AWF10324.1|3856457_3856754_+	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	81.4	5.2e-40
>prophage 13
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	3863671	3871063	4688906		Enterobacteria_phage(50.0%)	7	NA	NA
AWF11763.1|3863671_3864721_+	hypothetical protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AWF12030.1|3864841_3865108_+	endodeoxyribonuclease RusA family protein	NA	V5URS4	Shigella_phage	62.2	7.8e-19
AWF13399.1|3865104_3865926_+	antitermination family protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AWF11725.1|3866440_3866557_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09953.1|3866818_3868834_+	hypothetical protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
AWF10824.1|3868904_3869300_+	outer membrane beta-barrel domain protein	NA	A5LH44	Enterobacteria_phage	97.4	6.1e-60
AWF10613.1|3869299_3871063_+	chaperone of endosialidase family protein	NA	K7PGT9	Enterobacteria_phage	85.2	1.8e-204
>prophage 14
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	4272668	4285406	4688906	transposase,integrase	Enterobacteria_phage(28.57%)	14	4270641:4270664	4284109:4284132
4270641:4270664	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AWF13769.1|4272668_4274459_-	phoH-like family protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	6.9e-26
AWF11513.1|4275665_4276169_-|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	91.9	2.9e-83
AWF10634.1|4276413_4276902_-	phage replication protein O, N-terminal domain	NA	A0A0M5M7Y1	Salmonella_phage	50.0	2.6e-36
AWF12120.1|4276988_4277528_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AWF12828.1|4277716_4278022_+	putative bacteriophage recombination protein	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.3e-43
AWF13365.1|4278018_4278699_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AWF11712.1|4278695_4278854_+	hypothetical protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AWF11151.1|4278850_4279915_+	DGQHR domain protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AWF12225.1|4280068_4280287_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AWF10278.1|4280457_4280574_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	92.1	1.2e-11
AWF11230.1|4281073_4282096_+	helix-turn-helix family protein	NA	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWF13915.1|4282095_4282875_+	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
AWF12754.1|4282890_4284042_+|integrase	phage integrase family protein	integrase	O21929	Phage_21	99.7	8.2e-206
AWF12618.1|4284155_4285406_-	isocitrate dehydrogenase, NADP-dependent	NA	Q77Z09	Phage_21	100.0	3.8e-23
4284109:4284132	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 15
CP029108	Escherichia coli strain AR437 chromosome, complete genome	4688906	4600559	4609329	4688906	integrase	Salmonella_phage(88.89%)	12	4600229:4600242	4609371:4609384
4600229:4600242	attL	AAAACAATAAGTTA	NA	NA	NA	NA
AWF09881.1|4600559_4600748_-	putative levan regulatory protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AWF10489.1|4600906_4603300_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AWF12671.1|4603296_4604154_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AWF10331.1|4604150_4604378_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AWF12206.1|4604377_4604611_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AWF10549.1|4604678_4605020_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AWF11690.1|4605042_4605267_-	putative cell division blocking protein	NA	NA	NA	NA	NA
AWF13586.1|4605441_4605951_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AWF10781.1|4605965_4606130_+	hypothetical protein	NA	NA	NA	NA	NA
AWF13017.1|4606293_4607229_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.8e-30
AWF11226.1|4607240_4608185_+	hypothetical protein	NA	NA	NA	NA	NA
AWF12062.1|4608276_4609329_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
4609371:4609384	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 1
CP029103	Escherichia coli strain AR437 plasmid unnamed1, complete sequence	89643	6	89486	89643	integrase,terminase,tail,transposase	Escherichia_phage(66.67%)	89	11275:11291	63231:63247
AWF09150.1|6_807_+	phage antirepressor KilA domain protein	NA	Q1MVK4	Enterobacteria_phage	99.6	1.6e-147
AWF09076.1|836_1682_+	putative replication protein repL	NA	Q1MVK3	Enterobacteria_phage	97.9	1.2e-150
AWF09079.1|1850_2555_+	hypothetical protein	NA	Q71TB8	Escherichia_phage	99.6	1.3e-134
AWF09111.1|3565_3820_-	putative upf52.7	NA	Q71TM5	Escherichia_phage	98.8	5.9e-40
AWF09131.1|3859_4591_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09081.1|4703_5519_-	putative upf54.2	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
AWF09085.1|5528_7118_-	putative gp22	NA	Q71TB2	Escherichia_phage	98.5	2.4e-301
AWF09138.1|7178_8885_-	putative upf57.5	NA	Q1MVJ5	Enterobacteria_phage	94.2	6.3e-311
AWF09102.1|9110_10112_-	parB	NA	Q38420	Escherichia_phage	99.4	1.1e-177
AWF09112.1|10128_11325_-	plasmid partition protein A	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
11275:11291	attL	CATTCTGTTTGCTCTTT	NA	NA	NA	NA
AWF09095.1|11882_12641_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	5.7e-139
AWF09078.1|13061_13454_-	putative upfA	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
AWF09069.1|13465_13597_-	putative membrane lipoprotein	NA	Q71TL6	Escherichia_phage	97.7	6.1e-17
AWF09143.1|13631_14054_-	putative ppfA	NA	A0A1B0VCB0	Salmonella_phage	86.4	1.1e-46
AWF09140.1|14093_14882_-	putative upfB	NA	A0A1B0V830	Salmonella_phage	96.6	1.4e-116
AWF09107.1|15620_16526_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AWF09139.1|16594_19564_+	DNA adenine methylase family protein	NA	A0A077SL51	Escherichia_phage	86.2	0.0e+00
AWF09106.1|20493_20610_+	hypothetical protein	NA	A0A1B0VAL9	Salmonella_phage	94.7	2.8e-13
AWF09127.1|21126_21561_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
AWF09075.1|21560_21725_+	hypothetical protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
AWF09082.1|21991_22132_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09062.1|22266_23562_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.5	3.4e-240
AWF09134.1|23561_23864_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09071.1|23860_24835_+	glycosyl transferases group 1 family protein	NA	A0A077SL52	Escherichia_phage	98.1	5.5e-187
AWF09141.1|24881_25127_-	putative upf76.8	NA	A0A077SK50	Escherichia_phage	100.0	1.9e-11
AWF09074.1|25506_26523_-	putative upf77.7	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
AWF09077.1|26524_27310_-	putative gp24	NA	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
AWF09144.1|27296_28025_-	putative upf79.2	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AWF09097.1|28028_29246_-	putative gp25	NA	A0A077SL53	Escherichia_phage	99.5	4.1e-224
AWF09132.1|29255_29633_-	putative 26 protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AWF09123.1|29779_30025_+	putative pmgL	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AWF09119.1|30027_30606_+	VRR-NUC domain protein	NA	Q71T85	Escherichia_phage	99.5	4.4e-107
AWF09120.1|30711_30828_+	putative hdmA	NA	Q71TJ4	Escherichia_phage	100.0	2.8e-13
AWF09118.1|30972_31101_+	putative pmgO	NA	NA	NA	NA	NA
AWF09105.1|31329_31956_+	putative pmgP	NA	Q71T82	Escherichia_phage	99.0	4.0e-122
AWF09068.1|31952_32630_+	serine/threonine-protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.3	3.3e-130
AWF09121.1|32626_33328_+	putative pmgQ	NA	Q71TJ0	Escherichia_phage	99.6	1.0e-142
AWF09094.1|33629_34892_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	1.7e-233
AWF09072.1|35379_35616_-|transposase	putative transposase	transposase	A0A0U2RK18	Escherichia_phage	91.0	3.9e-30
AWF09064.1|36214_38071_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	38.2	8.3e-75
AWF09130.1|38641_39016_-|integrase	integrase core domain protein	integrase	A0A0P0I4A4	Acinetobacter_phage	51.6	4.3e-31
AWF09063.1|39497_39797_+	putative sOS mutagenesis and repair protein UmuD	NA	Q1MVE7	Enterobacteria_phage	100.0	1.3e-51
AWF09108.1|39869_40091_+	antitoxin phd	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWF09090.1|40090_40471_+	toxin doc	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AWF09098.1|40517_40655_+	putative pdcA	NA	Q71TH5	Escherichia_phage	100.0	1.1e-16
AWF09083.1|40682_41726_+	hypothetical protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
AWF09126.1|41892_42267_+	putative late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	1.2e-62
AWF09101.1|42352_43546_+	helix-turn-helix domain protein	NA	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
AWF09148.1|43545_45030_+|terminase	putative large terminase protein	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AWF09088.1|45055_45907_-	repressor protein C1	NA	A0A077SLM8	Escherichia_phage	99.3	4.0e-157
AWF09115.1|46822_47044_+	putative cre-associated protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
AWF09073.1|47051_48083_+	recombinase cre	NA	A0A077SLE7	Escherichia_phage	99.4	6.4e-194
AWF09109.1|48304_48445_+	putative c8	NA	Q5XLQ4	Enterobacteria_phage	97.8	3.2e-16
AWF09129.1|48817_49252_+	recombination enhancement function protein	NA	Q71TG3	Escherichia_phage	97.2	7.9e-77
AWF09137.1|49441_50083_+	putative maturation control protein	NA	A0A077SK30	Escherichia_phage	96.2	4.2e-111
AWF09142.1|50173_51214_+	yaaC-like family protein	NA	NA	NA	NA	NA
AWF09147.1|51781_51952_-	modulator protein	NA	Q71TG0	Escherichia_phage	98.2	1.6e-25
AWF09103.1|52026_52401_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	99.2	2.9e-67
AWF09133.1|52500_59157_-	SNF2 family N-terminal domain protein	NA	Q1MVN7	Enterobacteria_phage	98.5	0.0e+00
AWF09096.1|59344_61054_+	putative proA	NA	Q71TR7	Escherichia_phage	99.6	0.0e+00
AWF09070.1|61046_62066_+	putative proB	NA	Q71TR6	Escherichia_phage	95.9	1.9e-177
AWF09128.1|62045_62162_-	putative lydE	NA	Q71TR5	Escherichia_phage	89.5	2.5e-14
AWF09117.1|62357_62915_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AWF09065.1|63260_63572_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.0	1.1e-51
63231:63247	attR	AAAGAGCAAACAGAATG	NA	NA	NA	NA
AWF09067.1|63575_63689_-	putative membrane protein	NA	NA	NA	NA	NA
AWF09091.1|63774_64569_+	putative isaA	NA	Q71TF1	Escherichia_phage	96.6	8.0e-144
AWF09110.1|64598_64916_-	putative odaA	NA	Q1MVN0	Enterobacteria_phage	88.6	7.6e-45
AWF09086.1|64905_67527_-	putative ddrB	NA	A0A1B0VFX4	Salmonella_phage	98.4	0.0e+00
AWF09066.1|67525_67648_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09149.1|67905_68271_-	putative upf26.7	NA	A0A077SK35	Escherichia_phage	98.3	6.7e-45
AWF09100.1|68267_70187_-	putative darA	NA	A0A077SLK4	Escherichia_phage	95.6	0.0e+00
AWF09087.1|70188_70791_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
AWF09084.1|70777_71221_-	putative lydB	NA	A0A077SK09	Escherichia_phage	98.0	2.0e-80
AWF09124.1|71217_71334_-	putative lydA	NA	Q37876	Escherichia_phage	100.0	8.0e-13
AWF09080.1|72314_72686_-|tail	caudovirales tail fiber assembly family protein	tail	Q9MCR5	Enterobacteria_phage	80.3	1.5e-23
AWF09104.1|72724_77425_-|tail	phage tail fiber repeat family protein	tail	Q71TP5	Escherichia_phage	57.9	4.1e-296
AWF09125.1|77436_77607_-|tail	putative tail fiber protein R	tail	Q71TD4	Escherichia_phage	98.2	1.5e-23
AWF09113.1|77949_78786_-	putative pep42	NA	A0A077SLH5	Escherichia_phage	99.6	1.5e-153
AWF09093.1|78785_80219_-	putative bplA	NA	Q71TP2	Escherichia_phage	99.4	3.4e-270
AWF09114.1|80215_80572_-	putative pmgA	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
AWF09135.1|80571_84312_-	transglycosylase SLT domain protein	NA	Q1MVL3	Enterobacteria_phage	87.4	0.0e+00
AWF09145.1|84323_84440_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09122.1|84393_85275_-	putative phage morphogenetic protein PmgB	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
AWF09089.1|85289_85901_-	putative tubB	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
AWF09146.1|85911_86157_-	putative phage morphogenetic protein TubA	NA	Q71TN7	Escherichia_phage	100.0	4.5e-37
AWF09136.1|86558_87044_-	putative upf50.0	NA	A0A077SL46	Escherichia_phage	98.8	1.2e-36
AWF09099.1|87101_87506_-	putative outer membrane lipoprotein	NA	A0A077SK39	Escherichia_phage	99.3	1.2e-34
AWF09116.1|88233_88455_+	putative cell division repressor	NA	A0A077SLM6	Escherichia_phage	100.0	1.3e-38
AWF09092.1|88451_89486_+	phage antirepressor KilAC domain protein	NA	A0A077SLI1	Escherichia_phage	99.1	4.5e-187
>prophage 1
CP029107	Escherichia coli strain AR437 plasmid unnamed5, complete sequence	93435	8781	48569	93435	protease,transposase	Escherichia_phage(29.17%)	48	NA	NA
AWF09340.1|8781_8967_-|transposase	putative transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	70.7	2.9e-20
AWF09301.1|9074_9296_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09300.1|9326_9677_-|transposase	putative transposase	transposase	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWF09322.1|9673_10030_-|transposase	transposase family protein	transposase	Q6H9S5	Enterobacteria_phage	89.5	5.7e-33
AWF09257.1|10144_10648_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	1.7e-94
AWF09296.1|10883_11453_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09269.1|11865_12219_-	putative membrane protein	NA	NA	NA	NA	NA
AWF09329.1|12690_13713_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF09328.1|14117_14375_+	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AWF09315.1|14676_15534_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWF09293.1|16234_16375_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09360.1|16353_16476_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09314.1|16472_17126_+|protease	CAAX protease self-immunity family protein	protease	NA	NA	NA	NA
AWF09312.1|17218_17476_+	antitoxin PemI	NA	NA	NA	NA	NA
AWF09252.1|17477_17810_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWF09356.1|17946_20844_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWF09323.1|20938_21544_+	resolvase, N terminal domain protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AWF09358.1|21540_22302_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	98.4	1.9e-134
AWF09353.1|22305_22713_+	isochorismatase family protein	NA	NA	NA	NA	NA
AWF09316.1|22850_23735_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AWF09361.1|23766_24966_-	tetracycline resistance protein, class C	NA	NA	NA	NA	NA
AWF09319.1|25071_25722_+	tetracycline repressor protein class B from transposon Tn10	NA	NA	NA	NA	NA
AWF09268.1|26037_27627_-|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	100.0	1.4e-293
AWF09308.1|27617_28322_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF09307.1|29150_29981_+	beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWF09291.1|30612_31317_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF09332.1|31363_32845_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	99.8	1.5e-284
AWF09350.1|33698_33971_+	cupin fold metallo, WbuC family protein	NA	NA	NA	NA	NA
AWF09289.1|34017_34893_-	beta-lactamase CTX-M-1	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWF09286.1|35045_35168_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09284.1|35148_35511_-|transposase	transposase DDE domain group 1 family protein	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
AWF09349.1|35501_36206_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF09305.1|36277_36943_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	64.5	2.4e-69
AWF09264.1|37435_37912_-	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AWF09274.1|38019_39258_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWF09285.1|39254_39722_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWF09273.1|39755_40181_+	putative macrolide phosphotransferase K	NA	NA	NA	NA	NA
AWF09299.1|40281_40986_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF09327.1|41091_41385_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.9e-51
AWF09333.1|41433_41691_+|transposase	transposase C of IS166 homeodomain protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	97.4	2.3e-31
AWF09344.1|41692_42451_+|transposase	helix-turn-helix domain of transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	9.1e-129
AWF09267.1|42464_43487_+	helix-turn-helix family protein	NA	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWF09324.1|43486_44266_+	istB-like ATP binding family protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	4.9e-138
AWF09362.1|44510_44942_+|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	100.0	5.4e-78
AWF09355.1|45004_45796_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09275.1|45802_47773_-	tonB-dependent hemoglobin/transferrin/lactoferrin receptor family protein	NA	NA	NA	NA	NA
AWF09346.1|48054_48420_+|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	100.0	9.6e-60
AWF09266.1|48377_48569_+|transposase	transposase family protein	transposase	Q9ZXG3	Shigella_phage	100.0	7.1e-14
>prophage 2
CP029107	Escherichia coli strain AR437 plasmid unnamed5, complete sequence	93435	52168	58705	93435	integrase,transposase	Macacine_betaherpesvirus(16.67%)	7	45083:45099	62884:62900
45083:45099	attL	TTGGACTTTCGCCAGCC	NA	NA	NA	NA
AWF09326.1|52168_52720_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.5e-24
AWF09357.1|53004_53982_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
AWF09288.1|54751_55084_+	homeo-like domain protein	NA	U5N3F9	Enterobacteria_phage	98.0	2.8e-50
AWF09262.1|55479_55731_+	hypothetical protein	NA	F1C5A5	Cronobacter_phage	60.0	2.1e-21
AWF09359.1|55910_56414_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
AWF09335.1|57086_57878_+	periplasmic solute binding family protein	NA	NA	NA	NA	NA
AWF09281.1|57877_58705_+	ABC transporter family protein	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
62884:62900	attR	GGCTGGCGAAAGTCCAA	NA	NA	NA	NA
>prophage 3
CP029107	Escherichia coli strain AR437 plasmid unnamed5, complete sequence	93435	84590	93430	93435	transposase	Stx2-converting_phage(42.86%)	16	NA	NA
AWF09339.1|84590_85274_+	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	36.0	1.1e-29
AWF09276.1|85274_85496_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09297.1|85509_85944_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09351.1|85988_86759_+	putative yfdA	NA	NA	NA	NA	NA
AWF09310.1|87172_87598_+	antirestriction family protein	NA	NA	NA	NA	NA
AWF09278.1|87644_88067_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09320.1|88063_88234_+	putative yffA	NA	NA	NA	NA	NA
AWF09283.1|88265_88949_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	2.9e-09
AWF09309.1|89003_89564_+	fertility inhibition protein	NA	NA	NA	NA	NA
AWF09255.1|89827_89953_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09279.1|90094_90217_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09334.1|90210_90378_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	100.0	7.8e-09
AWF09354.1|90726_91032_+|transposase	transposase family protein	transposase	A0A0P0ZCV4	Stx2-converting_phage	44.6	3.9e-14
AWF09292.1|91031_91379_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWF09363.1|91398_92970_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AWF09331.1|92890_93430_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	99.3	1.4e-78
