The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	447243	481807	5439007	capsid,tRNA,transposase,integrase,head,protease,terminase,tail,portal	uncultured_Caudovirales_phage(61.11%)	36	464851:464868	482152:482169
AWF07898.1|447243_448191_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWF06061.1|448205_448700_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.5e-18
AWF07105.1|448843_449968_+	DNA protecting protein DprA	NA	NA	NA	NA	NA
AWF03961.1|449939_450413_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07942.1|450438_450981_+	zinc-ribbon domain protein	NA	NA	NA	NA	NA
AWF06649.1|450985_451558_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AWF05921.1|451561_452380_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWF08642.1|452376_452634_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06339.1|452609_453164_-	bacterial transferase hexapeptide family protein	NA	NA	NA	NA	NA
AWF04917.1|458959_459181_-	prokaryotic membrane lipolipid attachment site family protein	NA	NA	NA	NA	NA
AWF05971.1|459474_462585_-	RND transporter, hydrophobe/amphiphile efflux-1 family protein	NA	NA	NA	NA	NA
AWF07081.1|462597_463737_-	efflux transporter, RND family, MFP subunit	NA	NA	NA	NA	NA
AWF03813.1|464115_464766_+	putative acrEF/envCD operon repressor	NA	NA	NA	NA	NA
464851:464868	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWF08683.1|465041_466268_+|integrase	phage integrase family protein	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWF04727.1|466444_467302_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06740.1|467483_467768_+	prophage CP4-57 regulatory family protein	NA	NA	NA	NA	NA
AWF04402.1|467796_468558_+	phage antirepressor KilAC domain protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.1e-40
AWF04385.1|469099_469279_+	hypothetical protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AWF06537.1|469271_469460_+	hypothetical protein	NA	NA	NA	NA	NA
AWF03275.1|469452_469767_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07366.1|469775_470132_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.4	2.3e-50
AWF04601.1|470128_470494_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07729.1|470499_472629_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWF05485.1|472971_473307_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05469.1|473355_473868_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04464.1|474131_475298_+|capsid	phage major capsid protein, HK97 family	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWF05114.1|475349_475910_+|head,protease	phage prohead protease, HK97 family	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWF07648.1|475911_477153_+|portal	phage portal protein, HK97 family	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWF05430.1|477329_477485_+|head,tail	phage head-tail joining family protein	head,tail	A0A1P8DTK6	Proteus_phage	54.0	7.2e-09
AWF08559.1|477556_477781_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	87.8	3.0e-32
AWF04047.1|477831_478224_+	HNH endonuclease family protein	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	90.0	1.4e-64
AWF07605.1|478210_478369_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.5e-17
AWF03590.1|478659_478902_+|transposase	transposase family protein	transposase	Q6H9S4	Enterobacteria_phage	37.0	2.0e-05
AWF04862.1|478898_479777_+	HTH-like domain protein	NA	U5P429	Shigella_phage	43.5	2.6e-50
AWF05735.1|479949_480162_+|terminase	phage terminase, small subunit	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.6	3.5e-30
AWF04744.1|480145_481807_+	phage Terminase family protein	NA	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482152:482169	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1239478	1285713	5439007	plate,capsid,lysis,tRNA,integrase,terminase,head,tail,portal	Salmonella_phage(86.84%)	56	1237772:1237818	1274339:1274385
1237772:1237818	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWF03427.1|1239478_1240504_-|integrase	phage integrase family protein	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
AWF03554.1|1240506_1240824_-	putative phage regulatory protein cI	NA	A0A1S6KZZ7	Salmonella_phage	49.5	1.5e-24
AWF04775.1|1241384_1241501_+	putative phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.6e-13
AWF04304.1|1241533_1242043_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWF05783.1|1242214_1242553_+	putative prophage protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWF06617.1|1242620_1242854_+	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWF07429.1|1242853_1243081_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWF03705.1|1243077_1243929_+	DNA adenine methylase family protein	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWF06957.1|1243925_1246310_+	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWF03814.1|1246672_1246906_+	dinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AWF05861.1|1247001_1247685_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07414.1|1247671_1248751_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06880.1|1248750_1249752_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04883.1|1250599_1251643_-|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AWF07824.1|1251642_1253397_-	sigma-70, region 4 family protein	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWF07595.1|1253546_1254380_+|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWF04294.1|1254396_1255449_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWF07332.1|1255452_1256106_+|terminase	phage small terminase subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWF06095.1|1256201_1256666_+|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWF06541.1|1256665_1256869_+	phage Tail Protein X family protein	NA	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWF03459.1|1256872_1257088_+	putative membrane protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWF05203.1|1257068_1257578_+	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWF07617.1|1257582_1257966_+	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWF04766.1|1257962_1258391_+|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWF04043.1|1258486_1258909_+|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWF06525.1|1258901_1259348_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWF07434.1|1259370_1260237_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08104.1|1260331_1260904_+|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWF06088.1|1260900_1261263_+	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWF06368.1|1261249_1262158_+|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWF07262.1|1262198_1262822_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	6.7e-53
AWF06149.1|1262823_1264773_+	cotH family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWF03443.1|1264782_1265901_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AWF05819.1|1265952_1267026_+|tail	phage tail-collar fiber family protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWF07927.1|1267174_1268347_+|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWF07742.1|1268356_1268872_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWF05674.1|1268924_1269224_+	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWF04301.1|1269238_1269358_+	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWF07738.1|1269350_1271981_+|tail	phage tail tape measure protein, TP901 family, core region	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWF05750.1|1271977_1272463_+	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWF06199.1|1272468_1273554_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.3	4.0e-170
AWF04733.1|1274167_1274314_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08677.1|1274847_1275330_-	ssrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1274339:1274385	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWF07921.1|1275479_1275917_+	ribosome association toxin RatA	NA	NA	NA	NA	NA
AWF05968.1|1275906_1276197_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08368.1|1276263_1276605_-	smpA / OmlA family protein	NA	NA	NA	NA	NA
AWF06018.1|1276586_1276727_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05695.1|1276752_1278414_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWF06524.1|1278500_1279379_-	ATP-NAD kinase family protein	NA	NA	NA	NA	NA
AWF07823.1|1279503_1280094_+	protein GrpE	NA	NA	NA	NA	NA
AWF08297.1|1280213_1281455_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03560.1|1281519_1282311_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWF03472.1|1282474_1283839_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWF03938.1|1284098_1284347_+	ribosomal protein S16	NA	NA	NA	NA	NA
AWF07394.1|1284455_1284914_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
AWF08657.1|1284945_1285713_+|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1390438	1435141	5439007	integrase,head,terminase,protease,tail	Salmonella_phage(42.22%)	58	1393002:1393016	1404183:1404197
AWF06036.1|1390438_1391905_+	inosine-5'-monophosphate dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AWF04804.1|1391972_1393550_+	GMP synthase	NA	NA	NA	NA	NA
1393002:1393016	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
AWF04715.1|1393742_1394993_+|integrase	phage integrase family protein	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
AWF07350.1|1395009_1395201_-	putative cell division initiation protein	NA	NA	NA	NA	NA
AWF03345.1|1395376_1395970_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
AWF07757.1|1395966_1396125_-	hypothetical protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
AWF03793.1|1396117_1396402_-	perC transcriptional activator family protein	NA	T1S9J5	Salmonella_phage	72.3	5.6e-31
AWF05317.1|1396520_1396769_-	prophage CP4-57 regulatory family protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
AWF06414.1|1396820_1397273_-	recombinase, phage RecT family protein	NA	Q858E1	Salmonella_phage	91.9	5.7e-70
AWF06896.1|1397852_1398752_-	putative phage-type endonuclease domain protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
AWF04235.1|1398748_1399048_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWF03499.1|1399044_1399194_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
AWF05570.1|1399414_1399996_-	cro/C1-type HTH DNA-binding domain protein	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
AWF08064.1|1400149_1400383_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWF04957.1|1400530_1400740_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AWF04295.1|1400739_1401507_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
AWF08059.1|1401503_1402289_+	replication P family protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
AWF03524.1|1402453_1402756_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	83.0	1.4e-43
AWF03853.1|1402817_1402952_+	putative membrane protein	NA	NA	NA	NA	NA
AWF07804.1|1402936_1403359_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	40.5	2.4e-14
AWF04910.1|1403342_1403534_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06326.1|1403530_1403956_+	hypothetical protein	NA	NA	NA	NA	NA
AWF03308.1|1403952_1404696_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1404183:1404197	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
AWF04955.1|1404695_1404866_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
AWF04499.1|1404866_1405079_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AWF03299.1|1405075_1405744_+	hypothetical protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
AWF08475.1|1405736_1405976_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
AWF07779.1|1405975_1406314_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
AWF07825.1|1406388_1406646_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05835.1|1406723_1407308_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
AWF05925.1|1407304_1408780_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
AWF06424.1|1408823_1409345_-	hypothetical protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
AWF08240.1|1410050_1410254_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07622.1|1410257_1411937_+|head,tail	bacteriophage head to tail connecting family protein	head,tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
AWF06040.1|1411933_1412239_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AWF05160.1|1412281_1412479_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06944.1|1412532_1412919_+|protease	putative endoprotease	protease	T1SAP9	Salmonella_phage	58.6	1.9e-34
AWF05223.1|1412931_1413939_+	hypothetical protein	NA	T1S9H9	Salmonella_phage	92.5	2.7e-181
AWF06569.1|1413948_1414341_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AWF07721.1|1414333_1414612_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
AWF05577.1|1414660_1415272_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
AWF04989.1|1415271_1417749_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
AWF03462.1|1417750_1418221_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
AWF08149.1|1418213_1418711_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
AWF07175.1|1418723_1421468_+	putative bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
AWF03787.1|1421467_1424857_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
AWF05699.1|1424866_1425481_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05206.1|1425755_1425920_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05340.1|1426158_1426371_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05218.1|1426421_1426538_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07614.1|1426531_1426987_-	putative anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	54.7	3.3e-41
AWF07084.1|1428604_1430974_+|tail	phage T7 tail fiber family protein	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
AWF05127.1|1430982_1431135_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
AWF05077.1|1431258_1431663_+	putative membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AWF03352.1|1431817_1431952_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05387.1|1431944_1432574_+	chitinase class I family protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
AWF04820.1|1432570_1433053_+	hypothetical protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
AWF06508.1|1433272_1435141_-	type I phosphodiesterase / nucleotide pyrophosphatase family protein	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1763871	1770778	5439007		Planktothrix_phage(33.33%)	7	NA	NA
AWF07800.1|1763871_1764735_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWF06582.1|1764745_1765519_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
AWF06189.1|1765629_1765761_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04131.1|1765761_1766655_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWF05908.1|1766900_1768262_-	peptidase U32 family protein	NA	Q6DW11	Phage_TP	94.5	2.5e-206
AWF04643.1|1768580_1769303_-	transcriptional regulatory, C terminal family protein	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AWF04490.1|1769299_1770778_-	signal transduction histidine-protein kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	1807345	1814970	5439007		Enterobacteria_phage(28.57%)	8	NA	NA
AWF07141.1|1807345_1808752_+	6-phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWF04981.1|1808919_1809033_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08502.1|1809063_1810041_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.0	3.2e-94
AWF07124.1|1810067_1810937_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
AWF06205.1|1810968_1811859_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
AWF03390.1|1811873_1812428_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
AWF04816.1|1812608_1813775_+	nucleotide sugar dehydrogenase family protein	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AWF06776.1|1813968_1814970_+	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	2781537	2792424	5439007		Escherichia_phage(87.5%)	9	NA	NA
AWF03753.1|2781537_2784645_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWF06004.1|2784699_2785965_+	lactose permease	NA	NA	NA	NA	NA
AWF04960.1|2785995_2787084_-	recF/RecN/SMC N terminal domain protein	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWF08164.1|2787170_2787431_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWF05406.1|2787728_2788589_+	beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWF05850.1|2788609_2789371_-	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWF06963.1|2789631_2790534_+	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWF05411.1|2790545_2791811_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWF06614.1|2791803_2792424_+	class II Aldolase and Adducin N-terminal domain protein	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	3015610	3157619	5439007	capsid,lysis,transposase,terminase,protease,integrase,tail	Klebsiella_phage(26.73%)	166	3091373:3091388	3154925:3154940
AWF07794.1|3015610_3018634_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
AWF04007.1|3018689_3018887_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03482.1|3018861_3019029_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05401.1|3019113_3019278_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06446.1|3019752_3020199_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	46.0	1.1e-28
AWF06906.1|3020522_3021713_-	putative bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	72.7	1.9e-157
AWF04493.1|3021718_3022072_-	putative bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWF06026.1|3022073_3022727_-	putative translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWF07649.1|3022780_3023131_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03553.1|3023383_3023569_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05834.1|3023621_3023855_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.6	5.8e-18
AWF05852.1|3023962_3024985_-	putative bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWF06987.1|3024987_3025215_-	putative bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
AWF07954.1|3025290_3025704_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
AWF08383.1|3025889_3027893_-	transglycosylase SLT domain protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWF04405.1|3027882_3028035_-	putative nTP pyrophosphohydrolase including oxidative damage repair enzyme	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWF07387.1|3028070_3028496_-	putative bacteriophage protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWF07976.1|3028499_3028700_-	hypothetical protein	NA	A0A0M5M1K6	Salmonella_phage	80.3	1.6e-24
AWF08213.1|3028897_3029140_+|transposase	transposase family protein	transposase	Q6H9S4	Enterobacteria_phage	37.0	2.0e-05
AWF07410.1|3029136_3030015_+	HTH-like domain protein	NA	U5P429	Shigella_phage	43.5	2.6e-50
AWF03714.1|3030256_3031402_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWF07773.1|3031405_3031846_-	putative bacteriophage protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWF07802.1|3031940_3032327_-	putative phage protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWF06337.1|3032326_3032833_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04126.1|3032829_3033249_-	hypothetical protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWF03901.1|3033217_3033499_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05938.1|3033538_3034474_-	hypothetical protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	2.3e-137
AWF05895.1|3034491_3034986_-	putative bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWF06122.1|3034989_3035976_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	52.6	1.7e-79
AWF07252.1|3036847_3038299_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWF03551.1|3038536_3039937_-|terminase	phage terminase, large subunit, PBSX family	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWF03688.1|3039887_3040376_-	putative bacteriophage protein	NA	NA	NA	NA	NA
AWF03580.1|3041356_3041677_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08296.1|3041682_3042213_-	phage lysozyme family protein	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWF06747.1|3042215_3042464_-|lysis	lysis S family protein	lysis	NA	NA	NA	NA
AWF03389.1|3042481_3042610_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08048.1|3042647_3042803_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03456.1|3042869_3043652_-	antitermination family protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWF05586.1|3043648_3044125_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWF04146.1|3044121_3045084_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWF08673.1|3045085_3046699_-	helicase domain protein	NA	A0A286N2P9	Klebsiella_phage	95.9	2.1e-311
AWF03271.1|3047585_3047753_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04067.1|3048478_3048793_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AWF03693.1|3048785_3048974_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWF08679.1|3049296_3049509_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.1	2.1e-30
AWF08020.1|3049823_3049946_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
AWF04565.1|3049942_3050368_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWF06757.1|3050364_3050559_+	putative membrane protein	NA	NA	NA	NA	NA
AWF08444.1|3050555_3051383_+	SPFH domain / Band 7 family protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWF03780.1|3051487_3052006_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWF05733.1|3052017_3052722_+	phage regulatory Rha family protein	NA	A0A286S260	Klebsiella_phage	88.2	4.7e-111
AWF06632.1|3052711_3052936_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWF06045.1|3052989_3053145_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	2.8e-21
AWF04543.1|3053141_3053621_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07585.1|3053693_3053840_+	putative bacteriophage protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
AWF03861.1|3053841_3054042_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	4.1e-20
AWF08116.1|3054022_3055204_-|integrase	phage integrase family protein	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWF07224.1|3055400_3055949_+|protease	intracellular protease, PfpI family protein	protease	NA	NA	NA	NA
AWF07700.1|3056147_3057680_-	HD domain protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWF08529.1|3057896_3058658_-	KR domain protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AWF07719.1|3058766_3059681_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF04469.1|3060240_3060549_-	histidine kinase-like ATPase domain protein	NA	NA	NA	NA	NA
AWF07070.1|3060554_3060692_+	glycosyl hydrolase family 2 domain protein	NA	NA	NA	NA	NA
AWF04748.1|3060716_3061586_-	aldo/keto reductase family protein	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AWF06505.1|3061664_3062819_-	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWF07489.1|3062939_3063998_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04991.1|3064248_3065133_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF04570.1|3065257_3066091_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04821.1|3066321_3066708_+	hypothetical protein	NA	NA	NA	NA	NA
AWF03932.1|3066875_3068492_-	periplasmic murein peptide-binding protein	NA	NA	NA	NA	NA
AWF03582.1|3068488_3068605_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03733.1|3068677_3069385_+	zinc carboxypeptidase family protein	NA	NA	NA	NA	NA
AWF06491.1|3069381_3070338_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AWF05190.1|3070449_3070956_+	thiol peroxidase	NA	NA	NA	NA	NA
AWF08277.1|3071026_3072079_-	membrane AbrB duplication domain protein	NA	NA	NA	NA	NA
AWF08210.1|3072180_3073722_-	transcriptional regulatory protein TyrR	NA	NA	NA	NA	NA
AWF05798.1|3073894_3075190_-	family 4 glycosyl hydrolase C-terminal domain protein	NA	NA	NA	NA	NA
AWF05942.1|3075366_3076221_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF07217.1|3076310_3077372_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06324.1|3077368_3078766_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05240.1|3078868_3079087_-	phage shock PspD family protein	NA	NA	NA	NA	NA
AWF06543.1|3079115_3079475_-	phage shock protein C	NA	NA	NA	NA	NA
AWF07851.1|3079474_3079699_-	phage shock protein B	NA	NA	NA	NA	NA
AWF06139.1|3079754_3080423_-	phage shock protein A	NA	NA	NA	NA	NA
AWF06665.1|3080590_3081565_+	psp operon transcriptional activator	NA	NA	NA	NA	NA
AWF03909.1|3081555_3082947_-	quinolone resistance protein NorB	NA	NA	NA	NA	NA
AWF04092.1|3082972_3084142_-	amidohydrolase family protein	NA	NA	NA	NA	NA
AWF08598.1|3084313_3086623_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF04856.1|3086601_3087432_-	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF06401.1|3087542_3088448_+	rmlD substrate binding domain protein	NA	NA	NA	NA	NA
AWF08026.1|3088781_3090425_+	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWF03639.1|3090421_3091387_+	peptide transport system permease protein SapB	NA	NA	NA	NA	NA
3091373:3091388	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AWF06915.1|3091591_3092263_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AWF04772.1|3093016_3093277_+	hypothetical protein	NA	NA	NA	NA	NA
AWF03323.1|3093352_3094618_-	IMS HHH motif family protein	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AWF08009.1|3094619_3095039_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AWF05609.1|3095118_3096603_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWF06350.1|3098000_3098468_-	DNA-invertase hin	NA	A0A286S1P7	Klebsiella_phage	98.0	1.4e-76
AWF03484.1|3098515_3099220_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF07227.1|3099396_3100161_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWF05133.1|3101295_3102135_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AWF04311.1|3102639_3103431_-	nucleotidyltransferase domain protein	NA	NA	NA	NA	NA
AWF05381.1|3104426_3105131_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF06769.1|3105379_3107323_+	putative flagellar biosynthesis, cell-distal portion of basal-body rod	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
AWF06814.1|3107330_3107456_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07067.1|3107564_3108164_+	concanavalin A-like lectin/glucanases superfamily protein	NA	NA	NA	NA	NA
AWF04961.1|3108388_3109120_-	concanavalin A-like lectin/glucanases superfamily protein	NA	NA	NA	NA	NA
AWF04986.1|3109123_3112078_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
AWF08204.1|3112154_3115223_-|tail	phage tail family protein	tail	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AWF05277.1|3115219_3115600_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AWF04416.1|3115609_3116092_-	hypothetical protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AWF07157.1|3116272_3116572_-	putative alkanesulfonate ABC transporter membrane protein	NA	A0A286S298	Klebsiella_phage	70.8	1.4e-37
AWF07110.1|3117577_3118558_-	hypothetical protein	NA	Q38213	Escherichia_phage	99.1	8.9e-185
AWF06024.1|3118670_3121568_-|tail	prophage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AWF04965.1|3122245_3122602_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AWF04236.1|3122678_3122855_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08405.1|3123022_3123505_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06634.1|3123558_3124731_-	bacterial Ig-like domain family protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AWF07302.1|3124754_3124907_-	putative electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AWF06903.1|3125143_3125695_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AWF03846.1|3125696_3126080_-	putative glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AWF03981.1|3126309_3126564_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AWF03767.1|3126565_3126961_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AWF07140.1|3127282_3128236_-|capsid	putative major capsid protein	capsid	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AWF05509.1|3128246_3129032_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AWF06450.1|3129145_3129322_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05738.1|3129562_3130588_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.2	1.9e-100
AWF04674.1|3130658_3132059_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AWF07830.1|3132058_3133318_-|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	58.2	4.8e-143
AWF04898.1|3133343_3134348_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AWF07725.1|3134896_3135088_-	putative membrane protein	NA	NA	NA	NA	NA
AWF03351.1|3135210_3135456_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AWF06592.1|3135681_3135810_-	hypothetical protein	NA	A0A286N2R0	Klebsiella_phage	78.6	1.4e-10
AWF07293.1|3136269_3136398_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.7	6.8e-13
AWF05265.1|3136414_3136690_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AWF07909.1|3136686_3137031_-	putative membrane protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AWF04050.1|3137027_3137567_-	putative Peptidoglycan domain protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AWF05787.1|3137563_3137875_-	putative membrane protein	NA	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AWF07096.1|3138341_3139388_-|integrase	integrase core domain protein	integrase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AWF07255.1|3139613_3140306_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	52.7	6.1e-55
AWF03245.1|3140302_3140443_-	putative gifsy-1 Prophage Protein	NA	NA	NA	NA	NA
AWF05879.1|3140439_3141078_-	bacteriophage Lambda NinG family protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AWF08608.1|3141070_3141739_-	serine/threonine-protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AWF08493.1|3141735_3141903_-	putative NinE-like protein from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AWF07326.1|3141883_3142351_-	ninB family protein	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AWF06257.1|3142871_3143900_+	hypothetical protein	NA	NA	NA	NA	NA
AWF07726.1|3143896_3144025_-	hypothetical protein	NA	T1SAP7	Salmonella_phage	65.1	1.1e-07
AWF03667.1|3144107_3144353_-	phosphoadenosine phosphosulfate reductase family domain protein	NA	NA	NA	NA	NA
AWF07964.1|3144408_3144711_-	hypothetical protein	NA	NA	NA	NA	NA
AWF03832.1|3144707_3145556_-	ATPase associated with various cellular activities family protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AWF05755.1|3145552_3146413_-	phage replication protein O, N-terminal domain	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AWF06650.1|3146498_3146720_-	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWF08655.1|3147306_3147798_+	peptidase S24-like family protein	NA	Q76H56	Enterobacteria_phage	81.6	1.7e-72
AWF04876.1|3148118_3149162_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	H2BD62	Pseudomonas_phage	37.9	8.8e-58
AWF07492.1|3149243_3149447_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AWF03837.1|3149757_3149883_+	putative membrane protein	NA	NA	NA	NA	NA
AWF07759.1|3149911_3150070_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05445.1|3150158_3150443_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AWF04564.1|3150473_3151304_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.4e-69
AWF07036.1|3151589_3152270_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AWF04083.1|3152266_3152695_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AWF08392.1|3152691_3153354_+	MT-A70 family protein	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AWF06709.1|3153561_3154749_-|integrase	phage integrase family protein	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AWF04169.1|3154925_3155816_+	peptide transport system permease protein SapC	NA	NA	NA	NA	NA
3154925:3154940	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AWF05675.1|3155815_3156808_+	oligopeptide/dipeptide ABC transporter, ATP-binding, C-terminal domain protein	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWF07706.1|3156809_3157619_+	ABC transporter family protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 8
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	3545638	3626854	5439007	plate,capsid,lysis,tRNA,protease,head,terminase,integrase,tail,portal	Salmonella_phage(64.81%)	93	3589429:3589447	3626929:3626947
AWF03996.1|3545638_3547360_+	thiol reductant ABC exporter, CydC subunit	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWF04787.1|3547404_3548106_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWF06421.1|3548459_3548678_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWF06945.1|3548798_3551045_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWF04190.1|3551108_3551426_-|protease	ATP-dependent Clp protease adaptor ClpS family protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWF04850.1|3551751_3551973_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWF06052.1|3552049_3553990_-	macrolide export ATP-binding/permease protein MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWF08032.1|3553986_3555102_-	macrolide-specific efflux protein MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWF07237.1|3555248_3556907_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07951.1|3557099_3557273_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08252.1|3557326_3558022_+	aquaporin Z	NA	NA	NA	NA	NA
AWF03958.1|3558018_3558132_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07046.1|3558137_3559037_+	hypothetical protein	NA	NA	NA	NA	NA
AWF03759.1|3559180_3560833_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWF06283.1|3560843_3561812_+	NADH oxidoreductase hcr	NA	NA	NA	NA	NA
AWF06854.1|3562023_3562458_-	doxX family protein	NA	NA	NA	NA	NA
AWF07681.1|3562609_3564328_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWF08651.1|3564366_3565368_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWF03784.1|3565378_3566821_+	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	NA	NA	NA	NA
AWF03788.1|3566908_3567922_+	3-beta hydroxysteroid dehydrogenase/isomerase family protein	NA	NA	NA	NA	NA
AWF06734.1|3567918_3568749_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWF04196.1|3568780_3569920_-	diguanylate cyclase domain protein	NA	NA	NA	NA	NA
AWF03476.1|3570797_3571313_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04172.1|3571539_3572268_+	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWF06418.1|3572288_3573020_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWF05810.1|3573026_3573743_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWF07095.1|3573742_3574411_+	amino ABC transporter, permease, 3-TM region, His/Glu/Gln/Arg/opine family domain protein	NA	NA	NA	NA	NA
AWF05552.1|3574594_3575326_+	lysine-arginine-ornithine-binding periplasmic family protein	NA	NA	NA	NA	NA
AWF03549.1|3575368_3576841_-	his Kinase A domain protein	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWF03663.1|3576837_3577554_-	response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWF07153.1|3577632_3578760_-	23S rRNA (uracil-5-)-methyltransferase RumB	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWF03735.1|3578801_3579290_-	inner membrane protein YbjO	NA	NA	NA	NA	NA
AWF04286.1|3579347_3580193_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWF07969.1|3580189_3581143_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWF03855.1|3581153_3582287_-	polyamine ABC transporter, ATP-binding family protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWF06824.1|3582450_3583563_-	putative lipo family protein	NA	NA	NA	NA	NA
AWF04144.1|3583911_3584391_-	bacterial sensory transduction regulator family protein	NA	NA	NA	NA	NA
AWF06577.1|3584479_3585382_-	alpha-L-glutamate ligase, RimK family protein	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWF06241.1|3585496_3585826_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWF06106.1|3586061_3586220_-	NADPH-flavin oxidoreductase domain protein	NA	NA	NA	NA	NA
AWF05845.1|3586203_3586491_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05824.1|3586693_3586957_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWF07013.1|3586963_3587347_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
AWF04389.1|3587613_3589299_+	aspT/YidE/YbjL antiporter duplication domain protein	NA	NA	NA	NA	NA
AWF06307.1|3589290_3589404_-	hypothetical protein	NA	NA	NA	NA	NA
3589429:3589447	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWF08249.1|3589518_3589674_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	65.3	3.8e-10
AWF07693.1|3589828_3590929_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWF08367.1|3590925_3591411_-	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWF06790.1|3591407_3594035_-|tail	phage tail tape measure protein, TP901 family, core region	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWF06573.1|3594027_3594147_-	phage P2 GpE family protein	NA	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWF03824.1|3594161_3594461_-	mu-like prophage FluMu gp41 family protein	NA	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWF05880.1|3594513_3595029_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWF04322.1|3595038_3596211_-|tail	phage tail sheath family protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWF03899.1|3596349_3597426_-|tail	phage tail-collar fiber family protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AWF07647.1|3597455_3597659_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06147.1|3597655_3598387_-	concanavalin A-like lectin/glucanases superfamily protein	NA	NA	NA	NA	NA
AWF08621.1|3598390_3601342_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWF05917.1|3601343_3601943_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWF07251.1|3601935_3602844_-|plate	baseplate J-like family protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWF07668.1|3602830_3603193_-	lysozyme family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AWF07906.1|3603189_3603762_-|plate	phage baseplate assembly V family protein	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWF04136.1|3603876_3604041_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08447.1|3604039_3604549_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08006.1|3604545_3604950_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	72.0	4.3e-45
AWF07465.1|3604984_3605416_-|tail	P2 phage tail completion R family protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWF07838.1|3605378_3605525_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
AWF06316.1|3605511_3605940_-|lysis	phage lysis regulatory, LysB family protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWF05643.1|3605936_3606320_-	putative membrane protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWF06365.1|3606324_3606834_-	phage lysozyme family protein	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWF04818.1|3606814_3606937_-	putative secretory protein	NA	E5G6N0	Salmonella_phage	85.0	2.9e-13
AWF07099.1|3607033_3607237_-	phage Tail Protein X family protein	NA	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWF06625.1|3607236_3607701_-|head	phage head completion family protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWF04798.1|3607796_3608447_-|terminase	phage small terminase subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWF06677.1|3608450_3609509_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWF06031.1|3609525_3610359_-|capsid	phage capsid scaffolding (GPO) serine peptidase family protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWF03762.1|3610501_3612268_+	sigma-70, region 4 family protein	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWF07491.1|3612267_3613293_+|portal	phage portal protein, PBSX family	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWF06394.1|3613354_3615097_-	AIPR family protein	NA	NA	NA	NA	NA
AWF08535.1|3615372_3615561_-	putative fels-2 prophage protein	NA	NA	NA	NA	NA
AWF06479.1|3616164_3616398_-	dinI-like family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWF03935.1|3616408_3616597_-	putative levan regulatory protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWF06603.1|3616750_3619165_-	bacteriophage replication protein A	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AWF08170.1|3619161_3620019_-	DNA adenine methylase family protein	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AWF08189.1|3620015_3620243_-	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWF08167.1|3620242_3620476_-	hypothetical protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AWF03350.1|3620543_3620885_-	putative fels-2 prophage protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWF05088.1|3620848_3621049_-	protein fil	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AWF07038.1|3621056_3621566_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWF07915.1|3621592_3621745_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06772.1|3621965_3622844_+	bacteriophage CI repressor helix-turn-helix domain protein	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AWF05227.1|3622855_3623800_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08088.1|3623898_3625383_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWF07958.1|3625801_3626854_+|integrase	phage integrase family protein	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3626929:3626947	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4070089	4118438	5439007	lysis,coat,tRNA,terminase,integrase	Cronobacter_phage(27.08%)	60	4066376:4066422	4115510:4115556
4066376:4066422	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWF04171.1|4070089_4072996_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	50.0	1.6e-19
AWF06157.1|4073163_4075641_-	hypothetical protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AWF05343.1|4075627_4076023_-	nlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AWF06464.1|4076019_4076490_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AWF03706.1|4076489_4076966_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
AWF08568.1|4077008_4080455_-	tape measure domain protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AWF03247.1|4080547_4080805_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06237.1|4081178_4081964_-	BRO family, N-terminal domain protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AWF06519.1|4082029_4082743_-	BRO family, N-terminal domain protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AWF08595.1|4082732_4082903_-	hicB family protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AWF05578.1|4083164_4083362_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04890.1|4083378_4083849_-	hypothetical protein	NA	NA	NA	NA	NA
AWF04938.1|4084142_4084322_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	65.8	3.5e-07
AWF04045.1|4084399_4085155_-	kilA-N domain protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AWF05201.1|4085330_4086008_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AWF07970.1|4086060_4086813_-	bacterial Ig-like domain family protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AWF07997.1|4086881_4087115_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	47.4	4.3e-13
AWF04232.1|4087270_4087696_-	putative gp14	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AWF04071.1|4087698_4088061_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AWF06300.1|4088233_4088614_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AWF03800.1|4088616_4088856_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05287.1|4088866_4089961_-|coat	putative phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AWF07754.1|4089972_4090401_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AWF04298.1|4090404_4091790_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AWF08176.1|4091862_4092267_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08337.1|4092380_4093280_-	phage Mu F like family protein	NA	F1C5D8	Cronobacter_phage	69.7	8.0e-116
AWF08591.1|4093359_4094781_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AWF04450.1|4094793_4096266_-|terminase	putative terminase large subunit	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AWF08158.1|4096265_4096868_-	putative dNA repair protein RecN	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AWF05672.1|4097084_4097246_+	hypothetical protein	NA	NA	NA	NA	NA
AWF06143.1|4097238_4097568_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04240.1|4097673_4098138_-|lysis	bacteriophage lysis family protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AWF04413.1|4098134_4098665_-	phage lysozyme family protein	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AWF04428.1|4098667_4098916_-|lysis	lysis S family protein	lysis	NA	NA	NA	NA
AWF08636.1|4099825_4100515_-	phage antitermination Q family protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AWF04491.1|4101168_4101804_-	bacteriophage Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AWF07907.1|4101796_4101967_-	putative NinE-like protein from lambdoid prophage DLP12	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AWF03703.1|4101966_4102422_-	putative phage protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AWF04729.1|4102922_4103570_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AWF05435.1|4103742_4104585_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AWF07709.1|4104581_4104695_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05551.1|4104691_4105198_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AWF04084.1|4105194_4105407_-	putative protein ren	NA	O48423	Enterobacteria_phage	69.2	9.9e-17
AWF03648.1|4105487_4106918_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AWF04771.1|4106907_4107759_-	putative replication protein O	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
AWF06815.1|4107799_4107946_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05230.1|4108031_4108253_-	bacteriophage CII family protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWF04210.1|4109161_4109344_+	hypothetical protein	NA	A0A2I6PIE7	Escherichia_phage	66.1	1.5e-18
AWF04168.1|4109694_4109910_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AWF06235.1|4110009_4110204_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04448.1|4110292_4110577_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AWF03278.1|4110607_4111438_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.8e-69
AWF06973.1|4111434_4112115_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AWF06404.1|4112266_4112923_+	MT-A70 family protein	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AWF06909.1|4112919_4113687_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AWF05233.1|4113903_4114119_+	phage/conjugal plasmid C-4 type zinc finger, TraR family protein	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AWF04361.1|4114332_4115496_+|integrase	phage integrase family protein	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
AWF07315.1|4115926_4116793_+	bifunctional protein FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4115510:4115556	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWF05539.1|4116794_4117007_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04773.1|4117052_4118438_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4327992	4339646	5439007	integrase,capsid	Enterobacteria_phage(70.0%)	15	4327844:4327857	4332057:4332070
4327844:4327857	attL	TCTGACATATTTTT	NA	NA	NA	NA
AWF06907.1|4327992_4329096_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AWF07258.1|4329106_4330360_+	gamma-glutamyl phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWF04725.1|4330712_4331903_+|integrase	phage integrase family protein	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWF05840.1|4331890_4332841_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4332057:4332070	attR	AAAAATATGTCAGA	NA	NA	NA	NA
AWF05846.1|4332840_4333266_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04831.1|4333612_4333762_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07163.1|4333834_4334401_-	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AWF04687.1|4334418_4334664_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AWF04158.1|4334660_4335398_-|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AWF07100.1|4335697_4335835_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06647.1|4335939_4336206_+	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWF07608.1|4336565_4336760_+	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	3.2e-22
AWF07428.1|4336804_4336984_+	hypothetical protein	NA	NA	NA	NA	NA
AWF04515.1|4336980_4337301_+	putative dNA replication protein	NA	NA	NA	NA	NA
AWF05105.1|4337312_4339646_+	putative P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	4806035	4813717	5439007	capsid,integrase,transposase	Enterobacteria_phage(85.71%)	12	4798958:4798972	4810792:4810806
4798958:4798972	attL	ACCTCCGCCACCGGC	NA	NA	NA	NA
AWF06774.1|4806035_4806515_-|integrase	integrase core domain protein	integrase	A0A0N9SIX5	Staphylococcus_phage	29.7	1.6e-06
AWF04038.1|4806647_4806803_+	hypothetical protein	NA	NA	NA	NA	NA
AWF05962.1|4806880_4807147_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF03685.1|4807743_4807860_-	hypothetical protein	NA	NA	NA	NA	NA
AWF06571.1|4807892_4810226_-	zinc-binding domain of primase-helicase family protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AWF05881.1|4810240_4810561_-	DNA replication protein, phage-associated	NA	NA	NA	NA	NA
AWF08143.1|4810557_4810785_-	hypothetical protein	NA	NA	NA	NA	NA
AWF07365.1|4810781_4810976_-	putative phage immunity repressor protein	NA	Q7M2A7	Enterobacteria_phage	85.5	7.2e-22
4810792:4810806	attR	ACCTCCGCCACCGGC	NA	NA	NA	NA
AWF04712.1|4811326_4811593_-	prophage CP4-57 regulatory family protein	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AWF06216.1|4812153_4812891_+|capsid	putative glyco3, capsid size determination protein Sid	capsid	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AWF05159.1|4812887_4813133_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWF05232.1|4813150_4813717_+	polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 12
CP029099	Klebsiella pneumoniae strain AR438 chromosome, complete genome	5439007	5008856	5013943	5439007	transposase	Escherichia_phage(33.33%)	8	NA	NA
AWF07162.1|5008856_5009540_+	integral membrane, YjbE family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
AWF08536.1|5009496_5009610_-	hypothetical protein	NA	NA	NA	NA	NA
AWF05467.1|5009685_5010603_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AWF08278.1|5010602_5010908_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AWF03795.1|5011076_5011598_+|transposase	transposase family protein	transposase	A0A1B1P776	Bacillus_phage	33.5	1.3e-14
AWF08311.1|5011654_5012440_+	DDE domain protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	67.7	3.3e-73
AWF07664.1|5012605_5012977_-	plasmid stability family protein	NA	A0A222YWJ6	Escherichia_phage	53.7	2.8e-22
AWF05456.1|5012986_5013943_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 1
CP029100	Klebsiella pneumoniae strain AR438 plasmid unnamed2	29625	7580	18567	29625	transposase	Escherichia_phage(60.0%)	11	NA	NA
AWF08701.1|7580_8114_-|transposase	tn3 transposase DDE domain protein	transposase	Q1MVP5	Enterobacteria_phage	100.0	3.5e-95
AWF08704.1|8269_11287_+	hypothetical protein	NA	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AWF08715.1|11273_11855_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.2	8.3e-82
AWF08688.1|11851_12484_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	98.9	8.5e-96
AWF08713.1|12495_13398_-	3-hydroxyacyl-CoA dehydrogenase, NAD binding domain protein	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWF08692.1|13659_14421_+	HTH domain protein	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWF08703.1|14441_15302_-	beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWF08685.1|15438_16143_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWF08684.1|16511_16751_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08698.1|16861_17524_-	resolvase, N terminal domain protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AWF08697.1|17904_18567_+	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 1
CP029101	Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence	208035	4963	45972	208035	integrase,transposase,holin	Macacine_betaherpesvirus(14.29%)	40	12005:12021	43068:43084
AWF08888.1|4963_6043_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF08916.1|6650_6866_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08887.1|6973_7702_-	psiA family protein	NA	NA	NA	NA	NA
AWF08752.1|7698_8130_-	plasmid SOS inhibition family protein	NA	NA	NA	NA	NA
AWF08855.1|8196_10233_-	parB-like nuclease domain protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
AWF08837.1|10302_10551_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08849.1|10599_11142_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
AWF08777.1|11917_12481_-	methyltransferase small domain protein	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
12005:12021	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
AWF08748.1|12528_13884_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08904.1|13935_14166_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08800.1|14257_14485_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08770.1|14448_14586_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08909.1|15268_15580_-	putative membrane protein	NA	NA	NA	NA	NA
AWF08859.1|15620_15875_-	hot	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
AWF08753.1|16111_16537_-	antirestriction family protein	NA	NA	NA	NA	NA
AWF08796.1|17057_17288_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08761.1|17521_19006_-	reverse transcriptase family protein	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWF08719.1|19411_19837_+	peptidase S24-like family protein	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AWF08878.1|19836_21108_+	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AWF08824.1|21246_21402_+	antitoxin, type II toxin-antitoxin system family protein	NA	NA	NA	NA	NA
AWF08894.1|21424_22282_-|transposase	transposase, IS605 OrfB family	transposase	A0A1B0VCD8	Salmonella_phage	80.9	1.0e-128
AWF08735.1|22278_22563_-|transposase	putative transposase family protein	transposase	A0A1W6JP07	Morganella_phage	86.8	1.0e-40
AWF08864.1|23097_24060_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08724.1|24059_25031_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AWF08737.1|25030_26197_-	cobQ/CobB/MinD/ParA nucleotide binding domain protein	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AWF08883.1|27260_27959_+	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	55.7	5.2e-54
AWF08755.1|28675_29416_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AWF08744.1|30550_31507_+	diguanylate cyclase domain protein	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AWF08764.1|31533_31659_-	EAL domain protein	NA	NA	NA	NA	NA
AWF08863.1|31909_32833_+|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AWF08868.1|34982_35819_+	EAL domain protein	NA	NA	NA	NA	NA
AWF08857.1|36801_38079_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08884.1|38141_40139_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWF08847.1|40290_40794_-|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	93.2	1.6e-84
AWF08785.1|41178_41994_-	HTH-like domain protein	NA	Q9ZXG3	Shigella_phage	62.8	1.5e-92
AWF08749.1|42017_42413_-|transposase	transposase family protein	transposase	Q76S41	Shigella_phage	75.4	1.4e-43
AWF08767.1|42565_42961_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	92.4	5.7e-66
AWF08791.1|43114_43519_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
43068:43084	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
AWF08913.1|43814_44246_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWF08812.1|44496_45972_-	heavy metal sensor kinase family protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
>prophage 2
CP029101	Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence	208035	65568	108756	208035	transposase,integrase	Escherichia_phage(36.84%)	50	59986:60002	100551:100567
59986:60002	attL	TGGCCGCTGGGCGTATC	NA	NA	NA	NA
AWF08732.1|65568_65883_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
AWF08718.1|66373_67189_-|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	A9YX10	Burkholderia_phage	25.9	1.7e-11
AWF08899.1|67355_67760_+	major intrinsic family protein	NA	NA	NA	NA	NA
AWF08845.1|67809_68307_-	acetyltransferase family protein	NA	NA	NA	NA	NA
AWF08911.1|68638_68965_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AWF08818.1|69231_69675_+	NADPH-dependent FMN reductase family protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	78.9	7.8e-64
AWF08804.1|69683_70229_+	RNA polymerase sigma factor, sigma-70 family protein	NA	NA	NA	NA	NA
AWF08846.1|70304_70667_+	arsenical resistance operon trans-acting repressor ArsD family protein	NA	NA	NA	NA	NA
AWF08786.1|70691_72026_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWF08756.1|72055_72442_+	anion-transporting ATPase family protein	NA	NA	NA	NA	NA
AWF08811.1|72563_73100_+	acetyltransferase domain protein	NA	NA	NA	NA	NA
AWF08873.1|73132_73558_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWF08885.1|73570_74860_-	arsenite/antimonite efflux pump membrane family protein	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWF08844.1|74907_76659_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWF08740.1|76676_77039_-	arsenical resistance operon trans-acting repressor ArsD	NA	NA	NA	NA	NA
AWF08862.1|77088_77439_-	bacterial regulatory, arsR family protein	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWF08810.1|77796_78066_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08723.1|78053_78629_+	putative ydeA	NA	NA	NA	NA	NA
AWF08790.1|78659_79154_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08783.1|79599_79803_+	hemolysin expression-modulating protein Hha	NA	NA	NA	NA	NA
AWF08768.1|80184_80439_+	putative yaeB	NA	NA	NA	NA	NA
AWF08870.1|80722_80881_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08823.1|81550_82909_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
AWF08897.1|83409_84021_-|integrase	integrase core domain protein	integrase	A0A2I6AZV9	Macacine_betaherpesvirus	45.9	4.0e-42
AWF08803.1|84131_84437_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF08881.1|84751_85714_-	peptidase M48 family protein	NA	NA	NA	NA	NA
AWF08751.1|85700_86135_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AWF08730.1|86687_86885_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08882.1|86884_89680_-	AAA domain protein	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWF08906.1|89794_90364_-	hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWF08835.1|90382_90520_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08903.1|91652_91775_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08779.1|91904_92408_+|transposase	putative transposase	transposase	U5P0U6	Shigella_phage	92.2	1.8e-88
AWF08896.1|92666_93647_+	hypothetical protein	NA	Q38213	Escherichia_phage	99.1	8.9e-185
AWF08833.1|94112_94748_-	hypothetical protein	NA	Q38213	Escherichia_phage	52.8	1.2e-33
AWF08819.1|94855_95722_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AWF08865.1|95718_96729_-	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AWF08773.1|96737_97565_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWF08781.1|97573_98437_-	phosphate/phosphite/phosphonate ABC transporter, periplasmic binding family protein	NA	NA	NA	NA	NA
AWF08834.1|98433_99021_-	ABC transporter family protein	NA	G9BWD6	Planktothrix_phage	38.9	1.2e-14
AWF08893.1|99602_99923_+	hypothetical protein	NA	Q38213	Escherichia_phage	52.9	3.2e-27
AWF08742.1|100116_100821_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
100551:100567	attR	GATACGCCCAGCGGCCA	NA	NA	NA	NA
AWF08900.1|100811_102077_+|transposase	tn3 transposase DDE domain protein	transposase	A0A1B0V7H9	Salmonella_phage	67.1	5.4e-142
AWF08789.1|102187_102793_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	99.5	6.4e-117
AWF08901.1|102982_103798_-	phosphotransferase enzyme family protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AWF08787.1|103948_104653_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF08861.1|104774_105680_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AWF08821.1|105676_106915_+	major Facilitator Superfamily protein	NA	NA	NA	NA	NA
AWF08874.1|106914_107499_+	erythromycin resistance repressor protein	NA	NA	NA	NA	NA
AWF08797.1|107991_108756_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 3
CP029101	Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence	208035	114175	169602	208035	integrase,transposase,bacteriocin	Stx2-converting_phage(23.81%)	45	105526:105542	164544:164560
105526:105542	attL	ATGAAGCGGCCGGTGGC	NA	NA	NA	NA
AWF08872.1|114175_115189_+|integrase	integron integrase family protein	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWF08802.1|115541_115742_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08716.1|115867_116428_+	resolvase, N terminal domain protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWF08792.1|116430_119397_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AWF08866.1|119463_119841_+	acetyltransferase family protein	NA	NA	NA	NA	NA
AWF08763.1|120041_120701_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AWF08806.1|121173_121677_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AWF08895.1|121917_123297_+	4Fe-4S single cluster domain protein	NA	S5VT21	Leptospira_phage	28.8	2.4e-50
AWF08850.1|123289_124402_+	4Fe-4S single cluster domain protein	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AWF08734.1|125964_126312_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AWF08840.1|126361_127336_+|transposase	transposase IS66 family protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.8	2.7e-149
AWF08880.1|127380_127899_+|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.1	1.7e-86
AWF08886.1|127966_128314_+|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.3	2.6e-62
AWF08774.1|130134_131868_-	nickel import ATP-binding protein NikE	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AWF08757.1|131875_132823_-	acetamidase/Formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AWF08831.1|132867_134472_-	bacterial extracellular solute-binding, 5 Middle family protein	NA	NA	NA	NA	NA
AWF08750.1|134484_135405_-	binding-protein-dependent transport system inner membrane component family protein	NA	NA	NA	NA	NA
AWF08726.1|135404_136253_-	N-terminal TM domain of oligopeptide transport permease C family protein	NA	NA	NA	NA	NA
AWF08801.1|136249_136843_-	response regulator	NA	NA	NA	NA	NA
AWF08822.1|136839_137967_-	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF08782.1|138251_138419_-|integrase	putative integrase catalytic region	integrase	NA	NA	NA	NA
AWF08722.1|138677_139046_+	putative tnpA	NA	U5N3F9	Enterobacteria_phage	89.9	2.4e-58
AWF08720.1|139521_140043_+	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AWF08775.1|140039_140993_+	fecR family protein	NA	NA	NA	NA	NA
AWF08784.1|141078_143403_+	fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AWF08836.1|143447_144350_+	periplasmic binding family protein	NA	NA	NA	NA	NA
AWF08738.1|144346_145345_+	ABC 3 transport family protein	NA	NA	NA	NA	NA
AWF08729.1|145341_146298_+	fe(3+) dicitrate transport system permease protein FecD	NA	NA	NA	NA	NA
AWF08815.1|146298_147066_+	ABC transporter family protein	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AWF08871.1|147164_147458_+|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AWF08825.1|147505_147625_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08910.1|147788_147914_-	EAL domain protein	NA	NA	NA	NA	NA
AWF08820.1|148409_149420_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWF08839.1|149442_149658_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08838.1|149880_150963_+	periplasmic binding and sugar binding domain of LacI family protein	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
AWF08816.1|151084_154159_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
AWF08860.1|154210_155464_+	lactose permease	NA	NA	NA	NA	NA
AWF08891.1|155600_156212_+|transposase	transposase DDE domain protein	transposase	Q9MCT5	Escherichia_phage	99.4	3.5e-99
AWF08793.1|156315_156525_+|transposase	transposase family protein	transposase	Q9MCT5	Escherichia_phage	98.6	4.1e-31
AWF08830.1|157169_159479_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AWF08898.1|159482_160799_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08762.1|160795_162991_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
AWF08843.1|164437_165295_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
164544:164560	attR	ATGAAGCGGCCGGTGGC	NA	NA	NA	NA
AWF08747.1|166180_166561_-	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	37.9	5.2e-16
AWF08745.1|167280_169602_-|bacteriocin	DNase/tRNase domain of colicin-like bacteriocin family protein	bacteriocin	NA	NA	NA	NA
>prophage 1
CP029102	Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence	135655	21104	33196	135655		Escherichia_phage(25.0%)	10	NA	NA
AWF08920.1|21104_21734_-	DNA methylase family protein	NA	A0A2I7RE86	Vibrio_phage	36.0	1.5e-20
AWF09038.1|22242_22410_-	putative membrane protein	NA	NA	NA	NA	NA
AWF09028.1|22533_23205_-	plasmid stability family protein	NA	NA	NA	NA	NA
AWF09003.1|23207_24182_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
AWF09015.1|24410_24842_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AWF08954.1|24841_26113_+	IMS HHH motif family protein	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AWF09020.1|26513_27410_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AWF09048.1|27794_28937_+	plasmid partition protein A	NA	Q1MVJ3	Enterobacteria_phage	90.0	7.6e-196
AWF09009.1|28933_29908_+	parB	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AWF08939.1|31168_33196_+	hsdM N-terminal domain protein	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
CP029102	Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence	135655	37771	109307	135655	transposase,holin,integrase	Escherichia_phage(29.03%)	73	51093:51152	105935:106372
AWF08982.1|37771_39040_+|transposase	helix-turn-helix domain of transposase ISL3 family protein	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
AWF08941.1|40345_40462_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09006.1|40846_41629_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AWF08972.1|41628_41961_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09050.1|41967_42324_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09041.1|42391_42670_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08928.1|42748_43021_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09010.1|43102_43222_-	hypothetical protein	NA	NA	NA	NA	NA
AWF09022.1|43543_43978_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08944.1|43961_44192_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
AWF09057.1|44188_44605_+	PIN domain protein	NA	NA	NA	NA	NA
AWF08971.1|44699_45389_+	AAA domain protein	NA	NA	NA	NA	NA
AWF08929.1|45473_45698_+	insA N-terminal domain protein	NA	A0A2L1IV22	Escherichia_phage	94.6	1.7e-35
AWF08947.1|45742_46120_+|transposase	putative transposase	transposase	Q71TF0	Escherichia_phage	93.6	1.9e-63
AWF08938.1|46281_46704_+	merC mercury resistance family protein	NA	NA	NA	NA	NA
AWF08965.1|46755_48450_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWF09054.1|48467_48830_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWF08932.1|48826_49063_+	merE family protein	NA	NA	NA	NA	NA
AWF08977.1|49059_49767_+	EAL domain protein	NA	NA	NA	NA	NA
AWF09031.1|50057_51110_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
51093:51152	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AWF09017.1|51156_51567_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.9e-72
AWF08990.1|51677_52538_-	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWF08970.1|52720_52843_-	helix-turn-helix domain of resolvase family protein	NA	Q1MVP4	Enterobacteria_phage	97.5	1.0e-13
AWF09030.1|53726_54077_-	beta-lactamase OXA-18 domain protein	NA	NA	NA	NA	NA
AWF09027.1|54281_54986_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWF09032.1|55058_57956_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AWF08921.1|58044_58665_+	resolvase, N terminal domain protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AWF08961.1|58814_59174_+	putative membrane protein	NA	NA	NA	NA	NA
AWF09036.1|59463_59598_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08981.1|59830_60190_-	hypothetical protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AWF09044.1|60361_60583_-|transposase	putative transposase	transposase	A0A1V0E8E1	Vibrio_phage	64.3	2.4e-13
AWF08986.1|60693_61908_+	DDE_Tnp_1-associated family protein	NA	NA	NA	NA	NA
AWF08968.1|62153_63473_+	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWF08955.1|63722_64604_-	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWF08959.1|64891_65671_-	phoH-like family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWF09008.1|65667_66672_-|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.8	8.7e-87
AWF09023.1|66799_69775_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08964.1|69938_71654_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWF08930.1|71948_72104_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09002.1|72152_73145_+|holin	choline kinase N terminus family protein	holin	NA	NA	NA	NA
AWF09037.1|73171_73333_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF08992.1|73664_78926_+	conjugative transfer relaxase protein TraI	NA	NA	NA	NA	NA
AWF08953.1|79006_79732_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
AWF09039.1|79803_80397_+	fertility inhibition protein	NA	NA	NA	NA	NA
AWF09043.1|80563_81160_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08963.1|81209_81854_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08975.1|82260_82560_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08996.1|82556_82865_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AWF08922.1|83040_83520_+	endonuclease	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
AWF08976.1|83784_83907_+	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AWF08948.1|84208_85066_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWF08958.1|86284_86848_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AWF08991.1|86831_87443_+	hypothetical protein	NA	NA	NA	NA	NA
AWF08925.1|87651_87813_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AWF09052.1|87839_88832_-|holin	choline kinase N terminus family protein	holin	NA	NA	NA	NA
AWF08997.1|88880_89036_-	hypothetical protein	NA	NA	NA	NA	NA
AWF08984.1|89330_91046_-|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AWF08983.1|91209_94185_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09046.1|94312_95317_+|integrase	integrase core domain protein	integrase	A0A2L1IVA1	Escherichia_phage	50.8	8.7e-87
AWF09058.1|95313_96093_+	phoH-like family protein	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AWF09040.1|96380_97262_+	carbapenem-hydrolyzing beta-lactamase Sme-1	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
AWF08926.1|97511_98831_-	hypothetical protein	NA	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AWF08966.1|99433_100291_-	DDE_Tnp_1-associated family protein	NA	NA	NA	NA	NA
AWF09049.1|100401_100623_+|transposase	putative transposase	transposase	A0A1V0E8E1	Vibrio_phage	64.3	2.4e-13
AWF08919.1|100794_101154_+	hypothetical protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AWF09004.1|101386_101521_+	hypothetical protein	NA	NA	NA	NA	NA
AWF09047.1|101810_102170_-	putative membrane protein	NA	NA	NA	NA	NA
AWF08940.1|102319_102940_-	resolvase, N terminal domain protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AWF09025.1|103028_105926_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AWF08957.1|105998_106703_+|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
105935:106372	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAA	NA	NA	NA	NA
AWF08989.1|106907_107258_+	beta-lactamase OXA-18 domain protein	NA	NA	NA	NA	NA
AWF08973.1|108141_108264_+	helix-turn-helix domain of resolvase family protein	NA	Q1MVP4	Enterobacteria_phage	97.5	1.0e-13
AWF08931.1|108446_109307_+	beta-lactamase TEM	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
