The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029039	Salmonella enterica strain CFSAN045764 chromosome, complete genome	4694399	1141333	1207057	4694399	capsid,head,lysis,integrase,tRNA,tail,plate,portal	Salmonella_phage(89.58%)	67	1142778:1142824	1178070:1178116
AWE28541.1|1141333_1142575_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.1	8.5e-100
1142778:1142824	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWE28542.1|1142940_1144164_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	38.9	3.2e-75
AWE28543.1|1144168_1145188_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.6e-190
AWE28544.1|1145189_1145822_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	95.2	1.2e-110
AWE28545.1|1146217_1146727_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
AWE31841.1|1146734_1146935_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
AWE28546.1|1146898_1147240_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AWE28547.1|1147307_1147541_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
AWE28548.1|1147540_1147768_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	90.7	9.6e-34
AWE28549.1|1147764_1148619_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	76.4	3.0e-120
AWE28550.1|1148615_1149446_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	76.4	9.3e-127
AWE28551.1|1149442_1151818_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	92.3	0.0e+00
AWE28552.1|1151971_1152160_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
AWE28553.1|1152098_1152404_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWE28554.1|1152463_1153195_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28555.1|1153569_1155336_+	hypothetical protein	NA	D0UIM0	Aggregatibacter_phage	34.3	1.5e-78
AWE28556.1|1155377_1156415_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.4	9.7e-182
AWE28557.1|1156414_1158181_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	98.0	0.0e+00
AWE28558.1|1158323_1159157_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	84.1	5.0e-120
AWE28559.1|1159173_1160241_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	4.8e-192
AWE28560.1|1160244_1160895_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	97.2	1.7e-112
AWE28561.1|1160990_1161455_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AWE28562.1|1161454_1161658_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWE28563.1|1161661_1161877_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AWE28564.1|1161857_1162367_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	1.1e-93
AWE28565.1|1162371_1162749_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.8	1.7e-59
AWE28566.1|1162748_1163174_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	5.5e-67
AWE28567.1|1163103_1163307_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	94.0	4.8e-29
AWE28568.1|1163269_1163701_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.7	1.7e-71
AWE28569.1|1163693_1164140_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	2.4e-65
AWE28570.1|1164208_1164787_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	3.9e-108
AWE28571.1|1164783_1165143_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	96.6	1.8e-58
AWE28572.1|1165129_1166038_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.7	1.6e-159
AWE28573.1|1166030_1166636_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	8.3e-117
AWE28574.1|1167923_1168541_+|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	97.9	1.2e-110
AWE28575.1|1168544_1169084_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.8	2.1e-95
AWE28576.1|1169086_1169920_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	97.8	1.3e-157
AWE31842.1|1169855_1170410_-	shikimate transporter	NA	A0A1S6KZZ0	Salmonella_phage	93.3	1.7e-87
AWE28577.1|1170439_1170997_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	97.8	7.2e-99
AWE28578.1|1171099_1172272_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
AWE28579.1|1172281_1172797_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	2.3e-91
AWE28580.1|1172851_1173154_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
AWE28581.1|1173168_1173288_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
AWE28582.1|1173280_1176088_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.6	0.0e+00
AWE28583.1|1176084_1176570_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AWE28584.1|1176566_1177667_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.5	3.5e-190
AWE28585.1|1177735_1177954_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
AWE31843.1|1178505_1179669_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1178070:1178116	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AWE28586.1|1179676_1181857_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AWE28587.1|1181853_1183263_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AWE28588.1|1183327_1194802_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AWE31844.1|1195416_1195899_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AWE28589.1|1196048_1196525_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWE28590.1|1196514_1196805_+	RnfH family protein	NA	NA	NA	NA	NA
AWE28591.1|1196966_1197305_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWE28592.1|1197453_1199115_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AWE28593.1|1199200_1200079_-	NAD(+) kinase	NA	NA	NA	NA	NA
AWE31845.1|1200010_1200205_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AWE28594.1|1200201_1200792_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWE28595.1|1200826_1201432_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWE28596.1|1201552_1202794_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWE28597.1|1202858_1203650_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWE28598.1|1203595_1203892_-	hypothetical protein	NA	NA	NA	NA	NA
AWE28599.1|1203815_1205177_+	signal recognition particle protein	NA	NA	NA	NA	NA
AWE31847.1|1205429_1205678_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWE31846.1|1205696_1206245_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWE28600.1|1206289_1207057_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP029039	Salmonella enterica strain CFSAN045764 chromosome, complete genome	4694399	1468332	1547015	4694399	head,protease,lysis,tRNA,tail,terminase,holin	Salmonella_phage(62.67%)	105	NA	NA
AWE28817.1|1468332_1469271_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AWE28818.1|1469634_1469955_+	helicase	NA	NA	NA	NA	NA
AWE28819.1|1470867_1471674_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWE28820.1|1471684_1472701_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AWE28821.1|1474103_1474307_-	hypothetical protein	NA	C6ZR24	Salmonella_phage	97.0	2.7e-32
AWE28822.1|1474403_1474754_-	hypothetical protein	NA	I6R980	Salmonella_phage	99.1	5.4e-60
AWE28823.1|1474810_1475611_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	97.4	4.1e-156
AWE28824.1|1475653_1475938_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	98.9	7.0e-50
AWE28825.1|1475930_1476851_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	82.9	1.9e-80
AWE28826.1|1477142_1477811_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	73.0	3.1e-40
AWE28827.1|1477807_1478323_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	98.8	1.1e-96
AWE28828.1|1478432_1479014_-	Eae-like protein	NA	A0A0N6WGF1	Salmonella_phage	72.0	2.8e-69
AWE28829.1|1479010_1479181_-	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AWE28830.1|1479191_1479485_-	DUF2856 domain-containing protein	NA	E7C9P8	Salmonella_phage	97.9	2.1e-49
AWE28831.1|1479531_1479816_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
AWE28832.1|1479815_1480523_-	recombinase	NA	I6R0N0	Salmonella_phage	87.6	5.2e-118
AWE28833.1|1480652_1480841_-	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
AWE31857.1|1480821_1480995_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AWE28834.1|1481064_1481379_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
AWE28835.1|1481550_1482165_-	pentapeptide repeat-containing protein	NA	A0A220NQW1	Salmonella_phage	70.6	3.2e-47
AWE28836.1|1482248_1482494_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	62.3	2.5e-19
AWE28837.1|1482501_1482834_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	96.4	4.6e-53
AWE31858.1|1483184_1483847_-	helix-turn-helix domain-containing protein	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
AWE28838.1|1483965_1484181_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
AWE28839.1|1484291_1484573_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AWE28840.1|1484607_1484754_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AWE28841.1|1484746_1485580_+	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.2	2.3e-149
AWE28842.1|1485576_1486953_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	98.9	4.1e-252
AWE28843.1|1487025_1487232_+	hypothetical protein	NA	I6RSI5	Salmonella_phage	98.5	5.3e-31
AWE28844.1|1487410_1487677_+	hypothetical protein	NA	Q716C8	Shigella_phage	61.2	3.1e-23
AWE28845.1|1487679_1487868_+	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	90.3	3.7e-23
AWE28846.1|1487824_1488271_+	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	98.6	2.3e-79
AWE28847.1|1488267_1488441_+	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AWE28848.1|1488407_1488584_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	98.3	2.3e-27
AWE28849.1|1488586_1488988_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
AWE28850.1|1488980_1489157_+	protein ninF	NA	I6S668	Salmonella_phage	93.0	3.1e-24
AWE28851.1|1489149_1489368_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
AWE28852.1|1489368_1489659_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
AWE28853.1|1489655_1490051_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	96.9	2.2e-70
AWE28854.1|1490047_1490251_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AWE28855.1|1490320_1490944_+	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
AWE28856.1|1491368_1491707_+	Fis family transcriptional regulator	NA	A0A1W6DXT8	Salmonella_phage	50.0	1.1e-22
AWE28857.1|1491900_1492080_-	hypothetical protein	NA	NA	NA	NA	NA
AWE31859.1|1492086_1492293_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	76.8	6.2e-16
AWE28858.1|1492404_1492731_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AWE28859.1|1492714_1493152_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	96.6	2.6e-72
AWE28860.1|1493148_1493610_+|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	79.3	4.5e-54
AWE28861.1|1493828_1494350_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	98.8	5.5e-93
AWE28862.1|1494814_1495246_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
AWE28863.1|1495229_1496549_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	99.1	4.6e-261
AWE28864.1|1496610_1496877_+	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	100.0	8.3e-45
AWE28865.1|1497117_1498467_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	98.9	9.1e-257
AWE28866.1|1498426_1499353_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	97.7	2.2e-169
AWE28867.1|1499355_1500621_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	97.1	2.0e-229
AWE28868.1|1500633_1501083_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
AWE28869.1|1501100_1502177_+	hypothetical protein	NA	I6RSK5	Salmonella_phage	99.7	9.0e-207
AWE28870.1|1502186_1502366_+	glycoprotein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
AWE28871.1|1502417_1502819_+	hypothetical protein	NA	I6S619	Salmonella_phage	97.7	7.8e-71
AWE28872.1|1502818_1503007_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	100.0	1.4e-30
AWE28873.1|1502990_1503353_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	99.2	1.2e-67
AWE28874.1|1503360_1503756_+	hypothetical protein	NA	I6RSK8	Salmonella_phage	99.2	5.5e-69
AWE28875.1|1503752_1504139_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	97.7	3.8e-67
AWE28876.1|1504154_1504892_+	hypothetical protein	NA	Q5G8X3	Enterobacteria_phage	98.0	2.3e-129
AWE28877.1|1504937_1505591_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.2	3.3e-119
AWE28878.1|1505812_1506541_+	DNA-binding protein	NA	I6S1R0	Salmonella_phage	98.8	3.4e-141
AWE28879.1|1506582_1506960_-	Arc family DNA-binding protein	NA	I6RSL2	Salmonella_phage	100.0	1.3e-64
AWE28880.1|1507075_1507246_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	100.0	5.7e-23
AWE28881.1|1507238_1508213_+	phage antirepressor Ant	NA	I6S627	Salmonella_phage	99.7	3.8e-188
AWE28882.1|1508318_1508963_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28883.1|1509031_1512226_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	58.1	1.1e-255
AWE28884.1|1512253_1512475_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28885.1|1512531_1512879_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	97.4	2.2e-61
AWE28886.1|1512875_1513163_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28887.1|1513205_1513910_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	1.6e-135
AWE28888.1|1513909_1514629_+|tail	phage tail protein	tail	I6S1R8	Salmonella_phage	92.1	7.3e-136
AWE28889.1|1514571_1515099_+|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	93.8	6.4e-65
AWE28890.1|1515108_1518288_+	DUF1983 domain-containing protein	NA	A0A1V0E5M1	Salmonella_phage	96.0	0.0e+00
AWE28891.1|1518296_1519256_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	1.4e-182
AWE28892.1|1519266_1520565_+|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.5	4.5e-245
AWE28893.1|1520636_1521806_-	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	99.2	2.7e-228
AWE28894.1|1522119_1523061_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.1e-147
AWE28895.1|1523349_1524105_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AWE28896.1|1524165_1525473_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AWE28897.1|1525843_1526128_+	DUF406 family protein	NA	NA	NA	NA	NA
AWE28898.1|1526305_1527616_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AWE28899.1|1527615_1529763_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AWE28900.1|1529971_1530457_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AWE28901.1|1530556_1531108_-	endonuclease SmrB	NA	NA	NA	NA	NA
AWE28902.1|1531273_1532206_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWE28903.1|1532241_1533327_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AWE28904.1|1533330_1534155_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AWE28905.1|1534154_1534964_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28906.1|1534963_1535512_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AWE28907.1|1535544_1535820_+	YfcL family protein	NA	NA	NA	NA	NA
AWE28908.1|1535871_1537932_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AWE28909.1|1538031_1539246_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AWE28910.1|1539343_1540000_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWE28911.1|1540066_1540585_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AWE28912.1|1540796_1540979_-	DNA-binding protein	NA	NA	NA	NA	NA
AWE28913.1|1541151_1541526_+	hypothetical protein	NA	NA	NA	NA	NA
AWE28914.1|1541705_1542884_+	MFS transporter	NA	NA	NA	NA	NA
AWE28915.1|1542880_1543882_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AWE28916.1|1543985_1545122_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
AWE28917.1|1545189_1546203_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWE28918.1|1546202_1547015_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
CP029039	Salmonella enterica strain CFSAN045764 chromosome, complete genome	4694399	1746594	1755768	4694399	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AWE29111.1|1746594_1747542_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AWE29112.1|1747525_1748257_+	ABC transporter permease	NA	NA	NA	NA	NA
AWE29113.1|1748237_1748345_-	hypothetical protein	NA	NA	NA	NA	NA
AWE29114.1|1748404_1749136_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AWE31865.1|1749361_1751047_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.9	3.4e-277
AWE29115.1|1751043_1751763_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWE29116.1|1751809_1752277_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AWE29117.1|1752333_1752864_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AWE29118.1|1753035_1753494_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AWE29119.1|1753734_1755768_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
CP029039	Salmonella enterica strain CFSAN045764 chromosome, complete genome	4694399	1912941	1920208	4694399		Morganella_phage(33.33%)	8	NA	NA
AWE29264.1|1912941_1913361_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AWE29265.1|1913363_1914632_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
AWE29266.1|1915086_1915299_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AWE31872.1|1915309_1915498_+	cold-shock protein	NA	NA	NA	NA	NA
AWE29267.1|1915756_1916968_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	2.6e-109
AWE29268.1|1917617_1917917_+	hypothetical protein	NA	NA	NA	NA	NA
AWE29269.1|1918008_1918704_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
AWE29270.1|1918777_1920208_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
CP029039	Salmonella enterica strain CFSAN045764 chromosome, complete genome	4694399	2718402	2722822	4694399		Escherichia_phage(50.0%)	6	NA	NA
AWE30048.1|2718402_2718642_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	2.5e-32
AWE31907.1|2719521_2720331_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AWE30049.1|2720403_2720781_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AWE30050.1|2720928_2721471_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	66.5	8.1e-71
AWE30051.1|2721663_2722392_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
AWE30052.1|2722408_2722822_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
