The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028950	Enterobacter cloacae complex sp. FDA-CDC-AR_0164 chromosome, complete genome	4849791	263139	320842	4849791	protease,transposase,lysis,capsid,integrase,terminase,head,tRNA,portal,tail	Enterobacteria_phage(30.3%)	63	262611:262634	295494:295517
262611:262634	attL	AATGGCACGCCCTGTAGGATTCGA	NA	NA	NA	NA
AWC83132.1|263139_264441_-|tail	phage tail protein	tail	A0A220NRP2	Escherichia_phage	45.9	5.8e-83
AWC83133.1|264505_265474_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.8	1.0e-55
AWC87311.1|265477_268276_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	71.2	0.0e+00
AWC83134.1|268275_268674_-	hypothetical protein	NA	S4TR39	Salmonella_phage	81.8	4.5e-63
AWC83135.1|268680_269265_-	hypothetical protein	NA	S4TND4	Salmonella_phage	83.4	3.6e-93
AWC83136.1|269264_269858_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	81.2	1.1e-92
AWC83137.1|269871_273126_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	86.9	0.0e+00
AWC83138.1|273160_273424_-|tail	phage tail protein	tail	K7P7L5	Enterobacteria_phage	90.8	1.8e-39
AWC83139.1|273447_273849_-|tail	phage tail protein	tail	A0A220NRP3	Escherichia_phage	97.7	4.0e-67
AWC83140.1|273903_274374_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	98.1	2.6e-81
AWC83141.1|274427_274775_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	99.1	2.9e-58
AWC83142.1|274771_275221_-	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	8.4e-74
AWC83143.1|275217_275556_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	1.1e-38
AWC83144.1|275565_275892_-	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	85.2	8.0e-50
AWC83145.1|275934_277146_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	86.2	6.8e-195
AWC83146.1|277155_278004_-	peptidase S14	NA	K7PH05	Enterobacteria_phage	92.1	4.9e-139
AWC83147.1|278017_279322_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	2.3e-233
AWC83148.1|279321_281058_-|terminase	terminase	terminase	K7PKT2	Enterobacteria_phage	98.6	0.0e+00
AWC83149.1|281057_281531_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	96.8	1.5e-84
AWC83150.1|281688_282039_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	1.7e-50
AWC83151.1|282038_282632_-	hypothetical protein	NA	S4TR53	Salmonella_phage	80.6	2.0e-91
AWC83152.1|282739_283261_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.6	8.1e-36
AWC83153.1|283408_284866_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	89.7	1.0e-269
AWC83154.1|285028_285361_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83155.1|285362_285551_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83156.1|286049_286430_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83157.1|286489_286957_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	71.6	4.8e-56
AWC83158.1|286953_287493_-	lysozyme	NA	H6WRZ4	Salmonella_phage	76.0	1.9e-80
AWC83159.1|287494_287743_-|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	35.1	1.9e-06
AWC87312.1|288470_288614_+	ABC transporter	NA	NA	NA	NA	NA
AWC83160.1|288652_289633_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWC83161.1|289891_290194_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83162.1|290180_290471_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83163.1|291024_291210_+	hypothetical protein	NA	NA	NA	NA	NA
AWC83164.1|291280_291877_-	Rha family transcriptional regulator	NA	A0A1X9SFL9	Acinetobacter_phage	53.4	3.3e-17
AWC83165.1|291980_292178_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.6	3.3e-06
AWC83166.1|292392_293124_-	hypothetical protein	NA	NA	NA	NA	NA
AWC83167.1|294146_295331_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	54.4	3.6e-124
AWC83168.1|295850_296549_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
295494:295517	attR	AATGGCACGCCCTGTAGGATTCGA	NA	NA	NA	NA
AWC83169.1|296573_297290_+	histidine kinase	NA	NA	NA	NA	NA
AWC83170.1|298102_298735_+	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
AWC83171.1|298786_299311_-	fimbriae assembly protein	NA	NA	NA	NA	NA
AWC83172.1|299320_300328_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AWC83173.1|300320_302882_-	fimbrial protein	NA	NA	NA	NA	NA
AWC83174.1|302896_303589_-	molecular chaperone FimC	NA	NA	NA	NA	NA
AWC83175.1|303623_304169_-	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
AWC83176.1|304236_304800_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AWC83177.1|305110_305977_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.9	2.5e-29
AWC83178.1|305978_306191_+	ribosome-associated protein	NA	NA	NA	NA	NA
AWC83179.1|306410_307910_+	PTS N-acetylglucosamine transporter subunit IICB	NA	NA	NA	NA	NA
AWC83180.1|307994_309011_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
AWC83181.1|309083_309605_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWC83182.1|309683_311069_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	8.7e-45
AWC83183.1|311243_311738_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWC83184.1|311741_312464_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AWC83185.1|312600_312810_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWC83186.1|313022_313532_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWC83187.1|313528_314596_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWC83188.1|314680_315751_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AWC83189.1|315822_316968_-	porin	NA	NA	NA	NA	NA
AWC83190.1|317150_319565_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC83191.1|319561_320248_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	5.0e-33
AWC87313.1|320218_320842_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 2
CP028950	Enterobacter cloacae complex sp. FDA-CDC-AR_0164 chromosome, complete genome	4849791	2087616	2147564	4849791	holin,capsid,integrase,terminase,plate,head,tRNA,portal,tail	Cronobacter_phage(43.55%)	74	2095564:2095590	2118033:2118059
AWC84789.1|2087616_2089176_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	8.4e-12
AWC84790.1|2089172_2089667_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWC84791.1|2089813_2090578_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AWC84792.1|2090578_2091748_-	DNA repair protein	NA	NA	NA	NA	NA
AWC84793.1|2092019_2092595_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.4	5.2e-68
AWC84794.1|2092882_2093221_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	75.7	8.3e-42
AWC84795.1|2093288_2093516_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	62.7	6.4e-14
AWC84796.1|2093515_2093737_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	72.2	6.7e-24
AWC84797.1|2093744_2095940_+	replication protein	NA	A0A218M4H2	Erwinia_phage	74.4	0.0e+00
2095564:2095590	attL	CTTGGAGTTCTGTCAATAACTGTACGG	NA	NA	NA	NA
AWC84798.1|2096049_2096490_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	76.6	1.0e-52
AWC84799.1|2096613_2096817_+|tail	phage tail protein	tail	A0A218M4L8	Erwinia_phage	74.6	1.8e-23
AWC84800.1|2096807_2097029_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	76.4	9.3e-26
AWC84801.1|2097012_2097522_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	3.9e-75
AWC87352.1|2097500_2097932_+	protein lysB	NA	O80310	Escherichia_phage	57.7	9.0e-33
AWC87353.1|2097831_2098077_+|holin	holin	holin	S4TNY4	Salmonella_phage	74.7	1.1e-27
AWC84802.1|2098039_2098507_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	59.5	4.8e-48
AWC84803.1|2098616_2099258_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	78.4	2.4e-90
AWC84804.1|2099254_2099605_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.8	3.4e-38
AWC84805.1|2099610_2100519_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	79.5	9.8e-130
AWC84806.1|2100511_2101042_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	5.3e-91
AWC84807.1|2101053_2103252_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.5	1.5e-91
AWC84808.1|2103253_2103685_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.0	8.2e-18
AWC84809.1|2103998_2105186_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	81.5	3.3e-186
AWC84810.1|2105197_2105716_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	5.9e-79
AWC84811.1|2105772_2106081_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	7.6e-26
AWC84812.1|2106113_2106233_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	87.2	2.8e-13
AWC84813.1|2106225_2108673_+|tail	phage tail tape measure protein	tail	Q37848	Escherichia_phage	47.1	1.3e-147
AWC84814.1|2108684_2109149_+|tail	phage tail protein	tail	O80317	Escherichia_phage	67.9	2.8e-56
AWC84815.1|2109145_2110300_+	hypothetical protein	NA	A0A0M5M5V5	Salmonella_phage	61.2	9.6e-130
AWC87354.1|2110367_2110568_+	late control protein B	NA	A0A2I8TV89	Erwinia_phage	75.0	1.1e-20
AWC84816.1|2110810_2111599_-	hypothetical protein	NA	NA	NA	NA	NA
AWC84817.1|2111595_2112618_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	64.0	5.0e-122
AWC84818.1|2112619_2113201_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	36.9	1.4e-28
AWC84819.1|2113341_2113563_+	regulator	NA	NA	NA	NA	NA
AWC84820.1|2113593_2114097_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	69.5	6.1e-57
AWC84821.1|2114106_2114301_+	hypothetical protein	NA	NA	NA	NA	NA
AWC84822.1|2114290_2114719_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	4.5e-24
AWC84823.1|2114718_2115120_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	56.4	5.4e-40
AWC84824.1|2115186_2115420_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AWC84825.1|2115410_2116232_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	70.5	8.4e-104
AWC84826.1|2116228_2118250_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.8	1.1e-303
2118033:2118059	attR	CTTGGAGTTCTGTCAATAACTGTACGG	NA	NA	NA	NA
AWC84827.1|2118371_2118578_+	hypothetical protein	NA	NA	NA	NA	NA
AWC84828.1|2118551_2118875_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	88.5	7.0e-46
AWC84829.1|2118871_2119924_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.7	1.4e-159
AWC84830.1|2119920_2121696_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	2.0e-288
AWC84831.1|2121868_2122663_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	55.6	3.8e-69
AWC84832.1|2122722_2123745_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	3.5e-152
AWC84833.1|2123748_2124477_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	65.9	8.6e-84
AWC84834.1|2124454_2124652_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	59.3	3.4e-11
AWC87355.1|2124750_2125203_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	76.0	1.1e-57
AWC84835.1|2125199_2125706_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.9	1.7e-67
AWC84836.1|2125702_2126410_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	1.8e-102
AWC84837.1|2126406_2127534_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.7	1.9e-175
AWC84838.1|2127530_2127986_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	72.8	9.2e-60
AWC84839.1|2127995_2128283_+|holin	holin	holin	C7BGD7	Burkholderia_phage	51.8	2.1e-14
AWC84840.1|2128279_2128621_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	88.1	3.5e-48
AWC84841.1|2128620_2128989_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	5.2e-21
AWC84842.1|2128885_2129125_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	56.6	5.0e-17
AWC84843.1|2129108_2129369_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	58.1	1.2e-19
AWC84844.1|2129556_2131869_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	56.7	3.5e-216
AWC84845.1|2131865_2132195_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	73.4	2.7e-37
AWC84846.1|2132191_2133376_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	79.5	9.7e-178
AWC84847.1|2133368_2133956_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	81.0	2.6e-91
AWC84848.1|2136310_2136844_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	46.9	6.8e-38
AWC84849.1|2136833_2137559_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	50.2	1.6e-61
AWC84850.1|2137530_2138079_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.9	4.1e-62
AWC84851.1|2138078_2139758_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.4	6.6e-204
AWC84852.1|2140372_2141263_-	hypothetical protein	NA	NA	NA	NA	NA
AWC84853.1|2141649_2142156_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AWC84854.1|2142240_2144088_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AWC84855.1|2144104_2144224_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWC84856.1|2144238_2145984_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.5	2.1e-75
AWC84857.1|2146098_2146314_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWC84858.1|2146550_2147564_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	6.3e-109
>prophage 3
CP028950	Enterobacter cloacae complex sp. FDA-CDC-AR_0164 chromosome, complete genome	4849791	3134998	3141270	4849791		Enterobacteria_phage(50.0%)	6	NA	NA
AWC85721.1|3134998_3136390_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
AWC85722.1|3136567_3137464_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	1.2e-42
AWC85723.1|3137815_3138901_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.0e-100
AWC85724.1|3138900_3139800_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.8	2.0e-29
AWC85725.1|3139851_3140730_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AWC85726.1|3140733_3141270_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	3.5e-50
>prophage 4
CP028950	Enterobacter cloacae complex sp. FDA-CDC-AR_0164 chromosome, complete genome	4849791	3165468	3206676	4849791	holin,integrase,terminase,head,tail	Enterobacteria_phage(23.73%)	73	3163532:3163545	3183470:3183483
3163532:3163545	attL	CTTCGGTGCGCTGG	NA	NA	NA	NA
AWC85746.1|3165468_3166647_+|integrase	integrase	integrase	K7P703	Enterobacteria_phage	93.4	2.1e-220
AWC85747.1|3166627_3166819_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	95.2	1.9e-30
AWC85748.1|3166829_3167030_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	77.3	1.8e-23
AWC85749.1|3167221_3167452_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	93.4	4.8e-33
AWC85750.1|3167460_3167700_-	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	4.9e-12
AWC87392.1|3167662_3168235_-	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	46.0	1.5e-35
AWC85751.1|3168246_3168465_-	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	62.9	4.6e-17
AWC85752.1|3168556_3168787_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	41.1	4.5e-07
AWC85753.1|3168783_3168975_-	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	5.4e-14
AWC85754.1|3168971_3169679_-	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	31.3	1.1e-22
AWC85755.1|3169675_3169894_-	hypothetical protein	NA	NA	NA	NA	NA
AWC85756.1|3169890_3171021_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	47.6	5.2e-88
AWC85757.1|3171017_3171170_-	cruciferin	NA	T1SAR0	Salmonella_phage	44.2	9.6e-06
AWC85758.1|3171166_3171595_-	regulator	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
AWC85759.1|3171591_3172272_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	94.7	1.1e-125
AWC85760.1|3172268_3173114_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	56.2	1.1e-69
AWC85761.1|3173132_3173417_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	89.4	1.5e-44
AWC85762.1|3173490_3173631_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AWC87393.1|3173788_3173998_-	hypothetical protein	NA	NA	NA	NA	NA
AWC85763.1|3174202_3174397_-	hypothetical protein	NA	NA	NA	NA	NA
AWC85764.1|3174884_3175238_-	hypothetical protein	NA	NA	NA	NA	NA
AWC87394.1|3175262_3175901_-	LexA family transcriptional repressor	NA	K7PH71	Enterobacterial_phage	77.7	4.2e-95
AWC85765.1|3176005_3176233_+	transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	85.1	6.6e-27
AWC85766.1|3176250_3176796_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	96.1	1.8e-94
AWC85767.1|3176808_3177066_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85768.1|3177141_3177336_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85769.1|3177319_3178174_+	replication protein	NA	K7PGT1	Enterobacteria_phage	52.0	1.1e-53
AWC85770.1|3178158_3179031_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	65.8	2.6e-103
AWC87395.1|3179030_3179606_+	protein ren	NA	G8C7U7	Escherichia_phage	39.3	7.6e-11
AWC85771.1|3179602_3179899_+	nucleoside 2-deoxyribosyltransferase	NA	A0A222YYT7	Escherichia_phage	60.9	7.8e-28
AWC85772.1|3180293_3180530_+	hypothetical protein	NA	E9NIE8	Enterobacter_phage	40.7	2.3e-06
AWC85773.1|3180526_3180970_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	52.2	1.9e-25
AWC85774.1|3180972_3181254_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	79.3	2.7e-30
AWC85775.1|3181257_3181674_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	57.4	5.1e-25
AWC87396.1|3181702_3182080_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	37.8	1.7e-22
AWC87397.1|3182193_3182475_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	54.8	5.3e-26
AWC85776.1|3182687_3183143_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AWC85777.1|3183142_3183313_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	94.3	2.6e-20
AWC85778.1|3183305_3183947_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	75.8	2.1e-78
3183470:3183483	attR	CCAGCGCACCGAAG	NA	NA	NA	NA
AWC85779.1|3183943_3184159_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85780.1|3184155_3184272_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85781.1|3184268_3184958_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.8	7.9e-55
AWC85782.1|3185250_3185568_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.7	8.9e-46
AWC85783.1|3185554_3185995_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	70.5	9.8e-51
AWC85784.1|3185991_3186378_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	37.8	9.3e-13
AWC85785.1|3186358_3186538_+	rz1 lytic protein	NA	U5P461	Shigella_phage	52.8	1.4e-08
AWC85786.1|3186611_3187250_+	hypothetical protein	NA	R9TRP4	Vibrio_phage	38.3	6.7e-24
AWC85787.1|3187341_3187560_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85788.1|3187649_3188135_-	hypothetical protein	NA	NA	NA	NA	NA
AWC85789.1|3188215_3188854_+	hypothetical protein	NA	I6S676	Salmonella_phage	89.6	6.5e-112
AWC85790.1|3188886_3189342_+	hypothetical protein	NA	I6S1P9	Salmonella_phage	84.7	1.7e-66
AWC85791.1|3189338_3190592_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.4	2.2e-212
AWC85792.1|3190649_3190886_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85793.1|3190944_3192312_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	91.6	2.5e-241
AWC85794.1|3192271_3193222_+|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	82.5	8.7e-137
AWC85795.1|3193231_3194497_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.7	9.9e-221
AWC85796.1|3194509_3194959_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	3.2e-65
AWC85797.1|3194976_3196053_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	90.5	2.1e-187
AWC85798.1|3196062_3196356_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	87.6	2.3e-40
AWC85799.1|3196418_3196820_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	80.0	3.5e-55
AWC85800.1|3196819_3196993_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.9	1.6e-12
AWC85801.1|3196992_3197343_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	65.2	4.4e-38
AWC85802.1|3197390_3197678_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85803.1|3197739_3198108_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.8	6.7e-45
AWC85804.1|3198104_3198488_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	58.3	5.2e-40
AWC85805.1|3198547_3199303_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	53.0	3.8e-58
AWC85806.1|3199353_3200094_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.1	2.5e-59
AWC85807.1|3200170_3200464_+	hypothetical protein	NA	NA	NA	NA	NA
AWC85808.1|3200502_3202836_+|tail	phage tail tape measure protein	tail	A0A291AXC6	Shigella_phage	50.6	9.3e-148
AWC85809.1|3202838_3203333_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	67.1	1.1e-58
AWC85810.1|3203332_3203803_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	57.8	5.4e-47
AWC85811.1|3203795_3204233_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	61.8	4.7e-45
AWC85812.1|3204174_3206676_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	55.4	3.6e-267
>prophage 5
CP028950	Enterobacter cloacae complex sp. FDA-CDC-AR_0164 chromosome, complete genome	4849791	3210334	3216054	4849791		Enterobacterial_phage(16.67%)	6	NA	NA
AWC85815.1|3210334_3210655_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.9	1.7e-12
AWC85816.1|3210833_3211253_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	56.7	1.1e-35
AWC85817.1|3211255_3212524_+	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.9	9.9e-229
AWC85818.1|3212564_3213701_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	29.9	1.9e-29
AWC85819.1|3213810_3214479_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	1.6e-81
AWC85820.1|3214887_3216054_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	85.8	5.4e-197
