The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	561512	570168	5140937		Enterobacteria_phage(66.67%)	9	NA	NA
AWC87972.1|561512_563846_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
AWC87973.1|563857_564193_-	hypothetical protein	NA	NA	NA	NA	NA
AWC87974.1|564189_564453_-	hypothetical protein	NA	NA	NA	NA	NA
AWC87975.1|564449_564995_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
AWC87976.1|564981_565197_-	hypothetical protein	NA	NA	NA	NA	NA
AWC87977.1|565193_565457_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
AWC87978.1|566192_567383_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.1	2.8e-140
AWC87979.1|567801_569061_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
AWC87980.1|569064_570168_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
>prophage 2
CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	2145049	2186426	5140937	tail,portal,integrase,capsid,head,plate,lysis,tRNA	Erwinia_phage(46.15%)	50	2144907:2144957	2180196:2180246
2144907:2144957	attL	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWC89300.1|2145049_2146084_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
AWC89301.1|2146087_2146672_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
AWC89302.1|2146781_2147003_+	regulator	NA	NA	NA	NA	NA
AWC89303.1|2147033_2147543_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	4.2e-45
AWC92013.1|2147553_2147733_+	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
AWC92014.1|2147744_2148047_+	hypothetical protein	NA	NA	NA	NA	NA
AWC89304.1|2148110_2148353_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AWC89305.1|2148352_2148664_+	hypothetical protein	NA	NA	NA	NA	NA
AWC89306.1|2148663_2148882_+	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	5.6e-15
AWC89307.1|2148887_2149469_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	58.4	1.7e-58
AWC89308.1|2149591_2149873_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
AWC89309.1|2149869_2152086_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.3	3.1e-238
AWC89310.1|2152124_2152337_+	hypothetical protein	NA	NA	NA	NA	NA
AWC89311.1|2152497_2154294_+	methylase	NA	NA	NA	NA	NA
AWC89312.1|2154290_2155373_+	restriction endonuclease	NA	NA	NA	NA	NA
AWC89313.1|2155757_2156012_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.6e-16
AWC92015.1|2156011_2156353_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWC89314.1|2156397_2157432_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
AWC89315.1|2157431_2159204_-	oxidoreductase	NA	F1BUR2	Erwinia_phage	82.2	5.2e-292
AWC89316.1|2159346_2160162_+|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.5	7.1e-71
AWC89317.1|2160204_2161389_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.6	4.5e-159
AWC89318.1|2161391_2162051_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	69.4	5.2e-80
AWC89319.1|2162144_2162633_+|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
AWC89320.1|2162632_2162836_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	68.7	1.8e-20
AWC89321.1|2162840_2163050_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
AWC89322.1|2163033_2163546_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	6.7e-59
AWC89323.1|2163542_2163971_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.0	4.6e-13
AWC89324.1|2164066_2164543_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	65.4	1.1e-50
AWC89325.1|2164529_2164979_+	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	61.1	7.2e-41
AWC89326.1|2165061_2166891_+	hypothetical protein	NA	E5E3R2	Burkholderia_phage	24.7	3.7e-11
AWC89327.1|2166972_2167602_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	74.3	1.1e-76
AWC89328.1|2167668_2167884_+	hypothetical protein	NA	NA	NA	NA	NA
AWC89329.1|2167880_2168231_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
AWC89330.1|2168235_2169144_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.9	2.4e-107
AWC89331.1|2169136_2169670_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	1.6e-76
AWC89332.1|2169676_2172337_+	hypothetical protein	NA	Q858V4	Yersinia_virus	54.6	9.8e-61
AWC89333.1|2172342_2172762_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	38.7	2.6e-16
AWC89334.1|2173037_2174207_+|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	81.7	4.0e-184
AWC89335.1|2174222_2174732_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
AWC89336.1|2174786_2175068_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	9.1e-26
AWC89337.1|2175100_2175223_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
AWC89338.1|2175215_2178044_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	39.1	2.8e-106
AWC89339.1|2178043_2178529_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
AWC89340.1|2178525_2179686_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	65.4	7.4e-138
AWC89341.1|2179769_2180000_+	transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
AWC89342.1|2180423_2180912_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
2180196:2180246	attR	AAAATTTGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
AWC89343.1|2180987_2182829_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AWC89344.1|2182986_2184735_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
AWC89345.1|2184871_2185087_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWC89346.1|2185412_2186426_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
>prophage 3
CP028948	Serratia marcescens strain AR_0123 chromosome, complete genome	5140937	3591439	3626327	5140937	tail,portal,integrase,terminase,capsid,head,plate	Escherichia_phage(25.71%)	43	3592246:3592267	3625207:3625228
AWC90549.1|3591439_3592228_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.3	9.2e-92
3592246:3592267	attL	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
AWC90550.1|3592372_3593356_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	64.8	4.1e-121
AWC90551.1|3593443_3593743_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	2.2e-38
AWC90552.1|3593868_3594144_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	1.5e-33
AWC90553.1|3594335_3594836_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	72.3	2.2e-67
AWC90554.1|3594899_3595157_+	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
AWC90555.1|3595149_3595449_+	hypothetical protein	NA	NA	NA	NA	NA
AWC90556.1|3595451_3595667_+	hypothetical protein	NA	NA	NA	NA	NA
AWC90557.1|3595669_3595951_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	56.8	7.7e-25
AWC90558.1|3595947_3598236_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	60.5	1.5e-267
AWC90559.1|3598325_3599054_+	hypothetical protein	NA	Q37850	Escherichia_phage	57.0	9.8e-72
AWC90560.1|3599239_3600889_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWC90561.1|3600885_3602028_+	hypothetical protein	NA	NA	NA	NA	NA
AWC90562.1|3602339_3603371_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.3	6.3e-165
AWC90563.1|3603367_3605140_-	oxidoreductase	NA	A0A0M4RE51	Salmonella_phage	81.3	3.8e-287
AWC90564.1|3605300_3606146_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	66.7	9.6e-103
AWC90565.1|3606216_3607416_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	75.9	9.3e-152
AWC90566.1|3607418_3608162_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.9e-71
AWC90567.1|3608255_3608762_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	71.4	1.5e-63
AWC90568.1|3608761_3608965_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	71.6	1.1e-20
AWC90569.1|3608967_3609177_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	39.1	9.8e-09
AWC90570.1|3609160_3609670_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.7	1.5e-63
AWC90571.1|3609666_3610104_+	hypothetical protein	NA	O80310	Escherichia_phage	42.4	1.2e-13
AWC90572.1|3610193_3610661_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	4.5e-62
AWC90573.1|3610653_3611100_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.6	2.9e-50
AWC90574.1|3611175_3611613_-	hypothetical protein	NA	NA	NA	NA	NA
AWC90575.1|3611602_3612043_-	hypothetical protein	NA	NA	NA	NA	NA
AWC90576.1|3612289_3612931_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.6	2.9e-67
AWC90577.1|3612927_3613278_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	8.9e-39
AWC90578.1|3613282_3614191_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	64.9	1.5e-101
AWC90579.1|3614183_3614717_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	6.3e-76
AWC90580.1|3614723_3616820_+	hypothetical protein	NA	Q858V4	Yersinia_virus	55.5	7.0e-62
AWC90581.1|3616821_3617346_+|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	45.3	6.2e-36
AWC90582.1|3617514_3617733_-	hypothetical protein	NA	NA	NA	NA	NA
AWC90583.1|3618478_3619648_+|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	81.4	6.2e-185
AWC90584.1|3619664_3620183_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	1.0e-75
AWC90585.1|3620240_3620543_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.3	1.9e-29
AWC90586.1|3620575_3620695_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	74.4	4.5e-11
AWC90587.1|3620687_3623135_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	64.9	1.7e-256
AWC92083.1|3623147_3623633_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	60.5	3.5e-49
AWC90588.1|3623629_3624799_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	74.7	3.0e-163
AWC90589.1|3624878_3625097_+	transcriptional regulator	NA	S4TNZ3	Salmonella_phage	62.5	6.8e-21
AWC90590.1|3625424_3626327_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.8	5.7e-37
3625207:3625228	attR	AGGCCGCTTCGGCGGCCTTTTT	NA	NA	NA	NA
