The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028946	Serratia marcescens strain AR_0124 chromosome, complete genome	5180277	216931	252542	5180277	tail,terminase,integrase	Salmonella_phage(28.21%)	46	210283:210299	257461:257477
210283:210299	attL	GCATGCTGCACGCCGGC	NA	NA	NA	NA
AWC73606.1|216931_220321_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.5	2.0e-183
AWC73607.1|220320_223077_-	hypothetical protein	NA	Q858G0	Salmonella_phage	36.1	7.2e-107
AWC73608.1|223086_223659_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	49.4	7.8e-32
AWC73609.1|223651_224125_-	hypothetical protein	NA	Q858G2	Salmonella_phage	66.0	8.6e-53
AWC73610.1|224124_226626_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.2	4.0e-306
AWC73611.1|226625_227234_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
AWC73612.1|227233_227557_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	2.7e-21
AWC77941.1|227596_227881_-	hypothetical protein	NA	NA	NA	NA	NA
AWC73613.1|227901_228348_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	57.4	7.9e-32
AWC73614.1|228401_229385_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	74.0	1.1e-139
AWC73615.1|229391_230111_-	peptidase	NA	G9L6C4	Escherichia_phage	58.9	7.7e-45
AWC73616.1|230121_230385_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	65.7	1.2e-11
AWC77942.1|230350_230647_-	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	7.1e-29
AWC73617.1|230646_232332_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.8	5.1e-188
AWC73618.1|232334_232538_-	hypothetical protein	NA	NA	NA	NA	NA
AWC73619.1|233363_234836_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	2.6e-233
AWC73620.1|234832_235384_-|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	59.7	3.7e-55
AWC73621.1|235489_235747_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	52.9	1.6e-16
AWC73622.1|235819_236206_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	35.1	2.7e-12
AWC73623.1|236198_236582_-	DUF551 domain-containing protein	NA	I6R0M4	Salmonella_phage	60.2	2.3e-27
AWC73624.1|236591_236846_-	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	45.7	3.6e-13
AWC77943.1|236847_237360_-	hypothetical protein	NA	Q716F4	Shigella_phage	52.3	2.3e-11
AWC73625.1|237385_237661_-	hypothetical protein	NA	S4TW48	Salmonella_phage	61.4	2.1e-19
AWC73626.1|237841_238489_-	hypothetical protein	NA	R9VWB9	Serratia_phage	61.7	1.0e-67
AWC73627.1|238485_238851_-	hypothetical protein	NA	R9W085	Serratia_phage	61.5	1.5e-20
AWC73628.1|238861_239074_-	conjugal transfer protein TraR	NA	Q9ZXI6	Pseudomonas_virus	50.8	3.1e-10
AWC77944.1|239076_239376_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	7.1e-37
AWC73629.1|239639_240206_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.8	4.2e-22
AWC73630.1|240111_241062_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	59.7	9.2e-78
AWC73631.1|241061_241361_-	hypothetical protein	NA	NA	NA	NA	NA
AWC73632.1|241353_241554_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	55.0	1.3e-13
AWC73633.1|241698_241917_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
AWC73634.1|242065_242662_+	XRE family transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.8	7.3e-49
AWC73635.1|242925_243111_+	hypothetical protein	NA	A0A2H4YDC5	Klebsiella_virus	50.0	2.7e-10
AWC73636.1|243187_243340_+	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	50.0	1.6e-05
AWC73637.1|243336_244383_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	60.1	1.3e-37
AWC73638.1|244390_244696_+	hypothetical protein	NA	NA	NA	NA	NA
AWC73639.1|244695_245517_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	78.7	1.6e-126
AWC73640.1|245513_246398_+	recombinase RecT	NA	E5AGD9	Erwinia_phage	65.4	8.8e-99
AWC73641.1|246438_246690_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	48.8	9.3e-14
AWC73642.1|246807_247038_+	hypothetical protein	NA	NA	NA	NA	NA
AWC73643.1|247034_247673_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.7	1.5e-76
AWC73644.1|247683_247968_+	hypothetical protein	NA	NA	NA	NA	NA
AWC73645.1|247971_249174_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	69.8	7.3e-157
AWC73646.1|249398_250976_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AWC73647.1|251078_252542_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	8.8e-88
257461:257477	attR	GCCGGCGTGCAGCATGC	NA	NA	NA	NA
>prophage 2
CP028946	Serratia marcescens strain AR_0124 chromosome, complete genome	5180277	863099	901206	5180277	tail,plate,portal,integrase,capsid,lysis,head,tRNA	Erwinia_phage(46.15%)	48	869279:869330	901278:901329
AWC74156.1|863099_864113_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	4.3e-110
AWC74157.1|864438_864654_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWC74158.1|864790_866539_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
AWC74159.1|866696_868538_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AWC74160.1|868613_869102_-	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
869279:869330	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
AWC74161.1|869482_869713_-	transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
AWC74162.1|869803_870952_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.4	1.9e-125
AWC74163.1|870948_871434_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
AWC74164.1|871438_874285_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	50.7	2.7e-109
AWC74165.1|874277_874400_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
AWC74166.1|874432_874714_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	69.0	5.3e-26
AWC74167.1|874768_875278_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
AWC74168.1|875293_876463_-|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	81.7	3.1e-184
AWC74169.1|876739_877285_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	46.4	2.0e-37
AWC74170.1|877286_879908_-	hypothetical protein	NA	Q858V4	Yersinia_virus	54.1	3.7e-60
AWC74171.1|879914_880448_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.0	5.7e-77
AWC74172.1|880440_881349_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.2	8.1e-108
AWC74173.1|881353_881704_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	67.2	2.2e-37
AWC74174.1|881851_882481_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	72.8	6.3e-75
AWC74175.1|882553_883000_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.4	4.6e-40
AWC74176.1|882986_883460_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.8	3.4e-49
AWC74177.1|883555_883984_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	5.5e-14
AWC74178.1|883980_884493_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.5	5.7e-58
AWC74179.1|884476_884686_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
AWC74180.1|884690_884894_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
AWC74181.1|884893_885382_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
AWC74182.1|885475_886135_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	69.4	5.2e-80
AWC74183.1|886137_887349_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.5	7.9e-159
AWC74184.1|887391_888207_-|capsid	phage capsid protein	capsid	S4TP53	Salmonella_phage	53.1	2.7e-70
AWC74185.1|888349_890122_+	oxidoreductase	NA	F1BUR2	Erwinia_phage	82.0	4.4e-291
AWC74186.1|890121_891156_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.5	3.2e-161
AWC77981.1|891200_891542_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWC74187.1|891541_891796_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
AWC74188.1|892320_892893_-	flavin reductase	NA	NA	NA	NA	NA
AWC77982.1|893021_893921_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC74189.1|894017_894248_-	hypothetical protein	NA	NA	NA	NA	NA
AWC77983.1|894262_894493_-	hypothetical protein	NA	NA	NA	NA	NA
AWC74190.1|894533_896747_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	58.9	4.7e-242
AWC74191.1|896743_897169_-	hypothetical protein	NA	NA	NA	NA	NA
AWC74192.1|897158_897440_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
AWC74193.1|897562_897787_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
AWC74194.1|897786_898080_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	54.4	6.4e-06
AWC74195.1|898144_898447_-	hypothetical protein	NA	NA	NA	NA	NA
AWC77984.1|898458_898638_-	hypothetical protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
AWC74196.1|898648_899158_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	5.5e-45
AWC74197.1|899189_899453_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	85.1	4.8e-37
AWC74198.1|899584_900163_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	55.3	9.9e-59
AWC74199.1|900162_901206_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	87.0	1.0e-178
901278:901329	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
>prophage 3
CP028946	Serratia marcescens strain AR_0124 chromosome, complete genome	5180277	1647018	1658458	5180277		Enterobacteria_phage(71.43%)	12	NA	NA
AWC74831.1|1647018_1648206_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	87.1	8.5e-198
AWC74832.1|1648192_1650913_+	hypothetical protein	NA	NA	NA	NA	NA
AWC74833.1|1650860_1651043_-	hypothetical protein	NA	NA	NA	NA	NA
AWC74834.1|1651173_1651425_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	67.3	2.9e-15
AWC74835.1|1651421_1652138_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	27.2	2.9e-15
AWC74836.1|1652648_1652906_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	59.3	1.3e-18
AWC74837.1|1652902_1653151_+	hypothetical protein	NA	NA	NA	NA	NA
AWC74838.1|1653164_1653692_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.1	8.2e-28
AWC74839.1|1653688_1653955_+	hypothetical protein	NA	NA	NA	NA	NA
AWC74840.1|1653941_1654283_+	hypothetical protein	NA	NA	NA	NA	NA
AWC74841.1|1654297_1656613_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.8	1.9e-257
AWC74842.1|1656934_1658458_+	hypothetical protein	NA	Q38324	Lactococcus_phage	27.3	1.0e-14
>prophage 4
CP028946	Serratia marcescens strain AR_0124 chromosome, complete genome	5180277	2488653	2497309	5180277		Enterobacteria_phage(66.67%)	9	NA	NA
AWC75531.1|2488653_2489757_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
AWC75532.1|2489760_2491020_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	3.6e-98
AWC75533.1|2491438_2492629_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.1	2.8e-140
AWC75534.1|2493364_2493628_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.0	1.5e-17
AWC75535.1|2493624_2493840_+	hypothetical protein	NA	NA	NA	NA	NA
AWC75536.1|2493826_2494372_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
AWC75537.1|2494368_2494632_+	hypothetical protein	NA	NA	NA	NA	NA
AWC75538.1|2494628_2494964_+	hypothetical protein	NA	NA	NA	NA	NA
AWC75539.1|2494975_2497309_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.2	3.3e-262
>prophage 5
CP028946	Serratia marcescens strain AR_0124 chromosome, complete genome	5180277	3473659	3512397	5180277	tail,portal,terminase,integrase,lysis	Enterobacterial_phage(27.03%)	43	3467872:3467886	3519893:3519907
3467872:3467886	attL	GAGACCGGCGGCAGT	NA	NA	NA	NA
AWC76415.1|3473659_3474670_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	66.7	4.6e-128
AWC76416.1|3474669_3474903_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AWC78093.1|3475210_3476056_-	hypothetical protein	NA	M4MB35	Vibrio_phage	38.4	6.3e-46
AWC76417.1|3476060_3476717_-	hypothetical protein	NA	R9VWB9	Serratia_phage	46.3	3.2e-45
AWC76418.1|3476713_3477124_-	hypothetical protein	NA	NA	NA	NA	NA
AWC76419.1|3477120_3477906_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	1.8e-63
AWC76420.1|3478891_3479710_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AWC76421.1|3479706_3480447_-	hypothetical protein	NA	NA	NA	NA	NA
AWC76422.1|3480659_3481310_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	56.0	2.8e-62
AWC76423.1|3481409_3481607_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	72.3	2.6e-19
AWC76424.1|3481634_3482168_+	DNA-binding protein	NA	A0A0P0ZE62	Stx2-converting_phage	30.1	3.6e-15
AWC76425.1|3482366_3483281_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.5	3.7e-52
AWC76426.1|3483277_3483997_+	DNA replication protein	NA	I6PBN0	Cronobacter_phage	42.8	2.9e-44
AWC76427.1|3483993_3484377_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	62.5	4.1e-37
AWC76428.1|3484361_3485357_+	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	46.7	4.7e-85
AWC76429.1|3485407_3486076_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	45.2	1.7e-46
AWC76430.1|3486271_3486508_+	hypothetical protein	NA	NA	NA	NA	NA
AWC76431.1|3486476_3486806_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWC76432.1|3486984_3488007_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	62.4	3.6e-120
AWC76433.1|3488163_3488409_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.2	1.2e-05
AWC78094.1|3488417_3488894_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	62.2	1.6e-51
AWC76434.1|3488893_3489421_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	53.3	1.6e-31
AWC76435.1|3490176_3490431_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	65.5	2.0e-24
AWC76436.1|3490708_3491218_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	53.2	8.2e-41
AWC76437.1|3491207_3493319_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	71.0	9.2e-304
AWC76438.1|3493315_3493531_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	71.4	4.4e-20
AWC76439.1|3493527_3495039_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	70.7	9.1e-205
AWC76440.1|3494980_3497005_+	peptidase S14	NA	K7PKX4	Enterobacterial_phage	72.9	9.5e-274
AWC76441.1|3497090_3497414_+	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	58.9	8.0e-26
AWC76442.1|3497406_3497682_+	ATP-binding protein	NA	K7PH55	Enterobacterial_phage	51.2	2.2e-16
AWC78095.1|3497692_3498256_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.8	1.6e-50
AWC76443.1|3498252_3498654_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	59.4	1.3e-44
AWC76444.1|3498665_3499403_+|tail	phage tail protein	tail	K7P6G8	Enterobacteria_phage	67.3	1.2e-88
AWC78096.1|3499447_3499858_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	41.8	1.5e-21
AWC76445.1|3499878_3500178_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	55.6	2.6e-23
AWC76446.1|3500170_3503296_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.4	1.7e-112
AWC76447.1|3503295_3503649_+|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	41.2	9.4e-20
AWC76448.1|3503657_3504407_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	61.0	2.2e-87
AWC76449.1|3504409_3505111_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	56.5	1.6e-74
AWC76450.1|3505171_3505732_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	38.9	7.4e-27
AWC76451.1|3505784_3506399_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.9	5.2e-58
AWC76452.1|3506460_3509808_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	58.9	4.1e-298
AWC78097.1|3509853_3512397_+	hypothetical protein	NA	A0A2D1GNM3	Pseudomonas_phage	30.7	3.2e-29
3519893:3519907	attR	GAGACCGGCGGCAGT	NA	NA	NA	NA
