The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	463622	470527	5225737		Planktothrix_phage(33.33%)	6	NA	NA
AWD00924.1|463622_464486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AWC96557.1|464496_465270_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
AWD00925.1|465511_466405_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWC96558.1|466649_468011_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	3.9e-207
AWC96559.1|468329_469052_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWC96560.1|469048_470527_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
>prophage 2
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	480991	544071	5225737	transposase,tail	Escherichia_phage(35.0%)	48	NA	NA
AWC96566.1|480991_482017_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWC96567.1|482335_483259_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWC96568.1|483598_484624_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWC96569.1|484620_484830_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96570.1|485041_485653_-	transcriptional regulator	NA	NA	NA	NA	NA
AWC96571.1|486092_487073_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
AWC96572.1|487345_488047_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AWC96573.1|488061_489918_-	histidine kinase	NA	NA	NA	NA	NA
AWC96574.1|490206_491559_-	molecular chaperone	NA	NA	NA	NA	NA
AWC96575.1|491575_491686_+	DNA-3-methyladenine glycosidase	NA	NA	NA	NA	NA
AWC96576.1|491696_492545_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
AWC96577.1|492659_493301_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
AWC96578.1|493391_493973_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AWC96579.1|494003_495851_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWC96580.1|496082_497666_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AWD00926.1|498431_499322_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
AWC96581.1|499714_500344_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWC96582.1|501303_502743_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
AWC96583.1|502873_503797_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC96584.1|503954_505088_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AWD00927.1|505093_505528_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AWC96585.1|505544_507707_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
AWC96586.1|507779_509210_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
AWC96587.1|509233_510697_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AWC96588.1|510689_511820_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWC96589.1|511828_512923_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWC96590.1|512937_514116_+	O-antigen ligase domain-containing protein	NA	NA	NA	NA	NA
AWC96591.1|514135_515410_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	46.5	1.4e-97
AWC96592.1|515987_516410_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96593.1|516523_517675_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AWC96594.1|517858_518782_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC96595.1|518886_520293_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
AWC96596.1|520480_521404_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	2.7e-175
AWC96597.1|521584_523000_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AWC96598.1|523021_524392_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
AWC96599.1|524555_525722_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AWC96600.1|525914_526922_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
AWC96601.1|527780_528704_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC96602.1|529553_530579_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWC96603.1|530897_531821_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AWD00928.1|534070_534838_+	ABC transporter permease	NA	NA	NA	NA	NA
AWC96604.1|534837_535578_+	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
AWC96605.1|535593_537489_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
AWC96606.1|537504_538659_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.7	8.5e-78
AWC96607.1|538655_539549_+	glycosyl transferase	NA	NA	NA	NA	NA
AWC96608.1|539746_540670_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
AWC96609.1|541853_543062_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
AWC96610.1|543147_544071_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 3
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	631408	640955	5225737	transposase	Burkholderia_phage(33.33%)	9	NA	NA
AWC96683.1|631408_632332_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC96684.1|632511_633657_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
AWC96685.1|634195_634477_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96686.1|634519_635227_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AWC96687.1|635270_636704_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
AWD00935.1|636684_637179_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AWC96688.1|637153_638065_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWC96689.1|638248_639160_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWC96690.1|639275_640955_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 4
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	801229	812516	5225737		Klebsiella_phage(40.0%)	17	NA	NA
AWD00944.1|801229_802525_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
AWC96843.1|802539_803346_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWC96844.1|803586_804849_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
AWC96845.1|804891_805137_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
AWC96846.1|805354_806104_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
AWC96847.1|806100_806325_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AWC96848.1|806321_806549_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	48.4	2.1e-09
AWC96849.1|806848_807142_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AWC96850.1|807335_807524_-	hypothetical protein	NA	NA	NA	NA	NA
AWC96851.1|808295_808892_-	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
AWC96852.1|809000_809213_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC96853.1|809233_809554_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
AWC96854.1|809749_810004_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96855.1|810000_811095_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
AWC96856.1|811121_811517_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96857.1|811516_811738_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96858.1|811730_812516_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
>prophage 5
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	816778	873301	5225737	terminase,capsid,plate,tail,holin,portal,head,transposase,protease	Vibrio_phage(34.85%)	77	NA	NA
AWC96863.1|816778_817372_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
AWC96864.1|817368_818139_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
AWC96865.1|818135_818780_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
AWC96866.1|818776_819376_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
AWC96867.1|820013_820283_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
AWD00945.1|820260_820761_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
AWC96868.1|820757_821249_+	Fis family transcriptional regulator	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
AWC96869.1|821350_821701_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
AWC96870.1|822111_822345_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96871.1|822332_822683_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
AWC96872.1|822812_823307_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
AWC96873.1|823303_825034_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
AWC96874.1|825043_825229_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
AWC96875.1|825228_826458_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
AWC96876.1|826444_827098_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
AWC96877.1|827112_828321_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
AWC96878.1|828347_828563_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
AWC96879.1|828559_828880_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
AWC96880.1|828949_829147_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
AWC96881.1|829148_829481_+|head,tail	head-tail adaptor protein	head,tail	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
AWC96882.1|829473_830013_+	hypothetical protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
AWC96883.1|830009_830375_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
AWC96884.1|830431_830923_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
AWC96885.1|830966_831320_+|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
AWC96886.1|831352_831616_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
AWC96887.1|831680_832148_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96888.1|832192_834637_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
AWC96889.1|834636_835107_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
AWC96890.1|835103_835586_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
AWC96891.1|835596_835977_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
AWC96892.1|836340_836904_-	transcriptional regulator	NA	NA	NA	NA	NA
AWD00946.1|837085_837310_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
AWC96893.1|839442_840390_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
AWC96894.1|840394_840634_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96895.1|840636_840924_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
AWC96896.1|840939_841557_+	DUF3164 domain-containing protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.6e-65
AWC96897.1|841637_842135_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
AWC96898.1|842094_842571_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
AWC96899.1|842567_843122_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
AWC96900.1|843118_843508_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
AWC96901.1|843784_844801_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AWD00947.1|844838_844964_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	100.0	1.3e-13
AWC96902.1|845296_845875_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
AWC96903.1|845877_846096_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
AWC96904.1|846088_846496_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96905.1|846483_847089_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
AWC96906.1|847085_847316_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWC96907.1|847296_847599_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
AWC96908.1|847608_847896_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
AWC96909.1|847898_848174_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96910.1|848163_848742_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
AWC96911.1|848738_850328_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
AWC96912.1|850327_851899_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
AWC96913.1|851891_852734_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
AWC96914.1|852922_853939_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
AWC96915.1|853941_854841_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
AWC96916.1|854917_855424_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96917.1|855423_855864_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
AWC96918.1|855863_856406_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
AWC96919.1|856402_857014_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
AWC96920.1|857016_857226_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWC96921.1|857227_858709_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
AWC96922.1|858718_859072_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
AWC96923.1|859075_859459_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
AWC96924.1|859361_859580_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96925.1|859557_861366_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
AWC96926.1|861365_862622_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
AWC96927.1|862614_863706_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
AWC96928.1|863696_864236_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
AWC96929.1|864232_864685_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
AWC96930.1|864671_865748_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
AWC96931.1|865732_866317_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
AWC96932.1|866319_867132_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
AWC96933.1|867131_868007_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
AWC96934.1|868016_870002_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
AWC96935.1|869998_870268_+	hypothetical protein	NA	NA	NA	NA	NA
AWC96936.1|870367_873301_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 6
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	1423134	1434022	5225737		Escherichia_phage(87.5%)	10	NA	NA
AWC97440.1|1423134_1423755_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AWC97441.1|1423747_1425013_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
AWC97442.1|1425024_1425927_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWC97443.1|1425964_1426198_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97444.1|1426188_1426950_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWC97445.1|1426970_1427831_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AWC97446.1|1428128_1428389_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWC97447.1|1428475_1429564_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWC97448.1|1429594_1430860_-	MFS transporter	NA	NA	NA	NA	NA
AWC97449.1|1430914_1434022_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 7
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	1875504	1931943	5225737	integrase,terminase,capsid,plate,tail,tRNA,portal,transposase	Enterobacteria_phage(51.43%)	65	1905703:1905762	1930964:1932020
AWC97848.1|1875504_1876005_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWC97849.1|1876121_1876568_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWD00991.1|1876551_1877343_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWC97850.1|1877444_1878629_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWC97851.1|1878660_1879353_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97852.1|1879498_1880008_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWC97853.1|1879994_1880351_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWC97854.1|1880340_1880580_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWD00992.1|1880844_1881096_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AWC97855.1|1881139_1882279_-	hypothetical protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
AWC97856.1|1882433_1883606_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
AWC97857.1|1883605_1884121_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
AWC97858.1|1884166_1884484_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AWD00993.1|1884483_1884642_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AWC97859.1|1884628_1887604_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
AWD00994.1|1887618_1888110_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
AWC97860.1|1888425_1889913_+	hypothetical protein	NA	NA	NA	NA	NA
AWC97861.1|1890162_1891260_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
AWC97862.1|1891259_1891472_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97863.1|1891468_1894495_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
AWC97864.1|1894484_1895408_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
AWC97865.1|1895409_1895760_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
AWC97866.1|1895756_1896344_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
AWC97867.1|1896340_1896976_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
AWC97868.1|1896972_1897440_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
AWD00995.1|1897621_1897951_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWC97869.1|1897962_1898508_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
AWC97870.1|1898504_1898789_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWC97871.1|1898779_1898980_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWC97872.1|1898979_1899495_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AWC97873.1|1899607_1900465_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
AWC97874.1|1900514_1901549_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
AWC97875.1|1901558_1902398_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
AWC97876.1|1902554_1904282_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
AWC97877.1|1904275_1905337_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
AWC97878.1|1905521_1905713_+	hypothetical protein	NA	NA	NA	NA	NA
1905703:1905762	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
AWC97879.1|1905758_1906682_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC97880.1|1907002_1907827_+	hypothetical protein	NA	NA	NA	NA	NA
AWC97881.1|1908196_1908556_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97882.1|1908805_1910545_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AWC97883.1|1913244_1914261_-	hypothetical protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
AWD00996.1|1914298_1914526_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	39.7	1.9e-05
AWC97884.1|1914534_1915101_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
AWC97885.1|1915097_1915322_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97886.1|1915390_1915663_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97887.1|1915678_1916056_-	hypothetical protein	NA	NA	NA	NA	NA
AWC97888.1|1916071_1916290_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWC97889.1|1916310_1916589_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AWC97890.1|1916709_1917009_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
AWC97891.1|1917124_1918138_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
AWC97892.1|1918372_1919386_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
AWC97893.1|1919443_1919545_+	hypothetical protein	NA	NA	NA	NA	NA
AWD00997.1|1919544_1919619_+	hypothetical protein	NA	NA	NA	NA	NA
AWC97894.1|1919736_1919862_+	hypothetical protein	NA	NA	NA	NA	NA
AWC97895.1|1919921_1920185_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWC97896.1|1920315_1920954_-	leucine efflux protein	NA	NA	NA	NA	NA
AWC97897.1|1921043_1921958_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWC97898.1|1922173_1922365_+	hypothetical protein	NA	NA	NA	NA	NA
AWC97899.1|1922618_1923662_-	type II asparaginase	NA	NA	NA	NA	NA
AWC97900.1|1923964_1925173_+	phosphodiesterase	NA	NA	NA	NA	NA
AWC97901.1|1925246_1927031_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWC97902.1|1927037_1927928_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC97903.1|1928048_1929557_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AWC97904.1|1929867_1930554_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWC97905.1|1931019_1931943_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
1930964:1932020	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGTGTCAGTGAACCTCCGAACAGCTGTTTTACCCGGTACATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCATTCGCTGATTAGCCACTGCACGGTTACGGTCTGCATATTCACCGGGCCAGTAACCCGCACCTTTTCGGGGTGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACAGAGCCGGGTGTCGTAAGCGCCGTCTGCCGATGCTGCCCTGATTTTTCTGTGAGTCTGCCGGATAAGACCCGGGAAGGCTTCTGAGTCCGTCACATTGTTCAGCGACAGGTCAGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATACGGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGGTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGACATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGTAGCGGAACGTTCATCAGAGAAAAAATGGAATCAATAAAGCCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAGAAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 8
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2183144	2192607	5225737	tRNA,protease	Bacillus_phage(16.67%)	9	NA	NA
AWC98130.1|2183144_2184866_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
AWC98131.1|2184910_2185612_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWC98132.1|2185965_2186184_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWC98133.1|2186303_2188583_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWC98134.1|2188613_2188931_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWC98135.1|2189256_2189478_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWC98136.1|2189411_2189615_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98137.1|2189554_2191495_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWC98138.1|2191491_2192607_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 9
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2643960	2718180	5225737	integrase,terminase,capsid,plate,tail,holin,tRNA,portal,head,transposase	Enterobacteria_phage(20.0%)	89	2699551:2699565	2724964:2724978
AWC98532.1|2643960_2645478_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AWC98533.1|2645809_2647285_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AWC98534.1|2647344_2649492_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWC98535.1|2649574_2650909_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AWC98536.1|2651274_2652843_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWC98537.1|2653135_2653408_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWC98538.1|2653508_2654429_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AWC98539.1|2654939_2655806_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC98540.1|2655828_2656854_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWC98541.1|2656855_2659291_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWC98542.1|2659301_2659997_-	fimbrial chaperone	NA	NA	NA	NA	NA
AWC98543.1|2660055_2660616_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWC98544.1|2661087_2661750_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWC98545.1|2661727_2662033_+	hypothetical protein	NA	NA	NA	NA	NA
AWC98546.1|2662085_2663390_-	citrate synthase	NA	NA	NA	NA	NA
AWC98547.1|2663900_2664071_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AWC98548.1|2664149_2664551_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWC98549.1|2664946_2665240_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98550.1|2665902_2666109_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
AWC98551.1|2667451_2668297_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWC98552.1|2668298_2670242_+	glycosyl transferase	NA	NA	NA	NA	NA
AWD01033.1|2670659_2670974_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
AWC98553.1|2671657_2672689_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AWC98554.1|2673004_2673601_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
AWC98555.1|2673597_2674746_-|plate	phage baseplate protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
AWC98556.1|2674735_2675185_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
AWC98557.1|2675181_2675763_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AWC98558.1|2675759_2676845_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
AWC98559.1|2676841_2678242_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
AWC98560.1|2678288_2680142_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
AWC98561.1|2680283_2680562_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AWC98562.1|2680563_2680935_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWC98563.1|2680938_2682450_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
AWC98564.1|2682454_2682631_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWC98565.1|2682633_2683179_-	ATP-binding protein	NA	NA	NA	NA	NA
AWC98566.1|2683175_2683535_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98567.1|2683539_2683920_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98568.1|2683921_2684971_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
AWC98569.1|2685069_2685477_-|head	head decoration protein	head	NA	NA	NA	NA
AWC98570.1|2685476_2686067_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98571.1|2686068_2686935_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
AWC98572.1|2686931_2688566_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
AWC98573.1|2688565_2688829_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AWC98574.1|2688837_2690964_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
AWC98575.1|2690905_2691487_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98576.1|2691748_2692387_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98577.1|2692482_2692689_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98578.1|2692922_2693312_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
AWD01034.1|2693308_2693806_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
AWC98579.1|2693783_2694053_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
AWC98580.1|2694596_2695280_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
AWC98581.1|2695276_2695417_-	YlcG family protein	NA	NA	NA	NA	NA
AWC98582.1|2695413_2696052_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
AWC98583.1|2696044_2696713_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
AWC98584.1|2696709_2696877_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
AWC98585.1|2696857_2697325_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
AWC98586.1|2697606_2697828_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98587.1|2698008_2698857_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
AWC98588.1|2698853_2699234_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
AWC98589.1|2699233_2700067_-	hypothetical protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
2699551:2699565	attL	CGGCGATGCGCTGGC	NA	NA	NA	NA
AWC98590.1|2700063_2700270_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
AWC98591.1|2700266_2700668_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
AWC98592.1|2700664_2700967_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC98593.1|2700963_2701812_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
AWC98594.1|2702975_2703296_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
AWC98595.1|2703345_2703561_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
AWC98596.1|2703660_2704293_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
AWC98597.1|2704729_2704936_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AWC98598.1|2705017_2705302_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
AWC98599.1|2705318_2706065_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
AWC98600.1|2706061_2706685_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
AWC98601.1|2706713_2707241_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
AWC98602.1|2707454_2707799_+	hypothetical protein	NA	NA	NA	NA	NA
AWC98603.1|2707791_2708469_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
AWC98604.1|2708465_2708693_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
AWC98605.1|2708689_2708911_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
AWC98606.1|2708910_2709150_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
AWD01035.1|2709162_2709498_+	DNA-binding protein	NA	NA	NA	NA	NA
AWD01036.1|2709494_2710538_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.6	5.0e-178
AWC98607.1|2710968_2711835_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AWC98608.1|2711836_2712049_+	ribosome-associated protein	NA	NA	NA	NA	NA
AWC98609.1|2712094_2713480_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AWC98610.1|2713655_2714150_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AWC98611.1|2714153_2714876_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AWC98612.1|2714983_2715322_+	hypothetical protein	NA	NA	NA	NA	NA
AWC98613.1|2715318_2715486_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC98614.1|2715418_2715928_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AWC98615.1|2715924_2716992_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AWC98616.1|2717103_2718180_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
2724964:2724978	attR	CGGCGATGCGCTGGC	NA	NA	NA	NA
>prophage 10
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2722679	2787820	5225737	transposase,tRNA,protease	Escherichia_phage(28.57%)	59	NA	NA
AWD01038.1|2722679_2723306_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AWC98619.1|2723334_2724105_+	oxidoreductase	NA	NA	NA	NA	NA
AWC98620.1|2724163_2725018_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AWC98621.1|2725125_2725908_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AWC98622.1|2725894_2726572_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
AWC98623.1|2726712_2727630_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AWC98624.1|2727626_2728085_+	NfeD family protein	NA	NA	NA	NA	NA
AWC98625.1|2728081_2728492_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AWD01039.1|2728598_2731100_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	4.7e-113
AWC98626.1|2731231_2732026_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWC98627.1|2732228_2732708_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AWC98628.1|2732813_2734466_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AWC98629.1|2734735_2735956_+	MFS transporter	NA	NA	NA	NA	NA
AWC98630.1|2736181_2737858_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
AWC98631.1|2737893_2739198_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
AWC98632.1|2739261_2740224_-	ferrochelatase	NA	NA	NA	NA	NA
AWC98633.1|2740352_2740997_-	adenylate kinase	NA	NA	NA	NA	NA
AWC98634.1|2741219_2743094_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
AWC98635.1|2743205_2743811_-	recombination protein RecR	NA	NA	NA	NA	NA
AWC98636.1|2743810_2744143_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWC98637.1|2744200_2746108_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
AWC98638.1|2746200_2746752_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AWC98639.1|2746902_2747280_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWC98640.1|2747349_2747877_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AWC98641.1|2747889_2748063_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AWC98642.1|2748130_2749030_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
AWC98643.1|2749065_2752413_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
AWC98644.1|2752542_2753193_-	DNA-binding transcriptional repressor AcrR	NA	NA	NA	NA	NA
AWC98645.1|2753335_2754529_+	MexE family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC98646.1|2754551_2757698_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
AWC98647.1|2758183_2758558_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AWC98648.1|2758584_2758803_+	transcriptional regulator	NA	NA	NA	NA	NA
AWC98649.1|2758961_2759528_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AWC98650.1|2759660_2760131_+	hypothetical protein	NA	NA	NA	NA	NA
AWC98651.1|2760105_2761557_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AWC98652.1|2761657_2762356_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWC98653.1|2762352_2762493_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWC98654.1|2762492_2762756_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AWC98655.1|2762871_2763942_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
AWC98656.1|2764212_2765484_+	maltoporin	NA	NA	NA	NA	NA
AWC98657.1|2765620_2765935_-	PTS sugar transporter	NA	NA	NA	NA	NA
AWC98658.1|2765999_2768057_-	beta-galactosidase	NA	NA	NA	NA	NA
AWC98659.1|2768088_2769291_-	galactosidase	NA	NA	NA	NA	NA
AWC98660.1|2769295_2770147_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWC98661.1|2770157_2771465_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWC98662.1|2771527_2772760_-	cyclodextrin-binding protein	NA	NA	NA	NA	NA
AWC98663.1|2773116_2774226_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
AWC98664.1|2774459_2776019_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWD01040.1|2776053_2776326_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AWC98665.1|2776490_2777354_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWC98666.1|2777398_2777995_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98667.1|2778038_2778962_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC98668.1|2779301_2780327_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWC98669.1|2781955_2782171_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98670.1|2782167_2782425_-	hypothetical protein	NA	NA	NA	NA	NA
AWC98671.1|2783333_2784359_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWC98672.1|2784698_2785622_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWC98673.1|2785923_2786847_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
AWC98674.1|2786890_2787820_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	3.5e-175
>prophage 11
CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	4949254	4989013	5225737	integrase,transposase,tRNA	Bacillus_phage(22.22%)	39	4962915:4962929	4986748:4986762
AWD00649.1|4949254_4950064_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	9.4e-15
AWD00650.1|4950194_4950632_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWD00651.1|4950631_4951837_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
AWD01120.1|4952034_4952259_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AWD00652.1|4952610_4953528_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
AWD00653.1|4953547_4953943_+	hypothetical protein	NA	NA	NA	NA	NA
AWD00654.1|4953935_4955036_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AWD00655.1|4955090_4955801_-	HTH domain-containing protein	NA	NA	NA	NA	NA
AWD00656.1|4955859_4956282_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AWD00657.1|4956283_4957702_-	L-fuculokinase	NA	NA	NA	NA	NA
AWD00658.1|4957809_4959585_-	L-fucose isomerase	NA	NA	NA	NA	NA
AWD00659.1|4959617_4960928_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AWD00660.1|4961494_4962142_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
AWD00661.1|4962169_4963318_+	lactaldehyde reductase	NA	NA	NA	NA	NA
4962915:4962929	attL	CGGGGATGGGATTTT	NA	NA	NA	NA
AWD00662.1|4963365_4964121_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.3e-10
AWD00663.1|4964217_4966161_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AWD00664.1|4966433_4967606_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AWD00665.1|4967652_4969050_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AWD00666.1|4969123_4970530_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AWD00667.1|4970526_4971549_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	1.9e-25
AWD00668.1|4971545_4972244_+	ABC transporter permease	NA	NA	NA	NA	NA
AWD00669.1|4972240_4973119_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD00670.1|4973824_4975087_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWD00671.1|4975342_4976218_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWD00672.1|4976264_4976639_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWD00673.1|4976645_4978016_-|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AWD00674.1|4978130_4979267_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWD00675.1|4979317_4979563_-	hypothetical protein	NA	NA	NA	NA	NA
AWD00676.1|4979568_4979760_+	hypothetical protein	NA	NA	NA	NA	NA
AWD00677.1|4980241_4980784_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWD00678.1|4980796_4981657_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWD00679.1|4981889_4982594_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD00680.1|4982627_4982930_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD00681.1|4982868_4983882_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWD00682.1|4984026_4984524_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWD00683.1|4984931_4985723_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWD00684.1|4985886_4986234_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWD00685.1|4986227_4987067_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
4986748:4986762	attR	CGGGGATGGGATTTT	NA	NA	NA	NA
AWD00686.1|4987471_4989013_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	0	10424	214704		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AWD01129.1|2622_5262_+	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
AWD01130.1|5243_6407_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AWD01131.1|6403_7681_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.2	1.3e-13
AWD01132.1|7677_8793_+	anticodon nuclease	NA	NA	NA	NA	NA
AWD01133.1|8789_10424_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.6	1.7e-103
>prophage 2
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	15024	15576	214704		Wolbachia_phage(100.0%)	1	NA	NA
AWD01321.1|15024_15576_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
>prophage 3
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	20759	26018	214704		Virus_Rctr197k(100.0%)	1	NA	NA
AWD01142.1|20759_26018_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
>prophage 4
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	55656	59258	214704		Cronobacter_phage(25.0%)	8	NA	NA
AWD01179.1|55656_56478_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AWD01324.1|56574_56793_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01180.1|57310_57724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWD01181.1|57724_58003_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AWD01182.1|57992_58313_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AWD01183.1|58393_58618_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01184.1|58628_58841_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01185.1|58901_59258_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 5
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	63551	67916	214704		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
AWD01194.1|63551_65609_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
AWD01195.1|65678_65927_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWD01196.1|65975_66518_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
AWD01197.1|66621_66840_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01198.1|67137_67458_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01199.1|67352_67916_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 6
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	70998	76508	214704		Pectobacterium_phage(25.0%)	8	NA	NA
AWD01325.1|70998_71253_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
AWD01204.1|71489_71915_-	antirestriction protein	NA	NA	NA	NA	NA
AWD01205.1|71952_72168_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01326.1|72434_72665_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01206.1|72898_74407_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
AWD01207.1|74406_74658_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01208.1|74811_75237_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
AWD01209.1|75236_76508_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	1.5e-155
>prophage 7
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	84911	93686	214704	transposase	Macacine_betaherpesvirus(50.0%)	7	NA	NA
AWD01213.1|84911_85883_-	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
AWD01214.1|85882_87049_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
AWD01215.1|87800_88811_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
AWD01216.1|89528_90269_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AWD01217.1|91412_92360_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
AWD01218.1|92386_92698_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWD01219.1|92762_93686_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
>prophage 8
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	98994	191834	214704	holin,transposase,integrase	uncultured_Caudovirales_phage(37.93%)	83	172094:172110	196790:196806
AWD01223.1|98994_100998_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWD01327.1|102031_103239_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AWD01224.1|104667_105099_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWD01225.1|105349_106825_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWD01328.1|106817_107498_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWD01226.1|107687_109073_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01227.1|109101_109455_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD01228.1|109568_110861_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWD01229.1|110871_114018_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AWD01230.1|114104_114545_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01231.1|114671_117125_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
AWD01232.1|117165_117363_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWD01233.1|117396_118134_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWD01234.1|118422_118872_-	copper resistance protein	NA	NA	NA	NA	NA
AWD01235.1|119105_120923_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWD01236.1|120922_121819_+	copper resistance protein B	NA	NA	NA	NA	NA
AWD01237.1|121858_122239_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWD01238.1|122243_123173_+	copper resistance protein D	NA	NA	NA	NA	NA
AWD01239.1|123227_123908_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWD01240.1|123904_125305_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWD01241.1|125521_125956_+	copper-binding protein	NA	NA	NA	NA	NA
AWD01242.1|126187_126367_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWD01243.1|128109_128619_+	porin	NA	NA	NA	NA	NA
AWD01329.1|128668_129166_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWD01244.1|129497_129824_+	transcriptional regulator	NA	NA	NA	NA	NA
AWD01330.1|129823_130534_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWD01245.1|130542_131088_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWD01246.1|131163_131526_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWD01247.1|133422_133959_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWD01248.1|133991_134417_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWD01249.1|134429_135719_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWD01250.1|135766_137518_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWD01251.1|137535_137898_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWD01252.1|137947_138298_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWD01253.1|138655_138925_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01254.1|138912_139488_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01255.1|139518_140013_+	DNA-binding protein	NA	NA	NA	NA	NA
AWD01256.1|140056_140425_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01257.1|140458_140662_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWD01258.1|140710_140968_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01259.1|141043_141298_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01260.1|141473_141740_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWD01261.1|141727_142210_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWD01331.1|142417_143764_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD01262.1|143812_144208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWD01263.1|144396_145794_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWD01264.1|146033_146312_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01265.1|146646_147213_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWD01266.1|147337_148981_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
AWD01267.1|149094_151542_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
AWD01268.1|151560_152994_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
AWD01269.1|153082_154366_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AWD01270.1|154495_156688_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AWD01271.1|157105_158029_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWD01272.1|158329_158530_+	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AWD01332.1|162787_163339_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
AWD01273.1|163354_165451_+|transposase	transposase	transposase	NA	NA	NA	NA
AWD01274.1|165842_166847_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01275.1|167057_170066_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
AWD01276.1|170226_170784_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
AWD01277.1|170915_171248_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AWD01278.1|171601_172750_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
172094:172110	attL	GGTGGCGTGCACCCCGG	NA	NA	NA	NA
AWD01279.1|172874_175892_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
AWD01280.1|176265_176640_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AWD01281.1|177168_178365_+	MFS transporter	NA	NA	NA	NA	NA
AWD01282.1|178436_179264_-	universal stress protein	NA	NA	NA	NA	NA
AWD01283.1|179282_180761_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AWD01284.1|181244_181598_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AWD01285.1|181693_182977_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AWD01286.1|183026_183455_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AWD01287.1|184118_185123_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWD01288.1|185201_185759_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
AWD01289.1|185752_186124_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01290.1|186120_186621_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD01291.1|186617_186944_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01292.1|187198_187555_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AWD01293.1|187544_187946_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AWD01294.1|187942_188233_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AWD01295.1|188295_188601_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD01296.1|188539_189553_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWD01333.1|189698_190490_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWD01297.1|190653_191001_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWD01298.1|190994_191834_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
196790:196806	attR	GGTGGCGTGCACCCCGG	NA	NA	NA	NA
>prophage 9
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	195034	197963	214704		Erysipelothrix_phage(50.0%)	4	NA	NA
AWD01305.1|195034_196681_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
AWD01306.1|196697_197063_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWD01307.1|197059_197296_+	mercury resistance protein	NA	NA	NA	NA	NA
AWD01308.1|197348_197963_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
>prophage 10
CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	211009	214290	214704	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
AWD01317.1|211009_211393_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AWD01318.1|211389_211737_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AWD01319.1|211786_213322_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AWD01334.1|214080_214290_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
>prophage 1
CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	0	53286	134346	transposase,integrase	Escherichia_phage(47.37%)	55	1:60	49477:51304
1:60	attL	CCAGAAGCGTTTACCCTGCGGATTACGCAAGATGATATTCCGGTTGTCTTCCTGTTCAAG	NA	NA	NA	NA
AWD01335.1|6047_6773_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
AWD01336.1|6844_7438_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWD01337.1|7604_8201_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01338.1|8250_8895_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01339.1|8950_9601_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWD01340.1|9597_9906_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AWD01341.1|10282_10987_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01342.1|11086_11452_-	transcriptional regulator	NA	NA	NA	NA	NA
AWD01343.1|13182_13608_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AWD01344.1|13635_13911_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWD01345.1|13926_14292_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWD01346.1|14363_14819_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWD01347.1|15078_15606_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AWD01348.1|15638_16070_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01349.1|16549_17515_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AWD01350.1|17722_17992_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01351.1|17984_19469_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWD01352.1|19468_19720_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01353.1|19877_20309_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWD01354.1|20308_21580_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AWD01355.1|21661_22639_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWD01356.1|22635_23841_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWD01357.1|24255_24525_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01358.1|24557_24755_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01359.1|24881_25748_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWD01360.1|26515_26773_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01361.1|26830_27607_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWD01362.1|27603_28347_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01363.1|28397_28748_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01466.1|28891_29326_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01364.1|29309_29540_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWD01365.1|29832_30537_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01366.1|30689_32123_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWD01367.1|33009_33714_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01467.1|34094_35051_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01368.1|35235_35847_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AWD01369.1|35900_36182_-	cytoplasmic protein	NA	NA	NA	NA	NA
AWD01370.1|36354_36690_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AWD01371.1|36918_37899_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
AWD01372.1|38436_38625_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01373.1|38929_39787_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWD01468.1|39779_39857_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWD01469.1|40088_40340_-	transcriptional regulator	NA	NA	NA	NA	NA
AWD01374.1|40475_40838_-	endonuclease	NA	NA	NA	NA	NA
AWD01375.1|40877_41582_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01470.1|43203_43446_+	relaxase	NA	NA	NA	NA	NA
AWD01376.1|43477_44155_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWD01377.1|44233_45433_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AWD01378.1|45464_46349_-	EamA family transporter	NA	NA	NA	NA	NA
AWD01471.1|46486_46879_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWD01379.1|48144_51162_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AWD01380.1|51294_51435_-	plasmid stabilization protein	NA	NA	NA	NA	NA
49477:51304	attR	CCAGAAGCGTTTACCCTGCGGATTACGCAAGATGATATTCCGGTTGTCTTCCTGTTCAAGATATTCGCCGACTTCGTACAAACGGGTATCCAATTCCATGGCCATCTGTTTGATCAGCTTTTCAGGCTCCTCCGCTAATTTTGTAAAATGGCTCTGTTGAAGCAGCGTATATTTGTTTTTTCGCCAATGTTCCCCGTCGATCAGGTCGGCGTCGAGTGCCCGGTATTTAGTGATATCAGGCAGCGTCAGCTGGCCATTCAGGCGATCAGGAATCTGTTGATAGAGGAACCACTCATAACGATCGATCAGGATATTCCCTTCACCATCCAGCAGGAATTCACGTGATTTTTTGGAAAGGAGTCTGGTGTCGGCAGTTTGCAACTGAGCGTCCTGGCCGTTGAGTTCGTTTTGTGTTTTCGCCAAGGCGGCCGCTAAGTGCTGGGTGCCGTCGCAGCCTTCGAAGCGCAGACATAGGAACAACTCTCGCAGCAAACCTTTCCGCAGACTTTCTTTCTCGTCGCAGTACTGCCACATGGCTTCATCGACCGATCGTCGCTGCTCGTTCAGGAAGAGACATACAGATTCCAGATCCCTTTTGGTCAGCAGGCTCAGTGCTTGCTGTCTTACTGTTGCAAACGGTAGTTGCAGATCAATGCTGTCATCAATGAACAGGTGCAGTACTTCAGCTGCCTTGCTGACATTTTTAGCTGCTTTTTGCCAATCCTTAAACACCGCTTCCTGCGCATAATCCTTTGCCTTCTGTTTGGTCTGTCTGACATGATGCACAAAGCCATCGGCAATACGTTCCAGCGCTTGCTGCCATCGCGTTTGAAGATAGCACAATAAATACAGCCATTGGCTGCCTACGGTTTGACGTTTCAGTTTGGCACCGTAGTAGTCGACTTTCTCTGCCAGGTGTTGCAGATTTTTCTGCGACAGTGATAGCGTGCTCAACAGCAGATCCACTTCCGGCATCCAATGCTGGATATGGCGATAGACAATCAGTTCTTTCTCCAACTCGGTTCCGGTGAAGTTACGAGCCGATTGTCGCAACTGTCGGAACGGCAGTGGACCTGTGCCGTTCACGAGCTCCGCCAGTGCTTGCTTAAGACCGCGTGACATTGCACGCTCAAGGTGCGCGGCCATGTGTTCCTGTTCGTCTCCCACCACCTGACTGATGATCTTTTGCAGCGTGCTGTAGGCAGGGATTGCGATCTTCTGCCCCGAACAATATTCATTGGCCGCATCGAAGAGGTGCCTAGGCGCTGTCCAGGCTCTGGCTTGCTGGGATAAGTAATCTCTCAACGCCGCTCCATGGTCTTTGACATTCCAGCGCTGGTAGTTGCAGAGCTGGAAAACACGTTGGTAAATCCGTTCGTTCTCTTTTGGCGTGAGATTAAAGGGTCTACAGCCTGGGCCTGGTAGAACGGTTTGATAAACGTATTTGAGGTCCTGCTTGATCTGATGAAAGCCGGGATTCAGCACCACCGGCTTGGCTTTGAAATAGCCCAGCAGTACCACCAGCATGTAACGCTGGCCCCGATGACGGAGGCTTTTAGCGATCGCCAGTTCCTTATCGTTCAGCGAGAAAAAGAAGCGTTGGTCGGCGGAGGTGAAAGCGGGGGGTCCATATAACTCATCTTGTTCTGCCTCGGACAAGATTTGGACACGTTCTTCGAATGCCATGGATTTAGCCCAAAAAGACTAAATCTTACTCAAACAGAGCCCAAATAGGGATCTCGAAAAAAGTAATACCCCTCTGGAGGCCACAGACGGCGGGGCCTCCAGAGCACTTTGTCGTTTTTGGACGGAAAATCCCTAGAACCCC	NA	NA	NA	NA
AWD01381.1|51443_51830_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01382.1|52375_52636_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01383.1|52581_53286_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
>prophage 2
CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	57273	104156	134346	protease,transposase,integrase	Escherichia_phage(33.33%)	50	91953:91968	110500:110515
AWD01387.1|57273_58743_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
AWD01388.1|59499_60069_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
AWD01389.1|60208_60523_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD01390.1|60461_61475_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWD01391.1|61621_62104_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AWD01392.1|62324_62591_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWD01393.1|62733_63498_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWD01394.1|63539_63752_+	resolvase	NA	NA	NA	NA	NA
AWD01395.1|63764_64973_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWD01396.1|65006_66440_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWD01397.1|66821_67028_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01398.1|67032_67545_-	restriction endonuclease	NA	NA	NA	NA	NA
AWD01399.1|68346_69051_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01400.1|69148_70268_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AWD01401.1|70315_70954_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
AWD01402.1|71365_72241_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AWD01472.1|72865_73492_+	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
AWD01403.1|73611_73791_+	Par-like protein	NA	NA	NA	NA	NA
AWD01404.1|74151_74340_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01405.1|74923_75361_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01406.1|75654_77178_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AWD01407.1|77719_78796_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWD01408.1|79508_80213_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AWD01473.1|80356_80911_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWD01409.1|81102_81807_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01410.1|81952_82243_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
AWD01475.1|82337_82838_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01474.1|82814_83519_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01411.1|83747_84464_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
AWD01412.1|86894_87899_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWD01413.1|88080_88257_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWD01414.1|88586_89402_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
AWD01415.1|89555_90260_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD01416.1|90441_90705_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01417.1|90799_91078_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01418.1|91271_91616_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01419.1|91723_92359_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
91953:91968	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
AWD01420.1|92358_94467_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
AWD01421.1|94456_95734_-	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AWD01422.1|97310_97727_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWD01423.1|97723_97954_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWD01424.1|98618_98825_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01425.1|98870_99179_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01426.1|99206_99536_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01427.1|99603_99960_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01428.1|99966_100299_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01429.1|100298_101081_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AWD01430.1|101935_102130_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01431.1|102294_102768_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AWD01432.1|102887_104156_-|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
110500:110515	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
>prophage 3
CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	108731	124627	134346		Enterobacteria_phage(20.0%)	20	NA	NA
AWD01435.1|108731_110759_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AWD01436.1|110870_111086_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01437.1|111310_111643_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01438.1|111662_111848_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01439.1|112019_112994_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AWD01440.1|112990_114196_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AWD01441.1|114517_115414_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AWD01442.1|115814_117086_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AWD01443.1|117085_117517_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AWD01444.1|117748_118720_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWD01445.1|118722_119394_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWD01446.1|119454_119685_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01447.1|120121_120823_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
AWD01448.1|120822_121044_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01449.1|121053_121473_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWD01450.1|121526_122294_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01451.1|122973_123402_+	antirestriction protein	NA	NA	NA	NA	NA
AWD01452.1|123444_123951_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
AWD01453.1|123993_124185_+	hypothetical protein	NA	NA	NA	NA	NA
AWD01454.1|124372_124627_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 4
CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	127766	132041	134346		Vibrio_phage(33.33%)	5	NA	NA
AWD01460.1|127766_128330_+	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
AWD01476.1|128662_128923_-	hypothetical protein	NA	NA	NA	NA	NA
AWD01461.1|129160_129673_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
AWD01462.1|129720_129963_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AWD01463.1|130031_132041_+	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
