The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028951	Klebsiella aerogenes strain AR_0161 chromosome, complete genome	5086051	3158386	3206457	5086051	holin,head,terminase,coat,integrase,tail	Cronobacter_phage(28.57%)	67	3161066:3161081	3212689:3212704
AWD04317.1|3158386_3159196_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
AWD04318.1|3159197_3160190_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
AWD04319.1|3160189_3161080_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3161066:3161081	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
AWD04320.1|3161256_3162444_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	3.5e-119
AWD04321.1|3162340_3162637_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04322.1|3162743_3163571_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.5	5.4e-18
AWD04323.1|3163796_3164174_-	protein ninX	NA	A0A1P8DTT2	Salmonella_phage	45.2	1.7e-19
AWD04324.1|3164173_3164395_-	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	46.8	5.1e-08
AWD04325.1|3164391_3164616_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	45.0	2.0e-07
AWD04326.1|3164612_3165302_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.9	1.8e-43
AWD04327.1|3165298_3165517_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04328.1|3165513_3166635_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	51.8	4.1e-101
AWD04329.1|3166648_3166933_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04330.1|3166947_3167463_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	69.6	3.4e-63
AWD04331.1|3167459_3168332_-	hypothetical protein	NA	A0A1B1P9H8	Acinetobacter_phage	50.6	2.3e-59
AWD04332.1|3168754_3168961_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
AWD04333.1|3169232_3169577_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04334.1|3170030_3170723_-	hypothetical protein	NA	A0A2I6PIE7	Escherichia_phage	54.1	1.8e-59
AWD04335.1|3170850_3171099_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	52.7	2.6e-16
AWD04336.1|3171195_3171738_+	regulator	NA	M9NZI6	Enterobacteria_phage	86.1	7.8e-82
AWD04337.1|3171922_3172855_+	replication protein	NA	A0A077KB11	Edwardsiella_phage	78.7	2.8e-55
AWD04338.1|3172851_3173553_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	80.0	1.8e-102
AWD04339.1|3173753_3174419_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04340.1|3174435_3175374_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04341.1|3175931_3176504_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04342.1|3176553_3176811_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	70.1	9.2e-25
AWD04343.1|3176993_3177443_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	4.1e-36
AWD04344.1|3177435_3177606_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	57.4	1.6e-09
AWD04345.1|3177598_3178180_+	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	1.2e-40
AWD04346.1|3178176_3178317_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04347.1|3178313_3179003_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	2.8e-60
AWD04348.1|3179249_3179846_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04349.1|3179977_3180373_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	92.4	3.9e-59
AWD04350.1|3180359_3180665_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	90.3	6.8e-43
AWD04351.1|3180642_3181185_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
AWD04352.1|3181181_3181457_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.2	2.4e-15
AWD04353.1|3181446_3181602_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.6	1.0e-15
AWD04354.1|3182227_3182512_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06200.1|3182721_3182958_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04355.1|3183623_3183812_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04356.1|3183815_3184418_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
AWD04357.1|3184417_3185893_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	84.7	2.5e-255
AWD04358.1|3185903_3187370_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	61.2	9.0e-157
AWD04359.1|3187305_3188301_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.3	9.2e-113
AWD04360.1|3188319_3189063_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04361.1|3189124_3190513_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.0	7.7e-150
AWD04362.1|3190516_3190957_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.4	1.2e-43
AWD04363.1|3190968_3192045_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	76.8	8.6e-157
AWD04364.1|3192054_3192456_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04365.1|3192458_3192839_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
AWD04366.1|3192838_3193012_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	57.1	1.1e-13
AWD04367.1|3193011_3193359_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	62.6	3.5e-35
AWD04368.1|3193361_3193802_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	53.2	8.9e-36
AWD04369.1|3193798_3194188_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	56.2	1.3e-38
AWD04370.1|3194256_3195009_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.6	2.1e-45
AWD04371.1|3195060_3195750_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.4	2.0e-66
AWD04372.1|3195954_3196512_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	89.3	1.2e-88
AWD06201.1|3196575_3196974_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	36.5	2.3e-14
AWD04373.1|3197045_3197909_-	hypothetical protein	NA	NA	NA	NA	NA
AWD04374.1|3198252_3199233_+	hypothetical protein	NA	I6R977	Salmonella_phage	71.3	2.7e-77
AWD04375.1|3199341_3199746_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.1	4.5e-18
AWD04376.1|3199806_3202158_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	49.4	4.2e-124
AWD04377.1|3202360_3202534_-	ATP-NAD kinase	NA	NA	NA	NA	NA
AWD04378.1|3202702_3203134_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	56.1	1.1e-35
AWD04379.1|3203130_3203601_+	hypothetical protein	NA	NA	NA	NA	NA
AWD04380.1|3203597_3203987_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	48.4	4.8e-33
AWD04381.1|3203979_3206457_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	43.9	1.3e-192
3212689:3212704	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 1
CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	26034	47219	451422	transposase,integrase	Salmonella_phage(28.57%)	24	27377:27393	58710:58726
AWD06293.1|26034_27039_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWD06294.1|27117_30087_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
27377:27393	attL	CGGTCGCGGATTTCACC	NA	NA	NA	NA
AWD06295.1|30089_30647_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWD06296.1|30684_31008_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD06297.1|30952_31966_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWD06298.1|32118_32859_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
AWD06299.1|32948_34298_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.3	3.3e-12
AWD06300.1|35037_35370_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
AWD06301.1|35496_36051_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
AWD06302.1|36706_37105_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWD06303.1|37179_37530_+	mercury transporter MerT	NA	NA	NA	NA	NA
AWD06304.1|37542_37818_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWD06305.1|37825_38038_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06306.1|38050_41044_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
AWD06307.1|41457_41697_-	methionine repressor-like protein	NA	NA	NA	NA	NA
AWD06308.1|41794_42409_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
AWD06309.1|42461_42698_-	mercury resistance protein	NA	NA	NA	NA	NA
AWD06310.1|42694_43060_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWD06311.1|43076_44723_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
AWD06312.1|44719_44965_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
AWD06313.1|44967_45243_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWD06314.1|45258_45609_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWD06315.1|45680_46115_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AWD06316.1|46214_47219_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
58710:58726	attR	CGGTCGCGGATTTCACC	NA	NA	NA	NA
>prophage 2
CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	58501	128326	451422	transposase,integrase	Escherichia_phage(25.0%)	59	61955:62014	127569:128389
AWD06325.1|58501_61387_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.8	5.4e-190
61955:62014	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AWD06326.1|62007_62712_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD06327.1|62944_63805_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWD06328.1|63817_64360_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWD06329.1|64841_65033_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06330.1|65038_65284_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06331.1|65334_66471_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWD06332.1|66585_67956_+|transposase	IS1182 family transposase ISCfr1	transposase	NA	NA	NA	NA
AWD06333.1|68776_69637_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWD06334.1|72853_73414_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWD06335.1|73494_73812_-|transposase	transposase	transposase	NA	NA	NA	NA
AWD06336.1|73750_74764_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWD06651.1|75055_75610_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWD06652.1|75740_76571_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWD06337.1|76708_77341_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AWD06338.1|77425_77878_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AWD06339.1|78100_78448_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWD06340.1|78441_79281_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWD06341.1|79685_81227_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWD06342.1|82177_83419_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.5	8.2e-10
AWD06343.1|83446_84097_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AWD06344.1|84702_85719_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
AWD06345.1|85977_86547_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06346.1|86737_87484_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06347.1|87550_88309_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06348.1|88560_89295_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AWD06349.1|89925_90525_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06350.1|91496_92617_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
AWD06351.1|94208_95747_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.8	4.1e-277
AWD06352.1|95795_96143_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
AWD06353.1|96139_96517_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AWD06354.1|97272_97584_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWD06355.1|97580_98000_+	transcriptional regulator	NA	NA	NA	NA	NA
AWD06356.1|98069_98483_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	46.3	1.1e-19
AWD06357.1|98528_99452_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	1.4e-176
AWD06358.1|99600_99867_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06359.1|101040_102408_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AWD06360.1|102510_103272_+	histidine utilization repressor	NA	NA	NA	NA	NA
AWD06361.1|103268_103826_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06362.1|103859_105392_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
AWD06363.1|105402_106278_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD06364.1|106308_106989_-	ABC transporter permease	NA	NA	NA	NA	NA
AWD06365.1|106991_107636_-	ABC transporter permease	NA	NA	NA	NA	NA
AWD06366.1|107632_108730_-	glycine/betaine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
AWD06367.1|109237_110914_+	urocanate hydratase	NA	NA	NA	NA	NA
AWD06368.1|110967_112362_+	cytosine permease	NA	NA	NA	NA	NA
AWD06369.1|112373_113582_+	imidazolonepropionase	NA	NA	NA	NA	NA
AWD06370.1|113574_114384_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AWD06371.1|115124_115532_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
AWD06372.1|116296_117220_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	3.3e-173
AWD06373.1|120494_121499_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWD06374.1|121938_122691_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWD06375.1|123294_124068_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AWD06376.1|124133_124835_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AWD06377.1|124900_126007_-	alkene reductase	NA	NA	NA	NA	NA
AWD06378.1|126219_126549_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	33.7	9.7e-11
AWD06379.1|126578_126917_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWD06380.1|126921_127503_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWD06381.1|127621_128326_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
127569:128389	attR	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 3
CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	138938	188345	451422	transposase	Escherichia_phage(30.77%)	41	NA	NA
AWD06397.1|138938_139643_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD06398.1|139633_142882_+	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
AWD06399.1|143182_143776_-	lytic transglycosylase	NA	NA	NA	NA	NA
AWD06400.1|143909_144638_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AWD06401.1|144654_144960_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06402.1|144973_145315_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06403.1|145650_146595_+	thioredoxin	NA	NA	NA	NA	NA
AWD06653.1|146675_147197_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06404.1|147193_147796_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06405.1|148772_149450_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06654.1|149455_149932_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06406.1|150122_150407_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	2.9e-19
AWD06407.1|150396_150645_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWD06408.1|150963_151257_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06409.1|151310_151919_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AWD06410.1|152055_152454_-	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AWD06411.1|152827_153184_-	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	40.8	2.1e-11
AWD06412.1|153564_154359_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AWD06413.1|155231_156212_-|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.6	2.4e-153
AWD06414.1|157721_158207_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06415.1|158217_158550_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06655.1|160472_160586_+	hypothetical protein	NA	U5P429	Shigella_phage	81.1	3.6e-10
AWD06656.1|160677_162249_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	4.2e-19
AWD06657.1|163241_164165_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.2	3.3e-165
AWD06416.1|164227_164653_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AWD06417.1|164649_164880_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWD06418.1|164911_165094_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06419.1|165132_167709_-	EstP	NA	NA	NA	NA	NA
AWD06420.1|167711_169919_-	restriction endonuclease	NA	NA	NA	NA	NA
AWD06421.1|170649_171432_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
AWD06422.1|171428_172451_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
AWD06423.1|174336_174516_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
AWD06658.1|174777_175038_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06424.1|176130_177099_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.0e-180
AWD06659.1|178519_179002_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06425.1|179277_179682_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
AWD06426.1|180411_181494_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
AWD06427.1|181615_184690_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
AWD06428.1|184741_185986_+	MFS transporter	NA	NA	NA	NA	NA
AWD06429.1|186052_186223_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWD06430.1|187268_188345_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	198384	271289	451422	protease,transposase	Enterobacteria_phage(12.5%)	62	NA	NA
AWD06439.1|198384_199389_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWD06440.1|199792_200803_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWD06441.1|201040_202123_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	8.8e-186
AWD06442.1|202230_205290_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.8	0.0e+00
AWD06443.1|205341_206595_+	MFS transporter	NA	NA	NA	NA	NA
AWD06444.1|206651_206822_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWD06445.1|207986_208313_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06446.1|208393_209290_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWD06447.1|209454_210531_-	dihydroorotase	NA	NA	NA	NA	NA
AWD06448.1|210527_211784_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AWD06449.1|211820_212762_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
AWD06450.1|212754_213603_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
AWD06451.1|213967_215224_+	MFS transporter	NA	NA	NA	NA	NA
AWD06452.1|215436_216702_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06453.1|217070_218051_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AWD06661.1|218174_218453_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06454.1|218549_218810_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWD06455.1|218866_220930_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AWD06456.1|221012_221432_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AWD06457.1|221792_222797_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWD06458.1|223143_223422_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWD06459.1|223515_223728_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06460.1|224470_224674_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06461.1|224703_225018_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06462.1|225260_225713_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06463.1|226214_227150_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
AWD06464.1|228874_229213_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06465.1|229400_230628_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	1.7e-169
AWD06466.1|231337_232458_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	1.1e-50
AWD06467.1|232584_233484_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
AWD06468.1|234951_235206_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06469.1|235497_235710_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06470.1|237280_238417_+	recombinase	NA	NA	NA	NA	NA
AWD06471.1|238482_238800_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06472.1|238950_239274_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06473.1|239270_240029_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06474.1|240025_240985_-	DNA replication protein	NA	NA	NA	NA	NA
AWD06475.1|241027_241435_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06476.1|241444_241888_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06477.1|243151_244120_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
AWD06478.1|245483_246221_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06479.1|246300_246783_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06662.1|246864_247977_+	tellurite resistance domain protein	NA	NA	NA	NA	NA
AWD06480.1|248026_249475_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06481.1|249492_252561_+	virulence factor SrfB	NA	NA	NA	NA	NA
AWD06482.1|252560_255275_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06483.1|255268_256288_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06484.1|256284_258252_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AWD06485.1|258251_258977_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
AWD06486.1|258966_260181_+	ABC transporter permease	NA	NA	NA	NA	NA
AWD06487.1|260231_261800_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06488.1|261835_262339_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06489.1|262398_262854_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06490.1|262947_264540_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.1e-175
AWD06491.1|264570_264921_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	3.4e-38
AWD06492.1|264917_265358_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AWD06493.1|265554_265737_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AWD06494.1|267411_268383_-	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AWD06495.1|268382_269549_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
AWD06496.1|269504_269753_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06497.1|269967_270249_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06498.1|270278_271289_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
>prophage 5
CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	275373	397668	451422	protease,transposase	Salmonella_phage(17.07%)	111	NA	NA
AWD06501.1|275373_276390_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWD06502.1|277968_279066_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
AWD06503.1|279640_280609_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.3e-180
AWD06663.1|281039_281948_+	HNH endonuclease	NA	NA	NA	NA	NA
AWD06504.1|282335_282686_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
AWD06505.1|282829_283261_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWD06506.1|283511_284987_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWD06507.1|284979_285660_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AWD06508.1|285849_287235_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AWD06509.1|287263_287617_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD06510.1|287730_289023_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWD06511.1|289033_292180_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
AWD06512.1|292266_292707_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06513.1|292834_295276_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	4.9e-83
AWD06514.1|295316_295514_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWD06515.1|295547_296285_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWD06516.1|296573_297023_-	copper resistance protein	NA	NA	NA	NA	NA
AWD06517.1|297257_299075_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWD06518.1|299074_299971_+	copper resistance protein B	NA	NA	NA	NA	NA
AWD06519.1|300010_300391_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWD06520.1|300395_301325_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AWD06521.1|301379_302060_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWD06522.1|302056_303457_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWD06523.1|303672_304107_+	copper-binding protein	NA	NA	NA	NA	NA
AWD06524.1|305494_305842_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWD06525.1|305838_306243_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	3.6e-68
AWD06526.1|308492_308747_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06527.1|308746_309010_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06664.1|309239_309521_+	DNA-binding protein	NA	NA	NA	NA	NA
AWD06528.1|309554_310124_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWD06529.1|310204_313000_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	1.2e-128
AWD06530.1|312999_313191_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06531.1|313339_313678_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWD06532.1|313689_314178_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWD06533.1|314164_315127_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AWD06665.1|315954_316269_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.1	1.8e-51
AWD06534.1|316265_316613_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWD06535.1|318831_319755_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
AWD06536.1|322592_323036_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AWD06537.1|323032_323503_+	RES domain-containing protein	NA	NA	NA	NA	NA
AWD06538.1|323634_324585_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	8.1e-167
AWD06539.1|324586_325555_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
AWD06540.1|325743_326004_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06541.1|326353_327277_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	6.9e-171
AWD06542.1|327615_328827_-	creatininase	NA	NA	NA	NA	NA
AWD06543.1|328913_329867_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
AWD06544.1|330023_330872_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWD06545.1|330895_331567_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWD06546.1|331563_332226_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWD06547.1|332230_333049_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
AWD06548.1|333045_334011_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWD06549.1|334079_335060_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AWD06550.1|335605_336529_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	3.3e-173
AWD06551.1|336935_337724_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06552.1|337723_338188_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06553.1|339126_339540_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06554.1|339732_340257_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06555.1|340458_341382_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	91.9	5.6e-165
AWD06556.1|341597_343463_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AWD06557.1|343666_345223_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.6e-106
AWD06558.1|345219_346545_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWD06559.1|346666_349783_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	23.8	4.6e-25
AWD06560.1|349844_350060_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	71.7	1.1e-15
AWD06561.1|350626_351631_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWD06562.1|351715_354694_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	4.7e-306
AWD06563.1|354853_355438_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.6e-22
AWD06564.1|355622_356180_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWD06565.1|356326_357031_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWD06566.1|358030_361975_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWD06666.1|361976_363332_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWD06567.1|363375_364413_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWD06568.1|364772_365315_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06569.1|365331_365856_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06570.1|366049_366538_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06571.1|367414_367879_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06572.1|367878_368688_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06573.1|368702_371663_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AWD06574.1|371652_373779_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AWD06575.1|373781_374879_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06576.1|374891_375566_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AWD06577.1|375574_376711_+	S49 family peptidase	NA	B8QTU8	Erwinia_phage	32.4	4.4e-10
AWD06578.1|376717_377491_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	32.1	6.0e-11
AWD06579.1|377542_377899_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06580.1|378251_378437_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06581.1|378526_378874_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06582.1|378946_379201_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06583.1|379295_379511_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06584.1|381098_382022_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWD06585.1|382121_382646_-	hypothetical protein	NA	A0A0M4R5D1	Salmonella_phage	33.3	1.9e-08
AWD06586.1|383038_383413_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06587.1|383424_383760_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06588.1|383770_384082_-	plasmid maintenance system killer family protein	NA	NA	NA	NA	NA
AWD06589.1|384352_384625_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	50.0	1.6e-11
AWD06590.1|384946_385561_+	Eac protein	NA	A0A220NQT7	Salmonella_phage	50.0	1.9e-52
AWD06591.1|385625_386063_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06592.1|386340_386649_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06593.1|386813_387479_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06594.1|387523_387823_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06595.1|388264_388582_-	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	41.9	4.3e-08
AWD06596.1|388610_388859_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06597.1|389432_390635_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.3	3.2e-35
AWD06598.1|390726_392142_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	5.3e-106
AWD06599.1|392275_392710_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06667.1|392742_393003_-	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	40.8	2.6e-11
AWD06600.1|393011_393215_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06601.1|393256_393700_-	hypothetical protein	NA	NA	NA	NA	NA
AWD06602.1|393969_394680_+	RES domain-containing protein	NA	NA	NA	NA	NA
AWD06603.1|394717_395359_-	DNA-binding protein	NA	NA	NA	NA	NA
AWD06604.1|395488_395848_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06605.1|396204_396411_+	hypothetical protein	NA	NA	NA	NA	NA
AWD06606.1|396744_397668_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
