The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	439378	450265	5341581		Escherichia_phage(87.5%)	9	NA	NA
AWC00861.1|439378_442486_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWC00862.1|442540_443806_+	MFS transporter	NA	NA	NA	NA	NA
AWC00863.1|443836_444925_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AWC00864.1|445011_445272_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWC00865.1|445569_446430_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AWC00866.1|446450_447212_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWC00867.1|447472_448375_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AWC00868.1|448386_449652_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AWC00869.1|449644_450265_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
>prophage 2
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	616620	674501	5341581	transposase,plate,tRNA,protease	Escherichia_phage(37.5%)	55	NA	NA
AWC01020.1|616620_617556_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AWC01021.1|617601_618975_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AWC01022.1|618989_619184_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01023.1|619162_619396_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01024.1|619499_620483_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AWC05277.1|620761_621505_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
AWC01025.1|621521_622586_+	oxidoreductase	NA	NA	NA	NA	NA
AWC01026.1|622822_623017_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01027.1|623129_623876_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01028.1|624126_625506_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AWC01029.1|625840_626320_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AWC01030.1|626571_627186_+	YitT family protein	NA	NA	NA	NA	NA
AWC01031.1|627224_628424_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AWC01032.1|628452_629121_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC01033.1|629113_630127_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	2.2e-29
AWC01034.1|630135_630942_-	methionine-binding protein	NA	NA	NA	NA	NA
AWC01035.1|631162_632338_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AWC01036.1|632382_633417_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AWC01037.1|633505_634054_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWC01038.1|634108_635020_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
AWC01039.1|635012_635879_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AWC01040.1|635969_636893_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC01041.1|636912_637818_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC01042.1|637956_638886_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
AWC01043.1|638911_639118_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWC01044.1|639168_640047_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWC01045.1|640205_640961_+	KR domain-containing protein	NA	NA	NA	NA	NA
AWC01046.1|640965_641559_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWC01047.1|641632_642346_+	oxidoreductase	NA	NA	NA	NA	NA
AWC01048.1|642412_642907_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01049.1|643034_643577_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AWC01050.1|643554_644634_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWC01051.1|644597_646352_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWC01052.1|646428_646899_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01053.1|647981_649580_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AWC01054.1|649576_653035_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWC01055.1|653031_653643_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01056.1|653641_654622_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWC05278.1|654660_654771_-	ABC transporter	NA	NA	NA	NA	NA
AWC01057.1|655154_656252_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
AWC01058.1|656444_656966_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01059.1|657145_657913_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01060.1|657899_658160_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01061.1|658156_659917_-	M23 family peptidase	NA	NA	NA	NA	NA
AWC01062.1|659952_660315_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01063.1|660321_661554_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01064.1|661546_664066_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
AWC01065.1|664058_666713_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	2.9e-97
AWC01066.1|666977_667469_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWC01067.1|667473_669180_-	OmpA family protein	NA	NA	NA	NA	NA
AWC01068.1|669176_669866_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWC05279.1|669862_671203_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWC01069.1|671215_672760_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWC01070.1|672802_673294_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWC01071.1|673934_674501_+|protease	protease	protease	NA	NA	NA	NA
>prophage 3
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	849398	894095	5341581	coat,terminase,head	Cronobacter_phage(19.61%)	64	NA	NA
AWC01234.1|849398_851582_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.4	3.0e-92
AWC01235.1|851668_854146_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.2	3.9e-197
AWC01236.1|854132_854528_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	3.6e-36
AWC01237.1|854524_854995_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	5.6e-28
AWC05284.1|854994_855414_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	1.6e-29
AWC01238.1|855513_858777_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	59.7	2.9e-232
AWC05285.1|858848_859319_-	hypothetical protein	NA	NA	NA	NA	NA
AWC05286.1|859792_860152_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.7	1.1e-15
AWC01239.1|860510_861062_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	91.4	1.8e-86
AWC01240.1|861278_861992_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	3.7e-63
AWC01241.1|862060_862825_-	hypothetical protein	NA	G0ZNE6	Cronobacter_phage	43.2	3.3e-38
AWC01242.1|862884_863106_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01243.1|863108_863492_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01244.1|863488_863857_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	8.5e-48
AWC01245.1|863859_864222_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	50.0	1.9e-20
AWC01246.1|864221_864395_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	4.1e-13
AWC01247.1|864394_864775_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AWC01248.1|864777_865017_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01249.1|865049_866105_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
AWC01250.1|866101_866563_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
AWC01251.1|866562_867918_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	53.3	1.3e-130
AWC01252.1|867995_868196_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01253.1|868188_869190_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.0	1.2e-115
AWC01254.1|869122_870586_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.6	1.1e-149
AWC01255.1|870598_872071_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	9.0e-250
AWC01256.1|872070_872673_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
AWC01257.1|873038_873224_-	rz1 lytic protein	NA	Q8SBD8	Shigella_phage	57.1	2.1e-10
AWC01258.1|873204_873582_-	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	51.2	2.1e-09
AWC01259.1|873578_874082_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	8.5e-75
AWC01260.1|874084_874399_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
AWC01261.1|874467_874740_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01262.1|875142_875832_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	8.4e-57
AWC01263.1|875828_875969_-	YlcG family protein	NA	NA	NA	NA	NA
AWC01264.1|875965_876607_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	1.1e-34
AWC01265.1|876603_877242_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	9.8e-76
AWC05287.1|877234_877405_-	NinE family protein	NA	G8C7V4	Escherichia_phage	69.6	6.3e-14
AWC01266.1|877410_878007_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	53.8	3.6e-56
AWC01267.1|878102_878360_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	76.6	6.4e-26
AWC01268.1|878359_878647_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01269.1|878819_879506_-	hypothetical protein	NA	A0A2D1GLY5	Escherichia_phage	50.6	3.8e-33
AWC01270.1|879502_880411_-	hypothetical protein	NA	A0A140XFY9	Salmonella_phage	81.0	1.3e-145
AWC01271.1|880407_880797_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.3	4.1e-16
AWC01272.1|880793_881096_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01273.1|881095_881872_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
AWC05288.1|881868_882597_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.9	9.3e-38
AWC01274.1|882730_882952_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWC01275.1|882990_883218_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
AWC05289.1|883286_884009_+	XRE family transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.7	1.1e-75
AWC01276.1|884054_884375_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01277.1|884374_885073_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AWC01278.1|885585_885780_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01279.1|885867_886839_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
AWC01280.1|886846_887131_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
AWC01281.1|887147_887894_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
AWC01282.1|887890_888514_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	4.0e-58
AWC05290.1|888542_889070_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
AWC01283.1|889288_889561_+	hypothetical protein	NA	Q716F1	Shigella_phage	64.7	2.8e-24
AWC01284.1|889557_890322_+	hypothetical protein	NA	R9VWB9	Serratia_phage	56.8	2.5e-70
AWC01285.1|890318_890537_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	58.5	1.6e-09
AWC01286.1|890540_890786_+	excisionase	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
AWC01287.1|890828_892088_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	89.9	2.3e-225
AWC01288.1|892084_892864_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AWC01289.1|892916_893312_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01290.1|893351_894095_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
>prophage 4
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	1121357	1128262	5341581		Bacillus_phage(33.33%)	6	NA	NA
AWC01473.1|1121357_1122836_+	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AWC01474.1|1122832_1123555_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWC01475.1|1123873_1125235_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWC05303.1|1125480_1126374_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWC01476.1|1126614_1127388_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWC05304.1|1127398_1128262_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 5
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	1468853	1483572	5341581	integrase,tail	Morganella_phage(50.0%)	17	1463739:1463759	1483800:1483820
1463739:1463759	attL	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
AWC01771.1|1468853_1471919_-|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
AWC01772.1|1471926_1472253_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01773.1|1472606_1473080_-	hypothetical protein	NA	NA	NA	NA	NA
AWC05319.1|1473084_1473435_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AWC05320.1|1473448_1473895_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AWC01774.1|1474234_1476997_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
AWC01775.1|1476989_1477340_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
AWC01776.1|1477349_1477976_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
AWC01777.1|1477972_1478182_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01778.1|1478178_1478682_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01779.1|1478678_1479641_-	HAD family hydrolase	NA	A0A291AWU3	Escherichia_phage	44.3	3.8e-07
AWC01780.1|1479637_1479817_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AWC01781.1|1479816_1480419_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
AWC01782.1|1480432_1480867_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
AWC01783.1|1480866_1481085_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AWC01784.1|1481215_1482223_-	hypothetical protein	NA	NA	NA	NA	NA
AWC05321.1|1482318_1483572_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
1483800:1483820	attR	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
>prophage 6
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	1549814	1596982	5341581	coat,terminase,tail,holin	Salmonella_phage(26.53%)	64	NA	NA
AWC01844.1|1549814_1551968_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	9.6e-83
AWC01845.1|1552044_1555107_-	kinase	NA	A0A286S259	Klebsiella_phage	94.1	0.0e+00
AWC01846.1|1555103_1555484_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
AWC01847.1|1555493_1555976_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	92.5	3.8e-80
AWC01848.1|1556156_1556621_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	6.1e-59
AWC01849.1|1556620_1560187_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.7	4.2e-83
AWC01850.1|1560282_1560645_-	hypothetical protein	NA	S4TR42	Salmonella_phage	72.4	2.3e-05
AWC01851.1|1560690_1561188_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01852.1|1561269_1561800_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	68.4	6.1e-63
AWC01853.1|1561976_1562144_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01854.1|1562311_1562794_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01855.1|1562848_1564021_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.4e-22
AWC01856.1|1564044_1564437_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AWC01857.1|1564433_1564985_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.1	7.0e-30
AWC01858.1|1564986_1565370_-	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	49.6	1.5e-23
AWC01859.1|1565371_1565782_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	40.4	1.6e-10
AWC01860.1|1565785_1566070_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01861.1|1566119_1567256_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.6	2.6e-156
AWC01862.1|1567343_1568108_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	3.9e-79
AWC01863.1|1568226_1568466_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01864.1|1568642_1569755_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.2	1.8e-109
AWC01865.1|1569738_1571163_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	7.5e-193
AWC01866.1|1571167_1572472_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	2.2e-146
AWC01867.1|1572449_1573445_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	42.9	6.5e-34
AWC01868.1|1573513_1573759_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	50.6	4.5e-13
AWC01869.1|1574072_1574345_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01870.1|1574477_1574762_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01871.1|1574852_1575008_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	80.4	3.2e-17
AWC01872.1|1574997_1575273_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	48.9	1.6e-14
AWC01873.1|1575280_1575910_-	endolysin	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
AWC01874.1|1575909_1576191_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AWC01875.1|1576177_1576573_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AWC01876.1|1576592_1576997_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01877.1|1577261_1578083_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
AWC01878.1|1578198_1578555_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	2.0e-41
AWC01879.1|1578551_1578848_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
AWC01880.1|1578850_1579057_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	2.8e-24
AWC01881.1|1579056_1579653_-	DUF1367 domain-containing protein	NA	K7PKS6	Enterobacteria_phage	80.1	1.3e-90
AWC01882.1|1579687_1579936_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	67.9	5.0e-28
AWC01883.1|1580042_1580276_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
AWC01884.1|1581037_1581514_-	DUF551 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	56.3	7.7e-17
AWC01885.1|1581510_1581690_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01886.1|1581686_1582304_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	52.1	3.7e-19
AWC01887.1|1582296_1583088_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	2.2e-64
AWC01888.1|1583080_1583416_-	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	43.0	5.8e-11
AWC01889.1|1583423_1584173_-	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
AWC01890.1|1584175_1585084_-	DNA-binding protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
AWC01891.1|1585098_1585287_-	hypothetical protein	NA	NA	NA	NA	NA
AWC01892.1|1585374_1585911_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	70.4	3.6e-63
AWC01893.1|1585913_1586147_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
AWC01894.1|1586251_1586647_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	73.3	3.1e-48
AWC01895.1|1586817_1587666_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01896.1|1587662_1588469_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AWC01897.1|1588517_1588721_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	74.6	1.4e-20
AWC01898.1|1589207_1589399_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWC01899.1|1589407_1589563_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AWC01900.1|1589700_1592811_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.7	1.3e-293
AWC01901.1|1592823_1593933_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.2	2.5e-183
AWC01902.1|1593967_1594306_+	hypothetical protein	NA	NA	NA	NA	NA
AWC01903.1|1594298_1594910_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	75.3	4.9e-40
AWC01904.1|1594906_1595215_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	1.2e-23
AWC05324.1|1595222_1595462_+	DUF4060 domain-containing protein	NA	M9P0E0	Enterobacteria_phage	71.8	3.2e-24
AWC01905.1|1595499_1595775_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
AWC01906.1|1595752_1596982_-	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	96.3	1.3e-238
>prophage 7
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	4626752	4636215	5341581	tRNA,protease	Dickeya_phage(16.67%)	9	NA	NA
AWC04626.1|4626752_4627868_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWC04627.1|4627864_4629805_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWC04628.1|4629744_4629948_+	hypothetical protein	NA	NA	NA	NA	NA
AWC04629.1|4629881_4630103_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWC04630.1|4630428_4630746_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWC04631.1|4630776_4633056_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWC04632.1|4633175_4633394_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWC04633.1|4633747_4634449_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWC04634.1|4634493_4636215_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 8
CP028932	Klebsiella pneumoniae strain AR_0153 chromosome, complete genome	5341581	4944239	4952855	5341581	tRNA	Pseudomonas_phage(16.67%)	10	NA	NA
AWC04900.1|4944239_4945724_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWC04901.1|4945801_4946041_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	51.3	7.2e-16
AWC04902.1|4946040_4946358_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.5	5.3e-22
AWC04903.1|4946754_4947321_-	hydrolase	NA	NA	NA	NA	NA
AWC04904.1|4947588_4949376_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AWC04905.1|4949377_4949821_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWC04906.1|4949848_4950589_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWC04907.1|4950623_4951145_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AWC04908.1|4951224_4951836_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWC04909.1|4951844_4952855_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
>prophage 1
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	0	9530	283371		Pseudomonas_phage(40.0%)	14	NA	NA
AWB99955.1|1035_1284_+	hypothetical protein	NA	NA	NA	NA	NA
AWB99956.1|1311_1629_+	DUF3846 domain-containing protein	NA	A0A2H4P7A4	Pseudomonas_phage	46.5	6.0e-10
AWB99957.1|2070_2364_-	hypothetical protein	NA	NA	NA	NA	NA
AWB99958.1|2424_3087_-	hypothetical protein	NA	NA	NA	NA	NA
AWB99959.1|3241_3550_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00231.1|3844_4279_-	hypothetical protein	NA	NA	NA	NA	NA
AWB99960.1|4507_5128_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	47.0	4.8e-51
AWB99961.1|5194_5413_-	hypothetical protein	NA	NA	NA	NA	NA
AWB99962.1|5448_5721_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	46.4	6.1e-11
AWB99963.1|5998_6310_+	plasmid maintenance system killer family protein	NA	NA	NA	NA	NA
AWB99964.1|6321_6639_+	hypothetical protein	NA	NA	NA	NA	NA
AWB99965.1|6668_7058_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00232.1|7434_7947_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.7	8.3e-09
AWB99966.1|8285_9530_+	site-specific DNA-methyltransferase	NA	A0A1U9WRT4	Mycobacterium_phage	25.3	2.9e-07
>prophage 2
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	13662	16516	283371		Bacillus_phage(50.0%)	2	NA	NA
AWB99969.1|13662_14454_+	NgrC	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
AWC00233.1|15427_16516_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
>prophage 3
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	23221	54400	283371	integrase,transposase,tail	Escherichia_phage(37.5%)	36	29664:29723	41017:41837
AWB99977.1|23221_23542_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AWB99978.1|23622_23937_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00234.1|24057_24309_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AWB99979.1|24474_24693_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AWB99980.1|24786_25284_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.0	1.5e-23
AWB99981.1|25280_25469_+	hypothetical protein	NA	NA	NA	NA	NA
AWB99982.1|25946_26174_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
AWB99983.1|26170_26815_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	40.7	2.2e-06
AWB99984.1|26815_27139_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AWB99985.1|27231_27618_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AWC00235.1|28869_29352_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
29664:29723	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AWB99986.1|29715_30420_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWB99987.1|30712_31027_-|transposase	transposase	transposase	NA	NA	NA	NA
AWB99988.1|30965_31979_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWB99989.1|32125_32608_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AWB99990.1|32828_33095_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AWB99991.1|33237_34002_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWB99992.1|34043_34256_+	resolvase	NA	NA	NA	NA	NA
AWB99993.1|34268_35477_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWB99994.1|35510_36944_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWB99995.1|37325_37532_-	hypothetical protein	NA	NA	NA	NA	NA
AWB99996.1|37536_38049_-	restriction endonuclease	NA	NA	NA	NA	NA
AWB99997.1|38073_38778_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWC00236.1|39409_40240_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWC00237.1|40370_40925_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWB99998.1|41068_41773_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWB99999.1|42651_45669_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
41017:41837	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
AWC00001.1|46241_46886_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
AWC00002.1|47758_48463_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWC00003.1|48908_49094_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00004.1|49363_49636_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
AWC00005.1|50209_50395_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	67.4	2.1e-10
AWC00006.1|50404_50854_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
AWC00007.1|50923_51532_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.0	2.6e-25
AWC00008.1|51819_52275_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00009.1|53158_54400_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 4
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	58563	60438	283371		Bacillus_phage(100.0%)	1	NA	NA
AWC00018.1|58563_60438_+	helicase	NA	A0A127AW80	Bacillus_phage	27.1	5.2e-08
>prophage 5
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	63700	66964	283371		Pseudomonas_phage(33.33%)	4	NA	NA
AWC00022.1|63700_65185_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWC00023.1|65100_65280_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00024.1|65270_65693_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
AWC00025.1|65692_66964_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
>prophage 6
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	74901	76814	283371		Clostridioides_phage(50.0%)	2	NA	NA
AWC00035.1|74901_75675_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	48.0	3.0e-10
AWC00036.1|75677_76814_-	S49 family peptidase	NA	G0YPK2	Erwinia_phage	32.2	5.7e-10
>prophage 7
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	85688	86393	283371	transposase	Escherichia_phage(100.0%)	1	NA	NA
AWC00043.1|85688_86393_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 8
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	94061	97327	283371		Salmonella_phage(50.0%)	6	NA	NA
AWC00047.1|94061_94622_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWC00048.1|94747_94960_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWC00241.1|94922_95042_+	mercury resistance protein	NA	NA	NA	NA	NA
AWC00049.1|95025_95262_-	mercury resistance protein	NA	NA	NA	NA	NA
AWC00050.1|95258_95624_-	transcriptional regulator	NA	NA	NA	NA	NA
AWC00051.1|95641_97327_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	4.6e-40
>prophage 9
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	111238	111880	283371		Streptomyces_phage(100.0%)	1	NA	NA
AWC00071.1|111238_111880_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
>prophage 10
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	115672	125923	283371		Caulobacter_phage(42.86%)	11	NA	NA
AWC00076.1|115672_116752_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.5	3.3e-39
AWC00077.1|116753_117527_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00078.1|117519_118662_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.2	6.3e-33
AWC00079.1|118673_119732_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AWC00080.1|120043_120628_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.9	1.8e-12
AWC00081.1|120624_121776_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AWC00082.1|121798_122254_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AWC00083.1|122277_123318_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AWC00084.1|123356_123935_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	5.5e-33
AWC00085.1|124021_124597_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
AWC00086.1|124681_125923_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
>prophage 11
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	132978	133473	283371		Moraxella_phage(100.0%)	1	NA	NA
AWC00093.1|132978_133473_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	34.2	6.1e-17
>prophage 12
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	157732	239926	283371	integrase,transposase	Salmonella_phage(12.0%)	75	178210:178224	230939:230953
AWC00115.1|157732_158437_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWC00116.1|158813_159038_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00117.1|159189_159837_+	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	31.4	2.6e-15
AWC00118.1|160451_161477_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
AWC00119.1|161769_162054_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00120.1|162109_162304_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00121.1|162264_163794_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWC00122.1|163982_165623_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AWC00123.1|165678_165969_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AWC00124.1|166162_166492_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AWC00125.1|166496_167528_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AWC00126.1|167538_168177_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AWC00127.1|168181_168547_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AWC00128.1|168550_169363_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AWC00129.1|169577_170609_-|transposase	IS630 family transposase ISEc33	transposase	NA	NA	NA	NA
AWC00130.1|170705_171644_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.4	4.4e-48
AWC00131.1|171795_172575_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
AWC00132.1|173109_173814_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWC00133.1|174698_175241_+	DNA-binding protein	NA	NA	NA	NA	NA
AWC00134.1|175576_176209_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00135.1|176237_177641_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AWC00136.1|177882_178767_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
178210:178224	attL	ATCTGCCCATAGAAC	NA	NA	NA	NA
AWC00137.1|178822_180298_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AWC00138.1|180696_181881_-|transposase	IS4 family transposase ISEc29	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
AWC00139.1|181929_182115_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00140.1|182334_182616_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00245.1|182596_183370_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AWC00141.1|183695_184532_-|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	58.5	3.9e-88
AWC00142.1|184768_186310_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWC00143.1|186714_187554_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWC00144.1|187547_187895_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWC00145.1|188058_188850_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWC00146.1|189257_189755_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWC00147.1|189899_190913_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWC00148.1|191234_191792_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AWC00149.1|191794_194767_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AWC00150.1|194845_195850_+|transposase	IS110 family transposase IS4321	transposase	NA	NA	NA	NA
AWC00151.1|196765_197650_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
AWC00152.1|199049_200117_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00153.1|200202_200457_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00154.1|200722_200974_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00155.1|200973_202458_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWC00156.1|202543_203680_+	recombinase	NA	NA	NA	NA	NA
AWC00157.1|203745_204063_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00158.1|204214_204538_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00159.1|204534_205293_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00160.1|205289_206249_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AWC00161.1|206291_206699_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00162.1|206708_207173_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00163.1|207220_207463_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00164.1|208414_208954_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00165.1|209022_210267_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
AWC00166.1|210377_210608_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00246.1|210679_211456_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AWC00167.1|212779_213856_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AWC00168.1|213950_215003_-	ATP-binding protein	NA	NA	NA	NA	NA
AWC00169.1|215030_215852_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00170.1|215913_216267_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00171.1|216411_217398_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00172.1|217731_219531_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.8	2.4e-26
AWC00173.1|219821_220070_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AWC00174.1|220059_220344_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	3.6e-22
AWC00175.1|220497_221724_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.7	1.2e-154
AWC00176.1|222298_222721_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.1	3.0e-33
AWC00177.1|222762_223950_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.3	1.3e-142
AWC00178.1|225649_226498_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00179.1|226546_229732_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWC00180.1|229741_230779_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWC00181.1|230775_232137_-	conjugal transfer protein	NA	NA	NA	NA	NA
230939:230953	attR	ATCTGCCCATAGAAC	NA	NA	NA	NA
AWC00182.1|232123_232648_-	signal peptidase I	NA	NA	NA	NA	NA
AWC00183.1|232785_237027_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00184.1|237154_237691_-	plasmid transfer protein	NA	NA	NA	NA	NA
AWC00185.1|237678_238083_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00186.1|238057_238516_-	HtdA	NA	NA	NA	NA	NA
AWC00187.1|238806_239926_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 13
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	255223	256402	283371		Salmonella_phage(100.0%)	1	NA	NA
AWC00205.1|255223_256402_+	DNA-binding protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
>prophage 14
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	263051	264299	283371		Enterobacteria_phage(100.0%)	1	NA	NA
AWC00212.1|263051_264299_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
>prophage 15
CP028929	Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence	283371	276637	282537	283371		Edwardsiella_phage(20.0%)	10	NA	NA
AWC00221.1|276637_277216_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
AWC00222.1|277206_277521_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00248.1|277645_278056_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.8	4.6e-42
AWC00223.1|278240_278600_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00224.1|278830_279274_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00225.1|279315_279519_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00226.1|279527_279788_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
AWC00227.1|279820_280255_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00228.1|280251_280995_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
AWC00229.1|281121_282537_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
>prophage 1
CP028930	Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence	103694	0	14739	103694		Staphylococcus_phage(33.33%)	7	NA	NA
AWC00249.1|2646_3330_-	YecA family protein	NA	NA	NA	NA	NA
AWC00250.1|3326_4601_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AWC00251.1|4590_6114_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
AWC00252.1|7246_7843_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00253.1|8009_8603_-	conjugal transfer protein	NA	NA	NA	NA	NA
AWC00254.1|8674_9400_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	7.1e-06
AWC00255.1|9480_14739_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
>prophage 2
CP028930	Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence	103694	45074	48677	103694		Cronobacter_phage(25.0%)	8	NA	NA
AWC00287.1|45074_45896_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
AWC00288.1|45993_46212_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00289.1|46729_47143_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWC00290.1|47143_47422_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AWC00291.1|47411_47732_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AWC00292.1|47812_48037_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00293.1|48047_48260_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00294.1|48320_48677_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 3
CP028930	Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence	103694	56500	58382	103694		Enterobacteria_phage(50.0%)	3	NA	NA
AWC00305.1|56500_57043_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	4.3e-48
AWC00306.1|57603_57924_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00307.1|57818_58382_-	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
>prophage 4
CP028930	Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence	103694	61519	78732	103694	transposase	Macacine_betaherpesvirus(30.0%)	18	NA	NA
AWC00312.1|61519_61774_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
AWC00313.1|62010_62436_-	antirestriction protein	NA	NA	NA	NA	NA
AWC00314.1|62473_62695_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00315.1|62619_62898_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00345.1|62956_63187_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00316.1|63420_64905_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWC00317.1|64904_65156_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00318.1|65310_65736_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
AWC00319.1|65735_67007_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
AWC00320.1|68996_69959_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00321.1|69958_70930_-	ParB/RepB/Spo0J family partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
AWC00322.1|70929_72096_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
AWC00323.1|72847_73858_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
AWC00324.1|74194_74392_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00325.1|74574_75315_-	recombinase	NA	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AWC00326.1|76458_77406_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AWC00327.1|77432_77744_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWC00328.1|77808_78732_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
>prophage 5
CP028930	Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence	103694	84040	91530	103694	holin,transposase	Stx2-converting_phage(60.0%)	5	NA	NA
AWC00332.1|84040_86044_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWC00346.1|87077_88285_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AWC00333.1|89194_90733_-|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AWC00334.1|90781_91129_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AWC00335.1|91125_91530_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
>prophage 1
CP028931	Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence	70829	2545	48797	70829	transposase,integrase	Escherichia_phage(40.91%)	53	11098:11112	51065:51079
AWC00349.1|2545_3559_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWC00350.1|3704_4409_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
AWC00351.1|4354_4615_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00352.1|5160_5547_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00353.1|5555_5747_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWC00354.1|6758_7514_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AWC00355.1|7514_7709_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00356.1|8192_8381_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00425.1|8931_9249_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AWC00357.1|9274_10255_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWC00358.1|10293_10467_-	ABC transporter	NA	NA	NA	NA	NA
AWC00359.1|10639_10921_+	cytoplasmic protein	NA	NA	NA	NA	NA
AWC00360.1|10974_11586_+	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
11098:11112	attL	GCGGCAGCACTGAAG	NA	NA	NA	NA
AWC00361.1|11734_12439_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWC00362.1|12429_12612_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00363.1|12575_13436_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWC00364.1|13456_14218_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWC00365.1|14208_14388_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00366.1|14520_17538_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AWC00367.1|17653_17899_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00368.1|17904_18096_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00369.1|18577_19120_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWC00370.1|19132_19993_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AWC00371.1|23139_23472_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWC00372.1|23518_24394_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AWC00373.1|24649_25903_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWC00374.1|25947_26928_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWC00426.1|26966_27053_-	ABC transporter	NA	NA	NA	NA	NA
AWC00375.1|27675_28233_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AWC00427.1|28466_29021_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AWC00376.1|29090_29879_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AWC00377.1|29938_30763_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AWC00378.1|31462_32323_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWC00379.1|33138_33849_-	AAA family ATPase	NA	NA	NA	NA	NA
AWC00380.1|33922_34339_-	PIN domain nuclease	NA	NA	NA	NA	NA
AWC00381.1|34335_34566_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AWC00382.1|34549_34984_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00383.1|35127_35478_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00384.1|35528_36272_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00385.1|36268_37045_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AWC00386.1|37102_37360_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00387.1|38127_38994_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWC00388.1|39350_39620_-	hypothetical protein	NA	NA	NA	NA	NA
AWC00389.1|40034_41240_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AWC00390.1|41236_42214_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AWC00391.1|42295_43567_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AWC00392.1|43566_43998_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AWC00393.1|44155_44407_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00394.1|44406_45891_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWC00395.1|45883_46153_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00396.1|46360_47326_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
AWC00397.1|47805_48237_+	hypothetical protein	NA	NA	NA	NA	NA
AWC00398.1|48269_48797_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
51065:51079	attR	GCGGCAGCACTGAAG	NA	NA	NA	NA
