The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	1320750	1369681	4754975	portal,protease,integrase,terminase,tail,tRNA,holin,head,capsid,lysis	Salmonella_phage(40.38%)	66	1315048:1315062	1340632:1340646
1315048:1315062	attL	CGGCAAATGTCATTT	NA	NA	NA	NA
AVZ62449.1|1320750_1321857_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AVZ62450.1|1321910_1322372_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AVZ62451.1|1322383_1322713_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVZ62452.1|1322709_1323375_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AVZ62453.1|1323546_1324797_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
AVZ62454.1|1324910_1326053_-|integrase	integrase	integrase	O21929	Phage_21	80.0	3.1e-173
AVZ62455.1|1326042_1326279_-	excisionase	NA	NA	NA	NA	NA
AVZ62456.1|1326328_1326832_-	Eaa protein	NA	A0A075B8H2	Enterobacteria_phage	91.0	6.6e-35
AVZ62457.1|1326828_1327161_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	63.6	4.9e-10
AVZ62458.1|1327153_1327474_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
AVZ62459.1|1327509_1328340_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
AVZ62460.1|1328332_1331044_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	44.7	4.1e-155
AVZ62461.1|1331170_1331521_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
AVZ62462.1|1331542_1331701_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AVZ62463.1|1332098_1332305_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
AVZ62464.1|1332331_1332703_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
AVZ62465.1|1332680_1333742_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ62466.1|1333811_1334207_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
AVZ62467.1|1334311_1334548_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
AVZ62468.1|1334513_1334888_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
AVZ62469.1|1334972_1335956_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
AVZ62470.1|1335958_1336708_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AVZ62471.1|1336718_1337066_+	DUF977 domain-containing protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AVZ62472.1|1337062_1337587_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	100.0	1.0e-91
AVZ62473.1|1337586_1338060_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AVZ62474.1|1338451_1338733_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	92.5	1.4e-47
AVZ62475.1|1338924_1339158_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AVZ62476.1|1339274_1339523_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AVZ62477.1|1339557_1340160_+	DUF1367 domain-containing protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AVZ62478.1|1340159_1340366_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	6.0e-35
AVZ62479.1|1340368_1340980_+	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
1340632:1340646	attR	AAATGACATTTGCCG	NA	NA	NA	NA
AVZ62480.1|1340976_1341123_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVZ62481.1|1341112_1341910_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
AVZ62482.1|1342308_1342434_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ62483.1|1342569_1343019_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ62484.1|1343379_1344066_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM2	Phage_Gifsy-1	98.7	5.1e-131
AVZ65720.1|1344341_1344671_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVZ62485.1|1344654_1345107_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	5.1e-79
AVZ65721.1|1345124_1345577_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
AVZ62486.1|1345812_1346214_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVZ62487.1|1346248_1346455_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ62488.1|1346499_1347045_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AVZ62489.1|1347016_1348948_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
AVZ62490.1|1348931_1349135_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
AVZ62491.1|1349131_1350712_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.0	4.3e-189
AVZ62492.1|1350701_1352198_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	6.9e-96
AVZ62493.1|1352210_1352558_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	5.4e-20
AVZ62494.1|1352612_1353641_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
AVZ62495.1|1353698_1354064_+	DNA packaging protein	NA	NA	NA	NA	NA
AVZ62496.1|1354074_1354452_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
AVZ62497.1|1354438_1355017_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
AVZ62498.1|1355013_1355415_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
AVZ62499.1|1355422_1356169_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	77.3	6.7e-100
AVZ62500.1|1356219_1356615_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
AVZ62501.1|1356611_1356950_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AVZ62502.1|1356921_1359963_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.6	4.4e-291
AVZ62503.1|1359965_1360295_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AVZ62504.1|1360304_1361003_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	6.0e-103
AVZ62505.1|1361009_1361747_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	1.2e-128
AVZ62506.1|1361644_1362292_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	6.0e-89
AVZ62507.1|1362354_1365717_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.7	0.0e+00
AVZ62508.1|1365755_1365998_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ62509.1|1366051_1368493_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	61.7	6.2e-86
AVZ62510.1|1368492_1369077_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
AVZ62511.1|1369173_1369374_-	phage virulence factor	NA	NA	NA	NA	NA
AVZ62512.1|1369564_1369681_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 2
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	1966321	2016861	4754975	tRNA,integrase,tail,protease	Moraxella_phage(14.29%)	58	1960875:1960889	2019534:2019548
1960875:1960889	attL	GTGAGCGGCTGTAAA	NA	NA	NA	NA
AVZ63096.1|1966321_1967017_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVZ63097.1|1967074_1968985_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AVZ63098.1|1969116_1969461_+	RidA family protein	NA	NA	NA	NA	NA
AVZ63099.1|1969466_1969646_-	YoaH family protein	NA	NA	NA	NA	NA
AVZ63100.1|1969726_1971091_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
AVZ63101.1|1971094_1971673_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AVZ63102.1|1971936_1973301_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVZ63103.1|1973438_1975040_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVZ63104.1|1975061_1976621_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
AVZ63105.1|1976608_1976944_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63106.1|1977093_1978062_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AVZ63107.1|1978114_1978915_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AVZ63108.1|1978927_1979779_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AVZ63109.1|1979836_1980295_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AVZ65744.1|1980650_1981271_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AVZ63110.1|1981267_1982077_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AVZ63111.1|1982142_1983888_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AVZ63112.1|1984107_1984317_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AVZ63113.1|1984329_1984473_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AVZ63114.1|1985121_1985409_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63115.1|1985479_1985623_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AVZ63116.1|1985780_1986020_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63117.1|1986231_1987023_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AVZ63118.1|1987198_1988572_+	MFS transporter	NA	NA	NA	NA	NA
AVZ63119.1|1988619_1989501_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVZ63120.1|1989694_1991743_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVZ63121.1|1991762_1992449_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVZ63122.1|1992546_1993131_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVZ63123.1|1993172_1994456_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVZ63124.1|1994418_1997058_+	MCE family protein	NA	NA	NA	NA	NA
AVZ65745.1|1997135_1998575_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVZ63125.1|1998689_1998929_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVZ63126.1|1999039_1999231_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVZ63127.1|1999249_1999900_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	2.7e-57
AVZ63128.1|2000123_2000288_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63129.1|2000572_2001295_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVZ63130.1|2001978_2002374_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AVZ63131.1|2002703_2003180_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63132.1|2003552_2003972_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVZ63133.1|2004100_2004295_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63134.1|2004341_2004611_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AVZ63135.1|2004776_2004917_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63136.1|2006380_2006749_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	4.1e-18
AVZ65746.1|2007014_2007215_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63137.1|2007832_2008747_+	protein PagO	NA	NA	NA	NA	NA
AVZ63138.1|2008879_2009038_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63139.1|2009047_2009662_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVZ63140.1|2010414_2010681_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63141.1|2010809_2010935_-	arsenic transporter	NA	NA	NA	NA	NA
AVZ63142.1|2011195_2011312_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVZ63143.1|2011502_2011703_+	phage virulence factor	NA	NA	NA	NA	NA
AVZ63144.1|2011799_2012681_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	75.4	3.7e-65
AVZ63145.1|2013150_2013342_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63146.1|2013406_2013574_+	lytic enzyme	NA	NA	NA	NA	NA
AVZ63147.1|2013830_2014364_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
AVZ63148.1|2014417_2014648_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVZ65747.1|2014837_2015785_+	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.2e-53
AVZ63149.1|2015781_2016861_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	1.3e-99
2019534:2019548	attR	TTTACAGCCGCTCAC	NA	NA	NA	NA
>prophage 3
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	2122513	2133129	4754975		Morganella_phage(25.0%)	12	NA	NA
AVZ63260.1|2122513_2123944_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVZ63261.1|2124017_2124713_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AVZ63262.1|2124792_2125104_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63263.1|2125753_2126965_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
AVZ65753.1|2127224_2127413_-	cold-shock protein	NA	NA	NA	NA	NA
AVZ63264.1|2127423_2127636_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVZ63265.1|2128090_2129359_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
AVZ63266.1|2129361_2129781_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVZ63267.1|2129907_2130069_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63268.1|2130549_2131347_+	protein MtfA	NA	NA	NA	NA	NA
AVZ63269.1|2131718_2132009_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
AVZ63270.1|2132655_2133129_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
>prophage 4
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	2303588	2312759	4754975	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVZ63425.1|2303588_2305622_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
AVZ63426.1|2305862_2306321_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
AVZ63427.1|2306492_2307023_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AVZ63428.1|2307079_2307547_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVZ63429.1|2307593_2308313_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ63430.1|2308309_2309995_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVZ63431.1|2310217_2310949_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVZ63432.1|2311008_2311116_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63433.1|2311096_2311828_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ63434.1|2311811_2312759_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 5
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	2524727	2597770	4754975	protease,terminase,tail,tRNA,head,lysis	Salmonella_phage(54.55%)	102	NA	NA
AVZ63633.1|2524727_2525540_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVZ63634.1|2525539_2526553_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ63635.1|2526620_2527757_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
AVZ63636.1|2527860_2528862_+	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AVZ63637.1|2528858_2530037_-	MFS transporter	NA	NA	NA	NA	NA
AVZ63638.1|2530216_2530591_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63639.1|2530763_2531012_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
AVZ63640.1|2531180_2531549_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
AVZ63641.1|2531548_2532067_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVZ63642.1|2532133_2532790_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVZ63643.1|2532887_2534102_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AVZ63644.1|2534201_2536262_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVZ63645.1|2536313_2536589_-	YfcL family protein	NA	NA	NA	NA	NA
AVZ63646.1|2536621_2537170_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVZ63647.1|2537169_2537979_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63648.1|2537978_2538803_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVZ63649.1|2538806_2539892_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
AVZ63650.1|2539927_2540860_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVZ63651.1|2541025_2541577_+	endonuclease SmrB	NA	NA	NA	NA	NA
AVZ63652.1|2541676_2542162_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVZ63653.1|2542370_2544518_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVZ63654.1|2544517_2545828_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVZ63655.1|2546005_2546290_-	DUF406 family protein	NA	NA	NA	NA	NA
AVZ63656.1|2546660_2547968_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AVZ63657.1|2548028_2548784_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVZ63658.1|2549072_2550014_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
AVZ63659.1|2550327_2551497_+	DUF4102 domain-containing protein	NA	I6R0M2	Salmonella_phage	99.0	1.0e-227
AVZ63660.1|2551568_2552867_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	97.7	3.0e-241
AVZ63661.1|2552877_2553837_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AVZ63662.1|2553845_2557016_-	host specificity protein J	NA	A0A1V0E5M1	Salmonella_phage	95.2	0.0e+00
AVZ63663.1|2557060_2557615_-	HNH endonuclease	NA	A0A2P1CKX5	Escherichia_phage	40.0	2.1e-10
AVZ63664.1|2557713_2558241_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	80.0	3.0e-62
AVZ63665.1|2558183_2558903_-|tail	phage tail protein	tail	A0A1V0E5M9	Salmonella_phage	90.0	3.4e-133
AVZ63666.1|2558902_2559607_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	5.5e-136
AVZ63667.1|2559742_2559988_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63668.1|2560140_2560488_-|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	93.9	9.1e-60
AVZ63669.1|2560580_2560979_+	hypothetical protein	NA	A0A1V0E5N6	Salmonella_phage	98.5	4.2e-69
AVZ63670.1|2560979_2563163_-	hypothetical protein	NA	H6WRV7	Salmonella_phage	94.5	6.6e-305
AVZ63671.1|2563222_2563537_-	hypothetical protein	NA	H6WRV4	Salmonella_phage	80.8	5.9e-42
AVZ65770.1|2563552_2563804_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	79.5	2.6e-32
AVZ63672.1|2563995_2564268_-	hypothetical protein	NA	H6WRV0	Salmonella_phage	100.0	4.5e-46
AVZ63673.1|2564267_2565056_-	phage antirepressor Ant	NA	H6WRU9	Salmonella_phage	100.0	5.2e-127
AVZ63674.1|2565120_2565987_-	hypothetical protein	NA	B6SD57	Bacteriophage	53.2	5.1e-67
AVZ63675.1|2566240_2566567_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	94.9	8.6e-44
AVZ63676.1|2566588_2566774_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63677.1|2566766_2567135_+	hypothetical protein	NA	H6WRU4	Salmonella_phage	65.0	9.4e-39
AVZ63678.1|2567149_2567371_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	78.8	9.3e-26
AVZ63679.1|2567439_2567754_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63680.1|2567785_2568439_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	98.6	2.5e-119
AVZ63681.1|2568484_2569222_-	hypothetical protein	NA	Q5G8X3	Enterobacteria_phage	96.3	1.7e-127
AVZ63682.1|2569237_2569624_-	hypothetical protein	NA	I6R9A6	Salmonella_phage	100.0	2.0e-68
AVZ63683.1|2569620_2570016_-	hypothetical protein	NA	I6RSK8	Salmonella_phage	100.0	3.2e-69
AVZ63684.1|2570023_2570386_-	hypothetical protein	NA	I6S1Q5	Salmonella_phage	100.0	4.3e-68
AVZ63685.1|2570369_2570558_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	100.0	1.4e-30
AVZ63686.1|2570557_2570959_-	hypothetical protein	NA	I6S619	Salmonella_phage	99.2	1.6e-71
AVZ63687.1|2571010_2571190_-	glycoprotein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
AVZ63688.1|2571199_2572276_-	hypothetical protein	NA	I6RSK5	Salmonella_phage	100.0	2.4e-207
AVZ63689.1|2572293_2572743_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	100.0	9.6e-78
AVZ63690.1|2572755_2574021_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	96.9	3.4e-229
AVZ63691.1|2574023_2574950_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	97.7	1.9e-168
AVZ63692.1|2574909_2576259_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	98.7	1.3e-255
AVZ63693.1|2576391_2577711_-|terminase	PBSX family phage terminase large subunit	terminase	Q5G8Y7	Enterobacteria_phage	98.4	2.3e-260
AVZ63694.1|2577694_2578126_-|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	100.0	7.6e-72
AVZ63695.1|2578559_2579246_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	2.7e-124
AVZ63696.1|2579232_2579424_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.9e-27
AVZ63697.1|2579458_2579896_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
AVZ65771.1|2579892_2580390_-	lysozyme	NA	A0A0M3ULD1	Salmonella_phage	97.0	9.3e-90
AVZ63698.1|2580367_2580571_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	98.5	9.4e-33
AVZ63699.1|2581099_2581879_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	98.4	7.6e-131
AVZ63700.1|2581875_2582055_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	2.7e-23
AVZ63701.1|2582035_2582239_-	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	92.5	8.8e-31
AVZ63702.1|2582235_2582847_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	89.7	1.3e-96
AVZ63703.1|2582839_2583016_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
AVZ63704.1|2583008_2583350_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AVZ63705.1|2583352_2583529_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
AVZ63706.1|2583495_2583669_-	protein ninD	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
AVZ63707.1|2583665_2584121_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.7e-80
AVZ63708.1|2584176_2584446_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
AVZ63709.1|2584442_2585819_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
AVZ63710.1|2585815_2586637_-	replication of DNA	NA	A0A192Y6S6	Salmonella_phage	100.0	5.2e-154
AVZ63711.1|2586819_2587101_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
AVZ63712.1|2587211_2587427_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
AVZ63713.1|2587537_2588227_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
AVZ63714.1|2588391_2589471_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
AVZ63715.1|2589509_2589713_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
AVZ63716.1|2590076_2590379_+	regulator	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
AVZ63717.1|2590391_2590979_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
AVZ63718.1|2591192_2591387_+	restriction endonuclease	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
AVZ65772.1|2591470_2591959_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	3.9e-32
AVZ63719.1|2592003_2592303_+	hypothetical protein	NA	A0A1R3Y5U4	Salmonella_virus	92.9	9.9e-47
AVZ63720.1|2592929_2593238_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	97.1	2.1e-52
AVZ63721.1|2593234_2594056_+	exonuclease VIII	NA	A0A0M5M5Y6	Salmonella_phage	98.5	8.0e-155
AVZ63722.1|2594055_2594625_+	hypothetical protein	NA	A0A0M4RD07	Salmonella_phage	98.4	1.9e-99
AVZ63723.1|2594624_2594939_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	100.0	7.0e-51
AVZ63724.1|2594955_2595126_+	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AVZ63725.1|2595122_2595548_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	79.3	7.2e-67
AVZ63726.1|2595544_2595778_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63727.1|2595764_2596409_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
AVZ63728.1|2596408_2596693_+	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
AVZ63729.1|2596685_2596970_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
AVZ63730.1|2597275_2597479_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	98.5	1.0e-31
AVZ63731.1|2597488_2597770_+	hypothetical protein	NA	C6ZR23	Salmonella_phage	75.0	2.9e-08
>prophage 6
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	2889484	2899365	4754975		Enterobacteria_phage(87.5%)	12	NA	NA
AVZ63962.1|2889484_2890681_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
AVZ63963.1|2890717_2892127_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ63964.1|2892510_2892696_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63965.1|2892659_2893226_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.3e-55
AVZ63966.1|2893242_2893488_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	75.3	5.3e-30
AVZ63967.1|2893484_2894222_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	62.3	1.7e-76
AVZ63968.1|2895032_2895635_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.8	4.2e-44
AVZ63969.1|2895624_2895924_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	70.7	6.1e-28
AVZ63970.1|2895916_2896366_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.5	1.5e-43
AVZ63971.1|2896439_2896700_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63972.1|2896696_2897017_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ63973.1|2897031_2899365_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
>prophage 7
CP028729	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 chromosome, complete genome	4754975	4405126	4425575	4754975	plate,tail	Burkholderia_phage(40.0%)	25	NA	NA
AVZ65347.1|4405126_4405855_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
AVZ65348.1|4406593_4407049_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ65349.1|4407045_4407651_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AVZ65350.1|4407655_4409425_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.2e-52
AVZ65351.1|4409427_4410060_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AVZ65352.1|4410052_4411168_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
AVZ65353.1|4411158_4411518_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	3.6e-35
AVZ65354.1|4411681_4413229_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
AVZ65355.1|4413228_4414158_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
AVZ65356.1|4414154_4414517_-	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AVZ65357.1|4414844_4415567_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AVZ65358.1|4415576_4416620_-	phage protein D	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
AVZ65359.1|4416607_4416817_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
AVZ65360.1|4416816_4417770_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AVZ65361.1|4417769_4420124_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
AVZ65362.1|4420220_4420349_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVZ65363.1|4420308_4420626_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVZ65364.1|4420677_4421202_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVZ65365.1|4421201_4422629_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AVZ65366.1|4422618_4422816_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVZ65367.1|4422812_4423268_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ65368.1|4423428_4423743_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
AVZ65369.1|4423755_4424361_-	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
AVZ65370.1|4424363_4424651_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AVZ65371.1|4425227_4425575_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
CP029249	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence	152940	5399	57500	152940	head,transposase,tail	Salmonella_phage(33.33%)	46	NA	NA
AWK67451.1|5399_6017_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AWK67452.1|6017_6224_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67453.1|6228_6528_+	RNA-binding protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	2.1e-20
AWK67454.1|6619_7108_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67455.1|7122_9315_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.2	1.7e-42
AWK67456.1|9314_9548_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67457.1|9529_10147_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67458.1|10314_13287_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AWK67459.1|13283_15149_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AWK67460.1|15159_15744_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67461.1|15700_16330_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AWK67462.1|16339_16786_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67463.1|16795_17173_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67464.1|17172_17835_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67465.1|18158_18536_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67466.1|18680_18962_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWK67467.1|18958_19585_+	pilus assembly protein	NA	NA	NA	NA	NA
AWK67468.1|19568_20486_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AWK67469.1|20482_21799_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWK67470.1|21795_22374_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AWK67471.1|22377_22770_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
AWK67472.1|23054_24317_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWK67473.1|24639_25785_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
AWK67474.1|25878_26412_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
AWK67475.1|26408_26726_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
AWK67476.1|26982_27408_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWK67477.1|27453_32940_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
AWK67478.1|33088_33796_+	DsbC family protein	NA	NA	NA	NA	NA
AWK67479.1|33792_36240_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AWK67480.1|36254_36572_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67481.1|36568_37099_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AWK67482.1|37061_38327_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
AWK67483.1|38323_38995_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWK67484.1|38991_39999_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AWK67485.1|42960_43665_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWK67486.1|44421_45078_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AWK67487.1|45857_47249_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AWK67488.1|47285_47858_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AWK67489.1|47994_48585_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AWK67490.1|48708_51696_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.7	1.5e-296
AWK67491.1|51863_52499_+	resolvase	NA	NA	NA	NA	NA
AWK67609.1|52526_53363_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWK67492.1|53428_53827_-	VOC family protein	NA	NA	NA	NA	NA
AWK67493.1|53868_54978_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
AWK67494.1|55008_55284_-	regulator protein FrmR	NA	NA	NA	NA	NA
AWK67495.1|56939_57500_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
>prophage 2
CP029249	Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence	152940	111675	137494	152940	transposase,integrase	Escherichia_phage(37.5%)	28	131428:131487	137487:138288
AWK67565.1|111675_112686_-|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
AWK67566.1|112688_113225_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67567.1|113217_113505_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67568.1|113523_113844_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67569.1|114074_114677_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67570.1|115315_115756_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67571.1|115727_119981_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AWK67616.1|119935_120139_+	hypothetical protein	NA	NA	NA	NA	NA
AWK67572.1|120113_120839_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67573.1|120952_121354_-	hypothetical protein	NA	NA	NA	NA	NA
AWK67574.1|121969_122974_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWK67575.1|123073_123508_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWK67576.1|123579_123930_+	mercuric transporter	NA	NA	NA	NA	NA
AWK67577.1|123945_124221_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWK67578.1|124292_125978_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AWK67579.1|125992_126631_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
AWK67580.1|126742_127108_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AWK67581.1|127104_127341_+	mercury resistance protein	NA	NA	NA	NA	NA
AWK67582.1|127337_128327_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWK67583.1|128536_129241_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
131428:131487	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AWK67584.1|131479_132184_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWK67585.1|132230_133535_-|integrase	integrase	integrase	NA	NA	NA	NA
AWK67586.1|133573_134281_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWK67587.1|134277_134514_-	mercury resistance protein	NA	NA	NA	NA	NA
AWK67588.1|134510_134873_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK67589.1|135548_136409_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AWK67617.1|136591_136813_-	hypothetical protein	NA	Q1MVP4	Enterobacteria_phage	100.0	6.7e-16
AWK67590.1|136789_137494_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
137487:138288	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGACGAGCAGCAGCACCAGGAGCAGAAGCACGTCGAGAAAAAGCAACAGCAGATCGAGCAGCGCCCACGGCGGGCCGCTCGCATCGGATAAGTCGAAAAATCCGGCTAAAGTGGCCGAGCTGCACATCAGGCCGCGCGGTTTTCCTCCCTGATCGCCGGCGCGGTTTCTTCCTCCCTGAACCGCATGCAGACTTGCCGCCTCGGACACCCCGAGGCGGTTTTTTTTTCGCCTCGCTCGAGCATCGCCGCATCCGACGATGCCGAGACGACCAGGCCGCGCACGTCGAGCTGCAGCATCGCCATTGCCGACGATGGCACCAGGTCGCCGGCGGTGGCCACCGACCTCGAGCTCGCATCGCCACATCCGACGATGCGCGCCGGCGTCGACCATCGCCAGGTCTGACGATGGCGGCCGCCCTGCCCTGGATCTCGCATCGCCATTTCTGGCGATGAGATCCACGGAGCGGCCATTTAGACCCGCCAATAACGACCCGGCCAAGATAAATCGCATGACGGCCTTTTTGGCCGGGGGTAGCATGACCGGACACTTTGCGTATGCCCAAAGGAGCCCGCAAGTATGCGCAGGACGAAGCCAGTAGCCGCGCCGATGGTGGCGCGGGTCTATCTGCGCGTCAGCACCGACGCGCAGGACTTGGAACGCCAAGAGGCGATCACTACGGCCGCGAAGGCCGCCGGCTACTACGTCGCCGGCATCTACCGTGAGAAGGCATCCGGCGCA	NA	NA	NA	NA
