The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	1385537	1438764	4614635	terminase,integrase,lysis,transposase,tRNA	Enterobacteria_phage(55.56%)	60	1420161:1420207	1442723:1442769
AVZ53021.1|1385537_1386632_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AVZ53022.1|1386700_1387627_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AVZ53023.1|1387856_1388339_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AVZ53024.1|1388416_1389232_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ53025.1|1389321_1391103_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AVZ53026.1|1391115_1391892_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AVZ53027.1|1391991_1392870_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AVZ53028.1|1393038_1394493_+	putative allantoin permease	NA	NA	NA	NA	NA
AVZ53029.1|1394552_1395914_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AVZ53030.1|1395970_1397272_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AVZ53031.1|1397293_1398439_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
AVZ53032.1|1398666_1399452_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AVZ53033.1|1399462_1400698_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AVZ53034.1|1400719_1401769_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AVZ53035.1|1402085_1403753_+	protein FdrA	NA	NA	NA	NA	NA
AVZ53036.1|1403762_1405022_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AVZ53037.1|1405032_1405848_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AVZ53038.1|1405844_1406738_+	carbamate kinase	NA	NA	NA	NA	NA
AVZ53039.1|1406932_1408000_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVZ53040.1|1407996_1408506_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AVZ53041.1|1408623_1409346_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AVZ53042.1|1409348_1409843_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AVZ53043.1|1410016_1411402_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
AVZ53044.1|1411437_1411959_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ53045.1|1412066_1412279_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVZ53046.1|1412280_1413147_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	2.2e-30
AVZ53047.1|1413617_1414160_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AVZ53048.1|1414379_1415072_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AVZ53049.1|1415102_1417706_+	outer membrane usher protein SfmD	NA	NA	NA	NA	NA
AVZ53050.1|1417684_1418725_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AVZ53051.1|1418735_1419251_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AVZ53052.1|1419253_1419886_-	DNA-binding response regulator	NA	NA	NA	NA	NA
1420161:1420207	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AVZ53053.1|1420220_1421384_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
AVZ53054.1|1421503_1421767_-	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AVZ53055.1|1422089_1422185_+	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AVZ53056.1|1422247_1423409_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVZ53057.1|1423720_1424053_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AVZ53058.1|1424307_1425834_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AVZ53059.1|1426298_1426850_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVZ53060.1|1426859_1427657_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ53061.1|1427773_1427875_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53062.1|1427871_1428327_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AVZ53063.1|1428326_1428497_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVZ53064.1|1428489_1428780_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AVZ53065.1|1428776_1429139_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AVZ53066.1|1429135_1429276_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AVZ53067.1|1429672_1430834_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVZ53068.1|1431147_1431366_+	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AVZ53069.1|1431403_1432420_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVZ53070.1|1432424_1433492_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AVZ53071.1|1434064_1434280_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVZ53072.1|1434279_1434777_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AVZ53073.1|1434773_1435235_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AVZ53074.1|1435266_1435560_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AVZ53075.1|1435850_1436261_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AVZ53076.1|1436546_1436753_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AVZ53077.1|1436917_1437112_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AVZ53078.1|1437259_1437361_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53079.1|1437500_1438046_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AVZ53080.1|1438020_1438764_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1442723:1442769	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2057753	2072134	4614635	tail,integrase	Shigella_phage(36.84%)	23	2061434:2061447	2069510:2069523
AVZ53637.1|2057753_2058881_-|integrase	integrase	integrase	O21925	Phage_21	61.5	7.2e-122
AVZ53638.1|2058861_2059107_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AVZ53639.1|2059371_2059572_+	hypothetical protein	NA	U5P0J5	Shigella_phage	88.0	1.7e-18
AVZ53640.1|2059571_2059913_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53641.1|2059850_2060159_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
AVZ53642.1|2060333_2061008_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AVZ53643.1|2061098_2061299_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AVZ53644.1|2061342_2061900_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
2061434:2061447	attL	CTGAAGCGGCTGAC	NA	NA	NA	NA
AVZ53645.1|2062075_2062255_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AVZ53646.1|2062244_2063612_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
AVZ53647.1|2063623_2063806_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AVZ53648.1|2063805_2064279_+	hypothetical protein	NA	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
AVZ53649.1|2064205_2064997_+	hypothetical protein	NA	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
AVZ53650.1|2064987_2065572_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	2.0e-112
AVZ53651.1|2065575_2066364_+|integrase	integrase	integrase	U5P0I1	Shigella_phage	94.4	2.7e-51
AVZ53652.1|2066363_2066966_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
AVZ53653.1|2066937_2067351_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
AVZ53654.1|2067759_2068314_+	DNA-invertase from lambdoid prophage e14	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
AVZ53655.1|2068420_2069254_+	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AVZ53656.1|2069487_2069652_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
2069510:2069523	attR	CTGAAGCGGCTGAC	NA	NA	NA	NA
AVZ53657.1|2069754_2070078_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AVZ53658.1|2070777_2071182_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVZ53659.1|2071402_2072134_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 3
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2264770	2295101	4614635	tail,transposase,integrase,tRNA	Escherichia_phage(41.38%)	39	2265596:2265610	2297376:2297390
AVZ56073.1|2264770_2266003_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2265596:2265610	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AVZ53842.1|2266257_2267241_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVZ53843.1|2267515_2267689_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53844.1|2267718_2269092_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVZ53845.1|2269220_2270156_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVZ53846.1|2270207_2271443_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AVZ53847.1|2271444_2271660_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVZ56075.1|2271738_2271948_-	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AVZ56074.1|2271940_2272135_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AVZ53848.1|2272191_2273001_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AVZ53849.1|2272993_2275594_-	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AVZ53850.1|2275695_2275971_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVZ56076.1|2276045_2276216_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVZ53851.1|2276215_2276437_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AVZ53852.1|2276565_2276844_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53853.1|2276878_2277367_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVZ53854.1|2277363_2277519_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AVZ53855.1|2277529_2277709_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ53856.1|2277972_2278449_-	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AVZ53857.1|2278572_2278869_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AVZ53858.1|2278891_2279314_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AVZ53859.1|2279326_2280184_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AVZ53860.1|2280190_2280937_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AVZ53861.1|2281607_2281793_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AVZ53862.1|2281989_2283447_+	potassium transporter TrkG	NA	NA	NA	NA	NA
AVZ53863.1|2283385_2283667_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53864.1|2283584_2283848_+	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AVZ53865.1|2283828_2284188_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53866.1|2284295_2284496_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ53867.1|2285566_2285821_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	95.8	7.4e-35
AVZ56078.1|2285795_2285915_+	ABC transporter	NA	NA	NA	NA	NA
AVZ53868.1|2285953_2286934_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AVZ56077.1|2286976_2287192_+	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AVZ56079.1|2287256_2290619_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AVZ53869.1|2290618_2291194_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AVZ53870.1|2291291_2291882_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVZ53871.1|2292198_2292432_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AVZ53872.1|2293392_2293827_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AVZ53873.1|2293967_2295101_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
2297376:2297390	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 4
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2487659	2532427	4614635	protease,tail,integrase,lysis,transposase	Enterobacteria_phage(34.48%)	61	2497250:2497265	2523398:2523413
AVZ54035.1|2487659_2489120_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
AVZ54036.1|2489208_2490492_-	MFS transporter	NA	NA	NA	NA	NA
AVZ54037.1|2491278_2491512_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
AVZ54038.1|2491828_2492419_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVZ54039.1|2492516_2493092_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AVZ54040.1|2493091_2494054_-|tail	side tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AVZ54041.1|2494004_2494574_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AVZ54042.1|2494713_2494815_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ54043.1|2494962_2495196_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVZ54044.1|2495253_2495664_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVZ54045.1|2495815_2495989_-	protein GnsB	NA	NA	NA	NA	NA
AVZ54046.1|2496160_2496316_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ54047.1|2496462_2496651_-	cold-shock protein	NA	NA	NA	NA	NA
AVZ54048.1|2496661_2496874_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVZ54049.1|2497236_2497734_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2497250:2497265	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
AVZ54050.1|2497730_2498264_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVZ54051.1|2498260_2498572_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVZ54052.1|2498576_2498792_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVZ54053.1|2499545_2499761_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVZ54054.1|2500061_2500274_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AVZ54055.1|2500695_2501448_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVZ54056.1|2501461_2502511_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
AVZ54057.1|2502512_2502791_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ54058.1|2502857_2503109_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ54059.1|2503325_2503481_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVZ54060.1|2503552_2503840_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVZ54061.1|2503839_2504079_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVZ54062.1|2504103_2504409_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ54063.1|2504611_2504944_+	protein FlxA	NA	NA	NA	NA	NA
AVZ54064.1|2505213_2505336_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AVZ54065.1|2505826_2506057_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AVZ54066.1|2506140_2506548_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AVZ54067.1|2506714_2506870_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVZ54068.1|2506829_2507000_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ54069.1|2507029_2507248_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ54070.1|2507815_2508004_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AVZ54071.1|2508000_2508192_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVZ54072.1|2509718_2510915_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	59.2	7.9e-135
AVZ54073.1|2510934_2511045_-	transporter	NA	NA	NA	NA	NA
AVZ54074.1|2511102_2512122_-	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AVZ54075.1|2512133_2513348_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVZ54076.1|2513328_2513517_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ54077.1|2513553_2513880_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVZ54078.1|2514014_2514356_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVZ54079.1|2514390_2514951_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVZ56087.1|2514953_2515664_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVZ54080.1|2515771_2516077_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVZ54081.1|2516275_2518702_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	8.6e-213
AVZ56088.1|2518762_2521186_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AVZ54082.1|2521196_2521814_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVZ54083.1|2521815_2522670_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVZ54084.1|2522712_2523327_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AVZ56089.1|2523485_2524778_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2523398:2523413	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
AVZ54085.1|2524730_2525426_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AVZ54086.1|2525550_2526702_-	ROK family protein	NA	NA	NA	NA	NA
AVZ54087.1|2526811_2528140_+|transposase	IS4 family transposase IS4	transposase	NA	NA	NA	NA
AVZ54088.1|2528344_2529238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ54089.1|2529344_2530598_+	MFS transporter	NA	NA	NA	NA	NA
AVZ54090.1|2530994_2531330_+	acid shock protein	NA	NA	NA	NA	NA
AVZ54091.1|2531422_2531506_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ54092.1|2531605_2532427_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	2967292	2975963	4614635		Escherichia_phage(28.57%)	8	NA	NA
AVZ54516.1|2967292_2968396_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
AVZ54517.1|2968403_2969651_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
AVZ54518.1|2969647_2970205_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AVZ54519.1|2970204_2971086_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AVZ54520.1|2971143_2972043_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
AVZ54521.1|2972042_2973128_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AVZ54522.1|2973500_2974394_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVZ54523.1|2974568_2975963_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3068029	3077470	4614635		Enterobacteria_phage(85.71%)	10	NA	NA
AVZ54594.1|3068029_3069166_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AVZ54595.1|3069162_3071007_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AVZ54596.1|3071287_3071749_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVZ54597.1|3071788_3072259_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AVZ54598.1|3072305_3073025_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ54599.1|3073021_3074707_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVZ54600.1|3074928_3075660_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	6.3e-111
AVZ54601.1|3075719_3075827_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ54602.1|3075807_3076539_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVZ54603.1|3076543_3077470_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 7
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3326140	3337350	4614635	tail,integrase	Enterobacteria_phage(56.25%)	16	3324115:3324131	3341025:3341041
3324115:3324131	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
AVZ54828.1|3326140_3327073_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
AVZ54829.1|3327384_3328542_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AVZ54830.1|3328694_3329057_+	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AVZ54831.1|3329053_3329974_+	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	89.5	1.6e-159
AVZ54832.1|3329970_3331302_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AVZ54833.1|3331600_3331945_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AVZ54834.1|3331916_3332357_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AVZ56118.1|3332383_3332902_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AVZ54835.1|3332951_3333227_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AVZ54836.1|3333226_3333721_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AVZ54837.1|3334443_3334806_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AVZ54838.1|3334871_3335696_+	DUF2303 domain-containing protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AVZ54839.1|3335823_3336360_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AVZ54840.1|3336350_3336713_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AVZ54841.1|3336712_3337018_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AVZ54842.1|3337149_3337350_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3341025:3341041	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3489959	3496109	4614635	transposase	Escherichia_phage(83.33%)	8	NA	NA
AVZ54978.1|3489959_3490112_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AVZ54979.1|3490129_3490321_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVZ54980.1|3490382_3490529_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AVZ54981.1|3490631_3491150_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AVZ54982.1|3491182_3492199_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVZ54983.1|3492364_3492904_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AVZ54984.1|3492996_3494574_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVZ54985.1|3494642_3496109_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 9
CP028703	Escherichia coli strain ME8067 chromosome, complete genome	4614635	3718856	3725995	4614635		Escherichia_phage(83.33%)	6	NA	NA
AVZ55185.1|3718856_3721418_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AVZ55186.1|3721523_3722180_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AVZ55187.1|3722230_3722998_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVZ55188.1|3723193_3724102_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AVZ55189.1|3724098_3725265_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AVZ55190.1|3725356_3725995_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
