The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	911960	965264	4682574	integrase,lysis,terminase,transposase,tRNA	Enterobacteria_phage(53.57%)	60	947922:947968	969224:969270
AVZ48047.1|911960_913055_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
AVZ48048.1|913123_914050_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
AVZ48049.1|914279_914762_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
AVZ48050.1|914839_915655_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ48051.1|915744_917526_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
AVZ48052.1|917538_918315_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AVZ48053.1|918414_919293_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
AVZ48054.1|920356_921565_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVZ48055.1|922313_923675_+	cyclic amidohydrolase	NA	NA	NA	NA	NA
AVZ48056.1|923731_925033_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
AVZ48057.1|925054_926200_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
AVZ48058.1|926427_927213_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
AVZ48059.1|927223_928459_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AVZ48060.1|928480_929530_-	ureidoglycolate dehydrogenase (NAD(+))	NA	NA	NA	NA	NA
AVZ48061.1|929846_931514_+	protein FdrA	NA	NA	NA	NA	NA
AVZ48062.1|931523_932783_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
AVZ48063.1|932793_933609_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
AVZ48064.1|933605_934499_+	carbamate kinase	NA	NA	NA	NA	NA
AVZ48065.1|934693_935761_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AVZ48066.1|935757_936267_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AVZ48067.1|936384_937107_-	UDP-2,3-diacylglucosamine hydrolase	NA	NA	NA	NA	NA
AVZ48068.1|937109_937604_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AVZ48069.1|937777_939163_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
AVZ48070.1|939198_939720_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ48071.1|939827_940040_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVZ48072.1|940041_940908_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVZ48073.1|941378_941921_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AVZ48074.1|942140_942833_+	fimbrial chaperone SfmC	NA	NA	NA	NA	NA
AVZ48075.1|942863_945467_+	outer membrane usher protein SfmD	NA	NA	NA	NA	NA
AVZ48076.1|945445_946486_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AVZ48077.1|946496_947012_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AVZ48078.1|947014_947647_-	DNA-binding response regulator	NA	NA	NA	NA	NA
947922:947968	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AVZ48079.1|947981_949145_-|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
AVZ48080.1|949264_949528_-	hypothetical protein	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
AVZ48081.1|949850_949946_+	protein ren	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
AVZ48082.1|950008_951170_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AVZ48083.1|951481_951814_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AVZ48084.1|952068_953595_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AVZ48085.1|954059_954611_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVZ48086.1|954620_955418_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ48087.1|955534_955636_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48088.1|955632_956088_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
AVZ48089.1|956087_956258_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVZ48090.1|956250_956541_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AVZ48091.1|956537_956900_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AVZ48092.1|956896_957037_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AVZ48093.1|957122_957506_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AVZ48094.1|957647_957866_+	hypothetical protein	NA	Q38586	Enterobacteria_phage	70.2	1.1e-13
AVZ48095.1|957903_958920_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
AVZ48096.1|958924_959992_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
AVZ48097.1|960564_960780_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVZ48098.1|960779_961277_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
AVZ48099.1|961273_961735_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	3.9e-74
AVZ48100.1|961766_962060_-	lipoprotein bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
AVZ48101.1|962350_962761_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
AVZ48102.1|963046_963253_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AVZ48103.1|963417_963612_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AVZ48104.1|963759_963861_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48105.1|964000_964546_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AVZ48106.1|964520_965264_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
969224:969270	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1190582	1240927	4682574	integrase,head,holin,lysis,terminase,tail,capsid,portal	Enterobacteria_phage(75.0%)	71	1188860:1188875	1213660:1213675
1188860:1188875	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
AVZ48308.1|1190582_1191653_-|integrase	integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
AVZ48309.1|1191630_1191849_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
AVZ48310.1|1191888_1192056_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
AVZ48311.1|1192144_1192426_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
AVZ48312.1|1192617_1193166_-	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
AVZ48313.1|1193162_1193384_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
AVZ48314.1|1193775_1193967_-	DUF1382 domain-containing protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
AVZ51610.1|1193939_1194122_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
AVZ48315.1|1194118_1194799_-	exonuclease	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
AVZ48316.1|1194795_1195581_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
AVZ48317.1|1195586_1196003_-	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	100.0	1.7e-73
AVZ48318.1|1195957_1196227_-	host cell division inhibitory peptide Kil	NA	G3CFI2	Escherichia_phage	98.9	3.0e-42
AVZ48319.1|1196306_1196675_-	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AVZ48320.1|1196857_1197058_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AVZ48321.1|1197324_1197807_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
AVZ51611.1|1197807_1198131_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
AVZ48322.1|1198595_1199030_-	biopolymer transporter ExbB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
AVZ48323.1|1199045_1199885_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
AVZ48324.1|1199997_1200711_-	LexA family transcriptional repressor	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
AVZ48325.1|1200811_1201012_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AVZ48326.1|1201130_1201424_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AVZ48327.1|1201456_1202356_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AVZ48328.1|1202352_1203054_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
AVZ48329.1|1203050_1203341_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
AVZ48330.1|1203396_1203855_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AVZ48331.1|1203833_1204724_+	hypothetical protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	7.3e-178
AVZ48332.1|1204720_1204894_+	protein ninD	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
AVZ48333.1|1204860_1205043_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
AVZ48334.1|1205039_1205210_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
AVZ48335.1|1205202_1205814_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
AVZ48336.1|1205810_1206017_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AVZ48337.1|1205994_1206660_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
AVZ48338.1|1206656_1207280_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
AVZ48339.1|1207391_1207586_+	hypothetical protein	NA	C6ZCW9	Enterobacteria_phage	100.0	1.0e-28
AVZ48340.1|1207956_1208280_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
AVZ48341.1|1208263_1208740_+	lysozyme	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
AVZ48342.1|1208736_1209198_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	100.0	1.9e-76
AVZ48343.1|1209229_1209523_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
AVZ48344.1|1209812_1210223_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
AVZ48345.1|1210508_1210715_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AVZ48346.1|1210879_1211074_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
AVZ48347.1|1211221_1211323_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48348.1|1211462_1212008_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
AVZ48349.1|1211982_1213908_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
1213660:1213675	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
AVZ48350.1|1213904_1214111_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVZ48351.1|1214107_1215709_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
AVZ48352.1|1215689_1217009_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
AVZ48353.1|1217018_1217351_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
AVZ48354.1|1217406_1218432_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
AVZ48355.1|1218473_1218872_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
AVZ48356.1|1218883_1219237_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AVZ48357.1|1219248_1219827_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AVZ48358.1|1219823_1220219_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AVZ51612.1|1220226_1220967_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AVZ48359.1|1220982_1221405_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVZ48360.1|1221386_1221821_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVZ48361.1|1221813_1224375_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
AVZ48362.1|1224371_1224701_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AVZ48363.1|1224700_1225399_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AVZ48364.1|1225404_1226148_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AVZ48365.1|1226045_1226717_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	8.1e-105
AVZ48366.1|1226777_1230176_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
AVZ48367.1|1230237_1230858_+	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
AVZ48368.1|1230922_1233247_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
AVZ48369.1|1233246_1233831_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
AVZ48370.1|1233959_1235192_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
AVZ48371.1|1235782_1236673_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
AVZ48372.1|1236669_1238247_-	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
AVZ48373.1|1239008_1239188_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ48374.1|1239102_1239579_-	kinase inhibitor	NA	NA	NA	NA	NA
AVZ48375.1|1239637_1240927_-	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 3
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1632867	1647248	4682574	integrase,tail	Shigella_phage(30.0%)	24	1631829:1631842	1649860:1649873
1631829:1631842	attL	ATTCATCTTATTTT	NA	NA	NA	NA
AVZ48733.1|1632867_1633995_-|integrase	integrase	integrase	O21925	Phage_21	61.5	7.2e-122
AVZ48734.1|1633975_1634221_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
AVZ48735.1|1634485_1634686_+	hypothetical protein	NA	U5P0J5	Shigella_phage	88.0	1.7e-18
AVZ48736.1|1634685_1635027_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48737.1|1634964_1635273_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
AVZ48738.1|1635447_1636122_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AVZ48739.1|1636212_1636413_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AVZ48740.1|1636456_1637014_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
AVZ48741.1|1637189_1637369_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AVZ48742.1|1637358_1638726_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
AVZ48743.1|1638737_1638920_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AVZ48744.1|1638919_1639393_+	hypothetical protein	NA	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
AVZ48745.1|1639319_1640111_+	hypothetical protein	NA	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
AVZ48746.1|1640101_1640686_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	2.0e-112
AVZ48747.1|1640689_1641319_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
AVZ48748.1|1641320_1641734_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
AVZ48749.1|1641705_1642308_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
AVZ51628.1|1642307_1642802_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
AVZ48750.1|1642873_1643428_+	DNA-invertase from lambdoid prophage e14	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
AVZ48751.1|1643534_1644368_+	5-methylcytosine-specific restriction enzyme A	NA	NA	NA	NA	NA
AVZ48752.1|1644601_1644766_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
AVZ48753.1|1644868_1645192_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
AVZ48754.1|1645891_1646296_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVZ48755.1|1646516_1647248_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1649860:1649873	attR	ATTCATCTTATTTT	NA	NA	NA	NA
>prophage 4
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1839890	1870221	4682574	integrase,tail,transposase,tRNA	Escherichia_phage(41.38%)	39	1840716:1840730	1872496:1872510
AVZ51641.1|1839890_1841123_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1840716:1840730	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
AVZ48939.1|1841377_1842361_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVZ48940.1|1842635_1842809_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48941.1|1842838_1844212_+	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVZ48942.1|1844340_1845276_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AVZ48943.1|1845327_1846563_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AVZ48944.1|1846564_1846780_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVZ51643.1|1846858_1847068_-	double-strand break reduction protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AVZ51642.1|1847060_1847255_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AVZ48945.1|1847311_1848121_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AVZ48946.1|1848113_1850714_-	exodeoxyribonuclease 8	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
AVZ48947.1|1850815_1851091_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVZ51644.1|1851165_1851336_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVZ48948.1|1851335_1851557_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AVZ48949.1|1851685_1851964_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48950.1|1851998_1852487_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVZ48951.1|1852483_1852639_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AVZ48952.1|1852649_1852829_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ48953.1|1853092_1853569_-	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AVZ48954.1|1853692_1853989_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AVZ48955.1|1854011_1854434_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
AVZ48956.1|1854446_1855304_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
AVZ48957.1|1855310_1856057_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
AVZ48958.1|1856727_1856913_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AVZ48959.1|1857109_1858567_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AVZ48960.1|1858505_1858787_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48961.1|1858704_1858968_+	hypothetical protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
AVZ48962.1|1858948_1859308_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48963.1|1859415_1859616_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ48964.1|1860686_1860941_+	hypothetical protein	NA	A5LH44	Enterobacteria_phage	95.8	7.4e-35
AVZ51646.1|1860915_1861035_+	ABC transporter	NA	NA	NA	NA	NA
AVZ48965.1|1861073_1862054_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AVZ51645.1|1862096_1862312_+	hypothetical protein	NA	Q687E7	Enterobacteria_phage	98.4	1.4e-29
AVZ51647.1|1862376_1865739_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
AVZ48966.1|1865738_1866314_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AVZ48967.1|1866411_1867002_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVZ48968.1|1867318_1867552_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVZ48969.1|1868512_1868947_-	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
AVZ48970.1|1869087_1870221_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
1872496:1872510	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 5
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2062780	2081991	4682574	tail,lysis	Enterobacteria_phage(42.86%)	33	NA	NA
AVZ49133.1|2062780_2064241_-	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
AVZ49134.1|2064329_2065613_-	MFS transporter	NA	NA	NA	NA	NA
AVZ49135.1|2066399_2066633_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVZ49136.1|2066949_2067540_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVZ49137.1|2067637_2068213_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AVZ49138.1|2068212_2069175_-|tail	side tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
AVZ49139.1|2069125_2069695_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
AVZ49140.1|2069834_2069936_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ49141.1|2070083_2070317_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVZ49142.1|2070374_2070785_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVZ49143.1|2070936_2071110_-	protein GnsB	NA	NA	NA	NA	NA
AVZ49144.1|2071281_2071437_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ49145.1|2071583_2071772_-	cold-shock protein	NA	NA	NA	NA	NA
AVZ49146.1|2071782_2071995_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVZ49147.1|2072357_2072855_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AVZ49148.1|2072851_2073385_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVZ49149.1|2073381_2073693_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVZ49150.1|2073697_2073913_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVZ49151.1|2074666_2074882_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVZ49152.1|2075182_2075395_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AVZ49153.1|2075816_2076569_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVZ49154.1|2076582_2077632_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AVZ49155.1|2077633_2077912_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ49156.1|2077978_2078230_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ49157.1|2078446_2078602_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVZ49158.1|2078673_2078961_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVZ49159.1|2078960_2079200_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVZ49160.1|2079224_2079530_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ49161.1|2079732_2080065_+	protein FlxA	NA	NA	NA	NA	NA
AVZ49162.1|2080334_2080457_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AVZ49163.1|2080947_2081178_-	division inhibition gene dicB repressor	NA	NA	NA	NA	NA
AVZ49164.1|2081261_2081669_+	transcriptional regulator	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
AVZ49165.1|2081835_2081991_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2539777	2548448	4682574		Escherichia_phage(28.57%)	8	NA	NA
AVZ49618.1|2539777_2540881_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
AVZ49619.1|2540888_2542136_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
AVZ49620.1|2542132_2542690_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
AVZ49621.1|2542689_2543571_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
AVZ49622.1|2543628_2544528_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
AVZ49623.1|2544527_2545613_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
AVZ49624.1|2545985_2546879_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVZ49625.1|2547053_2548448_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2641854	2651295	4682574		Enterobacteria_phage(85.71%)	10	NA	NA
AVZ49700.1|2641854_2642991_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
AVZ49701.1|2642987_2644832_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.9	0.0e+00
AVZ49702.1|2645112_2645574_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVZ49703.1|2645613_2646084_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AVZ49704.1|2646130_2646850_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ49705.1|2646846_2648532_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVZ49706.1|2648753_2649485_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AVZ49707.1|2649544_2649652_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ49708.1|2649632_2650364_-	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVZ49709.1|2650368_2651295_-	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2899188	2910398	4682574	integrase,tail	Enterobacteria_phage(56.25%)	16	2897163:2897179	2914073:2914089
2897163:2897179	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
AVZ49934.1|2899188_2900121_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
AVZ49935.1|2900432_2901590_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
AVZ49936.1|2901742_2902105_+	glucose translocase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
AVZ49937.1|2902101_2903022_+	bactoprenol glucosyl transferase	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
AVZ49938.1|2903018_2904350_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
AVZ49939.1|2904648_2904993_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	86.2	3.1e-44
AVZ49940.1|2904964_2905405_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
AVZ51686.1|2905431_2905950_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
AVZ49941.1|2905999_2906275_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
AVZ49942.1|2906274_2906769_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
AVZ49943.1|2907491_2907854_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
AVZ49944.1|2907919_2908744_+	DUF2303 domain-containing protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
AVZ49945.1|2908871_2909408_+	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
AVZ49946.1|2909398_2909761_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
AVZ49947.1|2909760_2910066_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
AVZ49948.1|2910197_2910398_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2914073:2914089	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 9
CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	3292198	3299337	4682574		Escherichia_phage(83.33%)	6	NA	NA
AVZ50296.1|3292198_3294760_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
AVZ50297.1|3294865_3295522_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
AVZ50298.1|3295572_3296340_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVZ50299.1|3296535_3297444_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
AVZ50300.1|3297440_3298607_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
AVZ50301.1|3298698_3299337_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
