The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	620196	630090	4825089	transposase,integrase	Enterobacteria_phage(80.0%)	12	610685:610700	636380:636395
610685:610700	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
AVV73873.1|620196_620769_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	94.6	7.9e-93
AVV73874.1|620842_621343_-	transactivation protein	NA	NA	NA	NA	NA
AVV73875.1|621339_622074_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.1	1.1e-128
AVV73876.1|622625_622892_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AVV73877.1|622888_623479_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
AVV73878.1|623471_623759_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AVV73879.1|623751_624207_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AVV73880.1|624342_624663_+	hypothetical protein	NA	NA	NA	NA	NA
AVV73881.1|624677_627011_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
AVV73882.1|627216_627552_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	3.9e-23
AVV73883.1|627767_628907_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-74
AVV73884.1|628876_630090_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	6.8e-102
636380:636395	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 2
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	1032227	1102278	4825089	tail,head,plate,protease,capsid,holin,terminase,integrase,transposase,portal	Enterobacteria_phage(34.67%)	99	1051747:1051805	1092882:1092940
AVV74228.1|1032227_1033575_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
AVV74229.1|1034189_1035506_+	flagellar hook protein	NA	NA	NA	NA	NA
AVV74230.1|1035528_1035921_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
AVV74231.1|1035925_1036237_+	flagellar protein FliT	NA	NA	NA	NA	NA
AVV74232.1|1036233_1037295_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
AVV74233.1|1037302_1037770_+	flagellar basal body protein FliL	NA	NA	NA	NA	NA
AVV74234.1|1037789_1038506_+	FliA/WhiG family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AVV74235.1|1038518_1039382_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AVV74236.1|1039384_1040308_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AVV74237.1|1040378_1041434_+	DNA polymerase IV	NA	NA	NA	NA	NA
AVV74238.1|1041430_1041883_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVV74239.1|1042061_1043213_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
AVV74240.1|1043209_1043824_+	peptide chain release factor H	NA	NA	NA	NA	NA
AVV74241.1|1043880_1045338_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AVV74242.1|1045598_1046057_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVV74243.1|1047449_1047851_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AVV74244.1|1047889_1048945_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	3.5e-118
AVV74245.1|1049233_1050337_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVV74246.1|1050348_1051602_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
1051747:1051805	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
AVV77663.1|1051806_1052745_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AVV74247.1|1052846_1053227_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	96.6	2.5e-58
AVV74248.1|1053168_1053447_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AVV74249.1|1053494_1053713_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	94.4	4.1e-34
AVV74250.1|1053811_1054093_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AVV74251.1|1054103_1054661_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AVV74252.1|1054653_1054815_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
AVV74253.1|1054811_1055492_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
AVV74254.1|1055488_1056274_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVV74255.1|1056279_1056576_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.4e-48
AVV74256.1|1056651_1056858_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVV74257.1|1057025_1057307_-	hypothetical protein	NA	NA	NA	NA	NA
AVV74258.1|1057332_1057716_-	hypothetical protein	NA	NA	NA	NA	NA
AVV74259.1|1057715_1058186_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	40.1	5.6e-20
AVV77664.1|1058474_1059167_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
AVV74260.1|1059277_1059505_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AVV74261.1|1059535_1060075_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
AVV74262.1|1060071_1061091_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.0e-110
AVV74263.1|1061087_1061789_+	Replication protein P	NA	Q9EYB6	Enterobacteria_phage	98.7	1.9e-128
AVV74264.1|1061785_1062079_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	2.9e-43
AVV74265.1|1062075_1062276_+	hypothetical protein	NA	NA	NA	NA	NA
AVV74266.1|1062272_1062503_+	hypothetical protein	NA	Q286X0	Escherichia_phage	78.9	2.3e-27
AVV74267.1|1062909_1063296_+	hypothetical protein	NA	K7P7J4	Enterobacteria_phage	72.3	1.5e-10
AVV74268.1|1063347_1063716_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	32.5	6.2e-06
AVV74269.1|1064011_1064521_+	hypothetical protein	NA	NA	NA	NA	NA
AVV74270.1|1064610_1064712_+	hypothetical protein	NA	NA	NA	NA	NA
AVV74271.1|1064708_1065164_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	5.4e-60
AVV74272.1|1065163_1065334_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AVV74273.1|1065326_1065617_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	3.3e-47
AVV74274.1|1065613_1065976_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	3.3e-60
AVV74275.1|1065972_1066113_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	5.0e-09
AVV74276.1|1066109_1066799_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
AVV74277.1|1067108_1067426_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AVV74278.1|1067412_1067889_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
AVV74279.1|1068377_1068671_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AVV74280.1|1068763_1068904_+	Rz1 lytic protein	NA	U5P461	Shigella_phage	78.6	2.2e-09
AVV74281.1|1069196_1069547_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
AVV74282.1|1069663_1070167_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	2.3e-88
AVV74283.1|1070163_1071897_+|terminase	terminase	terminase	U5P0Q5	Shigella_phage	98.6	0.0e+00
AVV74284.1|1071908_1072091_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
AVV74285.1|1072090_1073332_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
AVV74286.1|1073273_1073960_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AVV74287.1|1073974_1075180_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	1.6e-223
AVV74288.1|1075229_1075430_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
AVV74289.1|1075432_1075756_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
AVV74290.1|1075752_1076163_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
AVV74291.1|1076137_1076644_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	2.9e-83
AVV74292.1|1076640_1077201_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	5.2e-105
AVV74293.1|1077209_1077380_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
AVV74294.1|1077363_1078860_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.4	4.2e-271
AVV74295.1|1078859_1079216_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
AVV74296.1|1079215_1079485_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AVV74297.1|1079451_1079634_+	hypothetical protein	NA	NA	NA	NA	NA
AVV74298.1|1079626_1081459_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.2	1.6e-299
AVV74299.1|1081550_1082081_+	hypothetical protein	NA	NA	NA	NA	NA
AVV74300.1|1082142_1083471_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	97.5	1.1e-243
AVV74301.1|1083467_1084547_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	7.7e-206
AVV74302.1|1084546_1085095_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	96.2	5.2e-94
AVV74303.1|1085091_1085520_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	4.0e-81
AVV74304.1|1085506_1086565_+|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
AVV74305.1|1086638_1087139_+	hypothetical protein	NA	O22003	Shigella_phage	98.2	4.3e-95
AVV77665.1|1087902_1088505_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	1.9e-97
AVV74306.1|1088476_1088698_-|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	76.8	2.7e-25
AVV77666.1|1088921_1089317_-	hypothetical protein	NA	NA	NA	NA	NA
AVV74307.1|1089440_1089995_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	88.9	2.2e-87
AVV74308.1|1090052_1090826_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
AVV74309.1|1094348_1095516_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
1092882:1092940	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
AVV74310.1|1095647_1096106_-	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AVV74311.1|1096209_1097094_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVV74312.1|1097295_1098078_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	44.5	3.3e-49
AVV77667.1|1098074_1098314_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	85.1	3.8e-33
AVV74313.1|1098285_1098834_-	hypothetical protein	NA	E7C9P4	Salmonella_phage	98.6	8.0e-34
AVV74314.1|1098830_1099052_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
AVV74315.1|1099150_1099432_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	1.8e-45
AVV74316.1|1099442_1099634_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AVV74317.1|1099606_1099789_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
AVV74318.1|1099785_1100466_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AVV74319.1|1100462_1101248_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVV74320.1|1101253_1101550_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AVV74321.1|1101714_1102278_+	replication protein P	NA	C1JJ54	Enterobacteria_phage	95.1	4.7e-98
>prophage 3
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	1818714	1873334	4825089	tail,head,protease,capsid,holin,terminase,transposase,integrase,lysis,portal	Enterobacteria_phage(49.23%)	73	1851737:1851754	1873577:1873594
AVV74939.1|1818714_1819788_-|integrase	integrase	integrase	Q9G075	Enterobacteria_phage	99.4	1.1e-199
AVV74940.1|1819765_1819969_-	excisionase	NA	Q77WA4	Escherichia_phage	75.4	1.2e-19
AVV74941.1|1819913_1821082_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
AVV74942.1|1821275_1821443_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AVV74943.1|1821531_1821813_-	hypothetical protein	NA	NA	NA	NA	NA
AVV74944.1|1821927_1822725_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
AVV74945.1|1822721_1822931_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
AVV74946.1|1822932_1823121_-	hypothetical protein	NA	Q286W7	Escherichia_phage	92.6	6.3e-23
AVV74947.1|1823293_1823983_-	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	56.2	1.8e-54
AVV74948.1|1823979_1824201_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
AVV74949.1|1824299_1824581_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	96.8	6.1e-46
AVV74950.1|1824591_1824783_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
AVV74951.1|1824755_1824938_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	4.8e-28
AVV74952.1|1824934_1825615_-	exonuclease	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
AVV74953.1|1825611_1826397_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
AVV74954.1|1826402_1826699_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.1e-48
AVV74955.1|1826667_1826916_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.0	2.5e-19
AVV74956.1|1826884_1827049_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
AVV74957.1|1827121_1827490_-	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
AVV74958.1|1827672_1827873_-	restriction endonuclease	NA	A5VWA0	Enterobacteria_phage	93.9	6.7e-31
AVV74959.1|1828086_1828668_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
AVV74960.1|1828684_1828957_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	95.6	3.3e-25
AVV74961.1|1829269_1829920_-	LexA family transcriptional repressor	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
AVV74962.1|1830000_1830186_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
AVV74963.1|1830294_1830573_+	hypothetical protein	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
AVV74964.1|1830607_1831507_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	3.2e-173
AVV74965.1|1831503_1832205_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
AVV74966.1|1832201_1832492_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AVV74967.1|1832562_1832835_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	84.3	3.8e-37
AVV74968.1|1832837_1833248_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.1	2.6e-69
AVV74969.1|1833244_1833427_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
AVV74970.1|1833423_1833594_+	protein ninF	NA	M1FPE8	Enterobacteria_phage	100.0	1.4e-26
AVV74971.1|1833586_1834198_+	protein NinG	NA	Q716C3	Shigella_phage	98.0	3.3e-97
AVV74972.1|1834194_1834860_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	97.3	1.4e-128
AVV74973.1|1834856_1835480_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	98.1	4.4e-113
AVV74974.1|1835758_1836475_+	hypothetical protein	NA	NA	NA	NA	NA
AVV77692.1|1837340_1837556_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AVV74975.1|1837555_1838053_+	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
AVV74976.1|1838049_1838487_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	2.9e-71
AVV74977.1|1838636_1839254_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AVV74978.1|1839743_1840289_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AVV74979.1|1840263_1842189_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AVV74980.1|1842185_1842392_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVV74981.1|1842388_1843990_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AVV74982.1|1843970_1845290_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	2.8e-234
AVV74983.1|1845299_1845632_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	7.1e-54
AVV74984.1|1845687_1846713_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.5e-190
AVV74985.1|1846754_1847153_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.0e-59
AVV74986.1|1847164_1847518_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.0e-62
AVV74987.1|1847529_1848063_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	73.4	3.6e-63
AVV74988.1|1848059_1848455_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
AVV77693.1|1848462_1849203_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	95.5	2.9e-127
AVV74989.1|1849218_1849641_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	83.6	1.1e-59
AVV74990.1|1849622_1850057_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
AVV74991.1|1850049_1852629_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.6	0.0e+00
1851737:1851754	attL	CGCTGGCGCAGCAGGCGG	NA	NA	NA	NA
AVV74992.1|1852625_1852955_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
AVV74993.1|1852954_1853653_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	1.5e-130
AVV74994.1|1853657_1854401_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	2.6e-144
AVV74995.1|1854298_1854940_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	1.2e-94
AVV74996.1|1855000_1858498_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
AVV74997.1|1858567_1859167_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	7.0e-108
AVV74998.1|1860545_1860815_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
AVV74999.1|1862206_1862578_-|integrase	integrase	integrase	K7PH54	Enterobacteria_phage	94.3	2.4e-58
AVV75000.1|1863021_1863582_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	64.4	6.4e-63
AVV77694.1|1863791_1864172_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75001.1|1864255_1864477_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75002.1|1864489_1865143_-	secretion protein EspJ	NA	NA	NA	NA	NA
AVV75003.1|1865619_1866648_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVV75004.1|1866620_1867313_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVV75005.1|1867442_1868615_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVV75006.1|1868614_1871161_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.0e-70
AVV75007.1|1871157_1871757_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVV75008.1|1871986_1873334_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
1873577:1873594	attR	CGCTGGCGCAGCAGGCGG	NA	NA	NA	NA
>prophage 4
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	1983572	2037406	4825089	integrase,holin,lysis,tRNA,tail,portal	Enterobacteria_phage(47.73%)	64	1971327:1971342	1987340:1987355
1971327:1971342	attL	CCGCGCAAAATTTCAC	NA	NA	NA	NA
AVV75112.1|1983572_1984691_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AVV75113.1|1984659_1984929_-	excisionase	NA	NA	NA	NA	NA
AVV75114.1|1984990_1987462_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1987340:1987355	attR	GTGAAATTTTGCGCGG	NA	NA	NA	NA
AVV75115.1|1987554_1987746_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVV75116.1|1987742_1987931_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVV75117.1|1988498_1988717_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75118.1|1988746_1988917_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75119.1|1988876_1989032_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVV75120.1|1989237_1989645_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AVV75121.1|1989721_1989949_+	transcriptional regulator	NA	NA	NA	NA	NA
AVV75122.1|1989932_1990484_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75123.1|1991283_1991949_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	3.2e-85
AVV75124.1|1991917_1992730_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	3.3e-108
AVV75125.1|1993589_1994348_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AVV75126.1|1994629_1994842_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AVV75127.1|1995062_1995323_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75128.1|1995389_1995668_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
AVV75129.1|1995669_1996728_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	9.8e-89
AVV75130.1|1996728_1997109_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	4.1e-37
AVV75131.1|1997105_1997927_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	1.1e-79
AVV75132.1|1998566_1998998_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AVV75133.1|1998888_1999155_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75134.1|1999312_1999441_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75135.1|1999489_1999660_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.4	9.7e-23
AVV77699.1|1999683_1999836_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	90.0	1.7e-15
AVV75136.1|1999975_2000119_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75137.1|2000117_2000333_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AVV75138.1|2000332_2000830_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AVV75139.1|2000826_2001294_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	99.4	4.6e-75
AVV75140.1|2001315_2001678_+	DNA-binding protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
AVV75141.1|2002129_2002669_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
AVV75142.1|2002769_2004776_+	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	99.4	0.0e+00
AVV75143.1|2004772_2004985_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVV75144.1|2004984_2006493_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.5e-287
AVV75145.1|2008504_2008873_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AVV75146.1|2008865_2009141_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVV75147.1|2009152_2009731_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
AVV75148.1|2009727_2010129_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AVV75149.1|2010139_2010883_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
AVV77700.1|2010943_2011330_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AVV75150.1|2011338_2011668_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AVV75151.1|2011639_2014705_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
AVV75152.1|2014704_2015034_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVV75153.1|2015043_2015742_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
AVV75154.1|2015746_2016490_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
AVV75155.1|2016387_2017035_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	5.0e-112
AVV75156.1|2017095_2020491_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
AVV75157.1|2020558_2021158_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
AVV75158.1|2021222_2022536_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
AVV75159.1|2022537_2022807_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
AVV77701.1|2023283_2023706_+	hypothetical protein	NA	B6DZB9	Enterobacteria_phage	77.0	3.0e-57
AVV75160.1|2024986_2025613_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.8	5.9e-25
AVV75161.1|2025796_2026387_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AVV75162.1|2026846_2027011_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	87.2	8.5e-16
AVV75163.1|2027243_2028107_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVV75164.1|2028090_2029227_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVV77702.1|2029205_2029421_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75165.1|2029476_2030703_+	peptidase T	NA	NA	NA	NA	NA
AVV75166.1|2030751_2031873_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVV75167.1|2031948_2033409_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AVV75168.1|2033408_2034080_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVV75169.1|2034248_2035619_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
AVV77703.1|2035622_2036264_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVV75170.1|2036299_2037406_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	2405358	2445102	4825089	head,capsid,terminase,transposase,lysis,tail,portal	Enterobacteria_phage(37.84%)	48	NA	NA
AVV75488.1|2405358_2405934_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AVV75489.1|2405933_2408894_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	2.4e-55
AVV75490.1|2408958_2409558_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
AVV75491.1|2413668_2414412_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
AVV75492.1|2414417_2415116_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	3.1e-131
AVV75493.1|2415440_2418002_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
AVV75494.1|2417994_2418429_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVV75495.1|2418410_2418833_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.2e-71
AVV77723.1|2418848_2419589_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	95.9	2.2e-127
AVV75496.1|2419596_2419992_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AVV75497.1|2419988_2420567_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
AVV75498.1|2420578_2420932_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
AVV75499.1|2420943_2421339_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.2e-55
AVV75500.1|2421380_2422406_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.9	5.6e-190
AVV75501.1|2422461_2422794_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	3.2e-54
AVV75502.1|2424102_2425704_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
AVV75503.1|2425700_2425907_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVV75504.1|2425903_2427829_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AVV75505.1|2427803_2428349_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
AVV75506.1|2428488_2428632_-	DNA-packaging protein	NA	NA	NA	NA	NA
AVV75507.1|2428737_2428971_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AVV75508.1|2429028_2429439_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AVV75509.1|2429590_2429764_-	protein GnsB	NA	NA	NA	NA	NA
AVV75510.1|2429935_2430208_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75511.1|2430238_2430427_-	cold-shock protein	NA	NA	NA	NA	NA
AVV75512.1|2430437_2430650_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVV75513.1|2431013_2431511_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AVV75514.1|2431507_2432041_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AVV75515.1|2432037_2432349_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AVV75516.1|2432353_2432569_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AVV75517.1|2433322_2433538_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AVV75518.1|2433838_2434051_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AVV75519.1|2434472_2435225_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AVV75520.1|2435238_2436288_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
AVV75521.1|2436289_2436568_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75522.1|2436634_2436886_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75523.1|2437102_2437258_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVV75524.1|2437329_2437617_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AVV75525.1|2437616_2437856_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AVV75526.1|2437880_2438186_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75527.1|2438388_2438721_+	protein flxA	NA	NA	NA	NA	NA
AVV75528.1|2438990_2439113_-	plasmid mobilization protein	NA	NA	NA	NA	NA
AVV75529.1|2440646_2441735_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AVV75530.1|2441777_2441960_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	1.7e-12
AVV75531.1|2441934_2442114_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75532.1|2443266_2443623_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	4.8e-40
AVV75533.1|2443619_2444042_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AVV75534.1|2444082_2445102_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.4e-55
>prophage 6
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	2448126	2458240	4825089		Shigella_phage(14.29%)	13	NA	NA
AVV75541.1|2448126_2450568_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.1	3.3e-111
AVV75542.1|2450640_2450892_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVV75543.1|2450911_2452207_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	2.2e-154
AVV75544.1|2452226_2452337_-	transporter	NA	NA	NA	NA	NA
AVV75545.1|2452394_2453414_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
AVV75546.1|2453425_2454640_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
AVV75547.1|2454620_2454809_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75548.1|2454845_2455172_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AVV75549.1|2455306_2455648_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75550.1|2455682_2456243_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVV75551.1|2456245_2456956_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVV75552.1|2457063_2457369_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVV75553.1|2457625_2458240_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
>prophage 7
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	2733153	2817151	4825089	head,plate,capsid,holin,terminase,integrase,tRNA,tail,portal	Escherichia_phage(22.22%)	91	2773271:2773330	2817213:2817337
AVV75809.1|2733153_2734926_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AVV75810.1|2735235_2735802_+	hydrolase	NA	NA	NA	NA	NA
AVV75811.1|2735798_2736617_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AVV75812.1|2736669_2737065_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75813.1|2737105_2737849_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AVV75814.1|2737845_2738817_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVV75815.1|2738981_2741411_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AVV75816.1|2741435_2742533_-	cytochrome C	NA	NA	NA	NA	NA
AVV75817.1|2742920_2743667_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVV75818.1|2743680_2744247_-	VOC family protein	NA	NA	NA	NA	NA
AVV75819.1|2744462_2746196_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
AVV75820.1|2746248_2746641_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AVV75821.1|2746640_2748719_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AVV75822.1|2750067_2750712_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AVV75823.1|2750722_2751112_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
AVV75824.1|2751126_2752176_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVV75825.1|2752178_2753039_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVV75826.1|2753329_2754991_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AVV75827.1|2755135_2755639_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AVV75828.1|2755659_2757624_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AVV75829.1|2757628_2758555_-	motility protein MotB	NA	NA	NA	NA	NA
AVV75830.1|2758551_2759439_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AVV75831.1|2759567_2760146_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AVV75832.1|2760148_2760499_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AVV75833.1|2761278_2761707_+	universal stress protein UspC	NA	NA	NA	NA	NA
AVV75834.1|2761713_2763138_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
AVV75835.1|2763112_2763913_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AVV75836.1|2764079_2765066_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AVV75837.1|2765080_2766595_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.7e-13
AVV75838.1|2767737_2767977_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75839.1|2768448_2768952_+	non-heme ferritin	NA	NA	NA	NA	NA
AVV75840.1|2769029_2769281_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AVV75841.1|2769395_2769482_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75842.1|2769575_2769788_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75843.1|2769745_2770069_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75844.1|2770240_2770738_+	non-heme ferritin	NA	NA	NA	NA	NA
AVV75845.1|2770775_2771015_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AVV75846.1|2771205_2772417_+	tyrosine transporter	NA	NA	NA	NA	NA
AVV75847.1|2772478_2773144_-	YecA family protein	NA	NA	NA	NA	NA
2773271:2773330	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AVV75848.1|2773615_2774035_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AVV75849.1|2774201_2775245_-	late control protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
AVV75850.1|2775248_2775473_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVV77741.1|2775633_2776023_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AVV75851.1|2777805_2778087_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVV75852.1|2778099_2778612_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVV75853.1|2780127_2780517_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AVV75854.1|2780516_2781701_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	1.9e-16
AVV75855.1|2781693_2782320_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.0	3.5e-25
AVV75856.1|2782322_2783243_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	48.1	4.9e-68
AVV75857.1|2783239_2783581_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	50.5	1.2e-19
AVV75858.1|2784465_2785002_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75859.1|2785709_2786090_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75860.1|2786086_2786506_-	DNA-packaging protein	NA	NA	NA	NA	NA
AVV75861.1|2786540_2787575_-|capsid	major capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	4.3e-105
AVV75862.1|2787633_2787963_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AVV75863.1|2787962_2789270_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	1.4e-105
AVV75864.1|2789269_2790844_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AVV75865.1|2790840_2791074_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75866.1|2791073_2792936_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.4	3.7e-192
AVV75867.1|2792922_2793489_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	44.0	3.5e-32
AVV77742.1|2793859_2794105_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75868.1|2794164_2794359_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75869.1|2794366_2794846_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
AVV75870.1|2794842_2795118_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.9e-09
AVV75871.1|2796281_2796575_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
AVV75872.1|2796571_2797168_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.6	3.0e-71
AVV75873.1|2797245_2797425_-	hypothetical protein	NA	NA	NA	NA	NA
AVV77743.1|2797576_2798218_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75874.1|2798336_2798615_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75875.1|2799182_2799671_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AVV75876.1|2799680_2800286_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75877.1|2800710_2801586_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75878.1|2801650_2801866_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75879.1|2802063_2803143_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AVV75880.1|2803715_2804639_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AVV77744.1|2804813_2805602_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.0	1.4e-39
AVV75881.1|2805874_2806096_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75882.1|2806283_2806508_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75883.1|2806811_2807048_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75884.1|2807049_2807460_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75885.1|2807498_2808890_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	45.6	1.6e-102
AVV75886.1|2808886_2809951_-	replication protein RepO	NA	C8CGZ1	Staphylococcus_phage	54.7	5.9e-33
AVV75887.1|2809953_2810178_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
AVV75888.1|2810217_2810694_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	3.2e-23
AVV75889.1|2810753_2810951_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75890.1|2811037_2811433_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	69.2	1.5e-42
AVV75891.1|2812379_2812700_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75892.1|2814942_2815512_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	50.3	3.6e-37
AVV75893.1|2815742_2815967_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	54.9	2.1e-09
AVV75894.1|2815902_2816166_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AVV75895.1|2816134_2817151_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	6.7e-127
2817213:2817337	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 8
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	2873205	2918523	4825089	head,integrase,capsid,holin,terminase,transposase,lysis,tail,portal	Enterobacteria_phage(38.64%)	61	2870002:2870016	2924574:2924588
2870002:2870016	attL	CAGTTCCCGCCAGCA	NA	NA	NA	NA
AVV75959.1|2873205_2874186_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
AVV75960.1|2874362_2874632_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
AVV77747.1|2876007_2876631_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	3.9e-69
AVV75961.1|2876699_2880176_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.6	0.0e+00
AVV75962.1|2880309_2880837_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
AVV75963.1|2880867_2881074_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75964.1|2881604_2882348_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.6e-147
AVV75965.1|2882353_2883052_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AVV75966.1|2883051_2883381_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AVV75967.1|2883377_2885957_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
AVV75968.1|2885937_2886351_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AVV75969.1|2886377_2886809_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AVV75970.1|2886822_2887575_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
AVV75971.1|2887582_2887978_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
AVV75972.1|2887974_2888508_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AVV75973.1|2888523_2888877_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AVV75974.1|2888869_2889292_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75975.1|2889295_2890324_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AVV75976.1|2890381_2890729_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AVV75977.1|2890765_2891992_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	2.5e-75
AVV75978.1|2891970_2892270_-|tail	phage tail protein	tail	E4WL22	Enterobacteria_phage	54.3	2.4e-16
AVV75979.1|2892259_2893852_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
AVV75980.1|2893848_2894055_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVV75981.1|2894038_2895967_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
AVV75982.1|2895938_2896448_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AVV75983.1|2896850_2897075_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AVV75984.1|2897156_2897471_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVV75985.1|2897713_2897854_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75986.1|2897936_2898404_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AVV75987.1|2898405_2898519_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AVV75988.1|2898739_2899273_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AVV75989.1|2899305_2899500_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75990.1|2899468_2899705_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75991.1|2899653_2899998_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75992.1|2899960_2900176_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AVV75993.1|2900174_2900336_+	hypothetical protein	NA	NA	NA	NA	NA
AVV75994.1|2902876_2903143_-	hypothetical protein	NA	NA	NA	NA	NA
AVV75995.1|2903633_2904455_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AVV75996.1|2904451_2904826_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
AVV75997.1|2904838_2905888_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	7.9e-107
AVV75998.1|2905889_2906168_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AVV75999.1|2906334_2906490_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVV76000.1|2906561_2907650_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AVV76001.1|2907836_2907941_-	hypothetical protein	NA	NA	NA	NA	NA
AVV76002.1|2908056_2908926_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
AVV76003.1|2908936_2909200_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AVV76004.1|2909201_2909420_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
AVV76005.1|2909452_2909665_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AVV76006.1|2910091_2910517_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	2.4e-62
AVV76007.1|2910557_2911520_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AVV76008.1|2911542_2911968_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVV76009.1|2911951_2912275_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AVV76010.1|2912399_2912876_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AVV77748.1|2913194_2913350_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AVV76011.1|2913351_2913480_+	hypothetical protein	NA	NA	NA	NA	NA
AVV76012.1|2913509_2913728_+	hypothetical protein	NA	NA	NA	NA	NA
AVV76013.1|2913731_2913947_-	hypothetical protein	NA	NA	NA	NA	NA
AVV76014.1|2914296_2914485_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVV76015.1|2914481_2914673_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVV76016.1|2917294_2917498_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVV76017.1|2917497_2918523_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
2924574:2924588	attR	TGCTGGCGGGAACTG	NA	NA	NA	NA
>prophage 9
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	3107876	3117317	4825089		Enterobacteria_phage(85.71%)	10	NA	NA
AVV76162.1|3107876_3109013_+	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
AVV76163.1|3109009_3111010_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AVV76164.1|3111133_3111595_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVV76165.1|3111635_3112106_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVV76166.1|3112152_3112872_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVV76167.1|3112868_3114554_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVV76168.1|3114775_3115507_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
AVV76169.1|3115566_3115674_+	hypothetical protein	NA	NA	NA	NA	NA
AVV76170.1|3115654_3116386_-	ABC transporter permease	NA	NA	NA	NA	NA
AVV76171.1|3116390_3117317_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.8e-22
>prophage 10
CP027104	Escherichia coli strain RM14715 chromosome, complete genome	4825089	3705155	3712295	4825089		Escherichia_phage(83.33%)	6	NA	NA
AVV76650.1|3705155_3707717_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AVV76651.1|3707822_3708479_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
AVV76652.1|3708529_3709297_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
AVV76653.1|3709492_3710401_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AVV76654.1|3710397_3711660_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AVV76655.1|3711656_3712295_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
