The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	165241	263900	4754025	integrase,terminase,head,tail,transposase,plate,lysis,tRNA,capsid,holin,portal	Escherichia_phage(34.78%)	104	180120:180139	274613:274632
AVV68970.1|165241_165679_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AVV68971.1|165675_166665_+	acetyltransferase	NA	NA	NA	NA	NA
AVV68972.1|166728_167637_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVV68973.1|167865_168177_+	toxin HigB-2	NA	NA	NA	NA	NA
AVV68974.1|168177_168468_+	transcriptional regulator	NA	NA	NA	NA	NA
AVV68975.1|168552_168765_+	hypothetical protein	NA	NA	NA	NA	NA
AVV68976.1|168826_169105_+	hypothetical protein	NA	NA	NA	NA	NA
AVV68977.1|169143_169326_+	hypothetical protein	NA	NA	NA	NA	NA
AVV73180.1|169506_169719_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AVV68978.1|169942_170872_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
AVV68979.1|170868_171504_-	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
AVV68980.1|171500_172403_-	formate dehydrogenase-O iron-sulfur subunit	NA	NA	NA	NA	NA
AVV68981.1|172415_175466_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
AVV68982.1|175469_175724_+	hypothetical protein	NA	NA	NA	NA	NA
AVV68983.1|175659_176493_+	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AVV68984.1|177488_178883_+	porin	NA	NA	NA	NA	NA
AVV68985.1|178923_179238_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
AVV68986.1|179247_180072_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
180120:180139	attL	CGATCTGTAGGCCGGATAAG	NA	NA	NA	NA
AVV68987.1|180164_181424_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
AVV68988.1|181420_182890_-	rhamnulokinase	NA	NA	NA	NA	NA
AVV68989.1|183177_184014_+	transcriptional activator RhaS	NA	NA	NA	NA	NA
AVV68990.1|183997_184936_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
AVV68991.1|184932_185967_-	rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
AVV68992.1|186252_186873_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
AVV68993.1|187047_187155_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVV68994.1|187151_188117_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AVV68995.1|188265_188940_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVV68996.1|189044_190418_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AVV68997.1|190414_191113_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVV73181.1|191262_191763_+	stress adaptor protein CpxP	NA	NA	NA	NA	NA
AVV68998.1|191949_192930_-|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
AVV68999.1|192999_193293_-	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
AVV69000.1|193429_193702_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
AVV73182.1|193871_194372_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AVV69001.1|194435_194660_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
AVV69002.1|194659_194962_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	5.0e-46
AVV69003.1|194961_195186_+	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AVV69004.1|195182_195458_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AVV69005.1|195447_197763_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.2	0.0e+00
AVV69006.1|197777_198824_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
AVV69007.1|201706_202741_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
AVV69008.1|202740_204513_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
AVV69009.1|204686_205541_+|capsid	capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.6	6.2e-134
AVV69010.1|205599_206673_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.2	3.3e-201
AVV69011.1|206676_207420_+|terminase	terminase	terminase	Q94MK1	Enterobacteria_phage	98.8	6.2e-122
AVV69012.1|207519_208029_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AVV69013.1|208028_208232_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AVV69014.1|208235_208517_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AVV69015.1|208516_209014_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
AVV69016.1|209028_209454_+	protein lysA	NA	U5N096	Enterobacteria_phage	98.6	2.3e-60
AVV69017.1|209441_209867_+	protein lysB	NA	A0A0F7LDJ6	Escherichia_phage	95.0	6.8e-65
AVV69018.1|209838_210012_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
AVV69019.1|209974_210442_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
AVV69020.1|210434_210887_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
AVV69021.1|211584_211932_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AVV69022.1|211936_212845_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AVV69023.1|212837_213368_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	4.3e-101
AVV69024.1|213378_215307_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	71.3	1.0e-224
AVV69025.1|215310_215838_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.3	4.4e-90
AVV69026.1|216059_216653_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	94.9	9.7e-102
AVV69027.1|216983_218174_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
AVV69028.1|218186_218705_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVV69029.1|218761_219037_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AVV73183.1|219069_219189_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AVV69030.1|219181_221629_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.2	0.0e+00
AVV69031.1|221643_222123_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
AVV69032.1|222122_223286_+	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.5	6.3e-206
AVV69033.1|223331_223586_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AVV69034.1|223821_224724_+	cation-efflux pump FieF	NA	NA	NA	NA	NA
AVV69035.1|224904_225867_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AVV69036.1|226186_227176_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVV69037.1|227282_228038_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AVV69038.1|228092_228860_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AVV69039.1|228967_229567_-	DUF1454 domain-containing protein	NA	NA	NA	NA	NA
AVV69040.1|229667_230108_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AVV69041.1|230319_230619_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVV69042.1|230645_231074_+	universal stress protein UspD	NA	NA	NA	NA	NA
AVV69043.1|231078_231825_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AVV69044.1|231921_232932_-	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
AVV69045.1|233102_234611_-	glycerol kinase	NA	NA	NA	NA	NA
AVV69046.1|234633_235479_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AVV69047.1|235903_236149_+	cell division protein ZapB	NA	NA	NA	NA	NA
AVV69048.1|236233_236719_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVV69049.1|236811_237738_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVV69050.1|237804_239136_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AVV69051.1|239145_239676_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AVV69052.1|239768_240728_-	cell division protein FtsN	NA	NA	NA	NA	NA
AVV69053.1|240819_241845_-	transcriptional regulator	NA	NA	NA	NA	NA
AVV69054.1|242000_244199_-	primosomal protein N'	NA	NA	NA	NA	NA
AVV69055.1|244401_244614_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AVV69056.1|244674_245283_-	hypothetical protein	NA	NA	NA	NA	NA
AVV69057.1|245342_245660_-	met repressor	NA	NA	NA	NA	NA
AVV69058.1|245936_247097_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AVV69059.1|247099_249532_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
AVV69060.1|249749_250610_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVV69061.1|250686_252306_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AVV69062.1|254118_255243_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVV69063.1|255375_256929_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
AVV69064.1|257310_258201_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AVV69065.1|258529_260710_+	catalase-peroxidase	NA	NA	NA	NA	NA
AVV69066.1|260803_261709_+	EamA family transporter	NA	NA	NA	NA	NA
AVV69067.1|261735_262353_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
AVV73184.1|262383_262569_+	hypothetical protein	NA	NA	NA	NA	NA
AVV69068.1|262552_263900_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
274613:274632	attR	CGATCTGTAGGCCGGATAAG	NA	NA	NA	NA
>prophage 2
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	647510	661491	4754025	integrase,transposase	Enterobacteria_phage(66.67%)	16	642544:642559	667782:667797
642544:642559	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
AVV69401.1|647510_648779_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
AVV73196.1|648885_649680_+	ABC transporter	NA	A0A0U2RXY7	Escherichia_phage	28.6	8.3e-08
AVV69402.1|649707_650775_-	protein beta	NA	NA	NA	NA	NA
AVV69403.1|650777_651179_-	protein gop	NA	NA	NA	NA	NA
AVV69404.1|651589_652162_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AVV69405.1|652235_652736_-	transactivation protein	NA	NA	NA	NA	NA
AVV69406.1|652732_653467_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	2.6e-128
AVV69407.1|654018_654285_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AVV69408.1|654281_654872_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
AVV69409.1|654864_655152_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
AVV69410.1|655144_655600_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AVV69411.1|655735_656056_+	hypothetical protein	NA	NA	NA	NA	NA
AVV69412.1|656070_658404_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
AVV69413.1|658617_658953_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	100.0	2.7e-24
AVV69414.1|659168_660308_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-74
AVV69415.1|660277_661491_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	6.8e-102
667782:667797	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 3
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1043578	1055053	4754025		Enterobacteria_phage(88.89%)	12	NA	NA
AVV69746.1|1043578_1044754_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.7	2.5e-141
AVV69747.1|1044754_1046455_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVV69748.1|1046451_1048074_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.4	8.2e-10
AVV73210.1|1048003_1048222_-	hypothetical protein	NA	NA	NA	NA	NA
AVV69749.1|1048274_1048847_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
AVV69750.1|1048920_1049421_-	transactivation protein	NA	NA	NA	NA	NA
AVV69751.1|1049417_1050152_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.8e-129
AVV69752.1|1050704_1050971_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
AVV69753.1|1050967_1051522_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	79.3	1.2e-40
AVV69754.1|1051514_1051802_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	95.8	4.3e-47
AVV69755.1|1051794_1052250_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
AVV69756.1|1052719_1055053_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 4
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1293485	1348339	4754025	integrase,terminase,head,tail,lysis,tRNA,capsid,protease,portal	Enterobacteria_phage(56.36%)	70	1289003:1289018	1317563:1317578
1289003:1289018	attL	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
AVV69978.1|1293485_1294871_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AVV69979.1|1294906_1295428_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVV69980.1|1295535_1295748_-	ribosome-associated protein	NA	NA	NA	NA	NA
AVV69981.1|1295749_1296616_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVV69982.1|1296665_1296854_+	hypothetical protein	NA	NA	NA	NA	NA
AVV69983.1|1296978_1298142_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	2.4e-197
AVV69984.1|1297997_1298369_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AVV69985.1|1298340_1298619_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AVV69986.1|1298666_1298885_-	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AVV69987.1|1298983_1299265_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AVV69988.1|1299275_1299833_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
AVV69989.1|1299825_1299987_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
AVV69990.1|1299983_1300664_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
AVV69991.1|1300660_1301446_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVV69992.1|1301451_1301748_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
AVV69993.1|1301823_1302030_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVV69994.1|1302626_1303382_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVV69995.1|1303420_1303651_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVV69996.1|1303719_1304259_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AVV69997.1|1304255_1305275_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AVV69998.1|1305271_1305973_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
AVV69999.1|1305969_1306272_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AVV70000.1|1306339_1306672_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AVV70001.1|1306926_1308453_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	28.0	7.9e-31
AVV70002.1|1308917_1309469_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVV70003.1|1309478_1310276_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVV70004.1|1310392_1310494_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70005.1|1310490_1310946_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
AVV70006.1|1310945_1311116_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVV70007.1|1311108_1311399_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
AVV70008.1|1311395_1311758_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
AVV70009.1|1311754_1311895_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
AVV70010.1|1311980_1312364_+	antitermination protein	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
AVV70011.1|1312552_1313635_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	2.0e-153
AVV70012.1|1314223_1314439_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVV70013.1|1314438_1314936_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AVV70014.1|1314932_1315394_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	1.6e-75
AVV70015.1|1315425_1315719_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AVV70016.1|1316078_1316273_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
AVV70017.1|1316420_1316522_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70018.1|1316661_1317207_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
AVV70019.1|1317181_1319107_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
1317563:1317578	attR	TCGCTGCTGGCGCTGG	NA	NA	NA	NA
AVV70020.1|1319103_1319310_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AVV70021.1|1319306_1320908_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.1e-308
AVV70022.1|1320888_1322208_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
AVV70023.1|1322217_1322550_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	8.4e-55
AVV70024.1|1322605_1323631_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
AVV70025.1|1323672_1324068_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
AVV70026.1|1324079_1324433_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
AVV70027.1|1325018_1325414_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
AVV73219.1|1325421_1326162_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	1.6e-130
AVV70028.1|1326177_1326600_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
AVV70029.1|1326581_1327016_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AVV70030.1|1327008_1329570_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.0	0.0e+00
AVV70031.1|1329566_1329896_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
AVV70032.1|1329895_1330594_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
AVV70033.1|1330599_1331343_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
AVV70034.1|1331240_1331912_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	8.1e-105
AVV70035.1|1335436_1336036_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
AVV73220.1|1336100_1339127_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
AVV70036.1|1339126_1339702_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	4.2e-102
AVV70037.1|1339799_1340390_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVV70038.1|1340706_1340940_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
AVV73221.1|1341487_1342114_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVV70039.1|1343018_1343768_+	transcriptional regulator	NA	NA	NA	NA	NA
AVV70040.1|1344017_1344971_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AVV70041.1|1344996_1345188_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70042.1|1346403_1346529_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVV73222.1|1346485_1347112_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVV70043.1|1347385_1348339_-|protease	protease 7	protease	NA	NA	NA	NA
>prophage 5
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1919949	1973798	4754025	integrase,terminase,tail,lysis,holin,tRNA,portal	Enterobacteria_phage(47.73%)	64	1915044:1915058	1921524:1921538
1915044:1915058	attL	GATCGCGATGTACGC	NA	NA	NA	NA
AVV70560.1|1919949_1921068_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AVV70561.1|1921036_1921306_-	excisionase	NA	NA	NA	NA	NA
AVV70562.1|1921367_1923839_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1921524:1921538	attR	GCGTACATCGCGATC	NA	NA	NA	NA
AVV70563.1|1923931_1924123_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVV70564.1|1924119_1924308_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVV70565.1|1924875_1925094_-	hypothetical protein	NA	NA	NA	NA	NA
AVV70566.1|1925123_1925294_-	hypothetical protein	NA	NA	NA	NA	NA
AVV70567.1|1925253_1925409_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AVV70568.1|1925614_1926022_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AVV70569.1|1926098_1926326_+	transcriptional regulator	NA	NA	NA	NA	NA
AVV70570.1|1926309_1926861_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70571.1|1927661_1928327_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	3.2e-85
AVV70572.1|1928295_1929108_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	3.3e-108
AVV70573.1|1929967_1930726_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
AVV70574.1|1931008_1931221_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
AVV70575.1|1931441_1931702_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70576.1|1931768_1932047_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
AVV70577.1|1932048_1933107_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	9.8e-89
AVV70578.1|1933107_1933488_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	4.1e-37
AVV70579.1|1933484_1934306_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	1.1e-79
AVV70580.1|1934945_1935377_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AVV70581.1|1935267_1935534_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70582.1|1935692_1935821_+	hypothetical protein	NA	NA	NA	NA	NA
AVV70583.1|1935869_1936040_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.4	9.7e-23
AVV73240.1|1936063_1936216_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	90.0	1.7e-15
AVV70584.1|1936355_1936499_-	hypothetical protein	NA	NA	NA	NA	NA
AVV70585.1|1936497_1936713_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
AVV70586.1|1936712_1937210_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
AVV70587.1|1937206_1937674_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	99.4	4.6e-75
AVV70588.1|1937695_1938058_+	DNA-binding protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
AVV70589.1|1938509_1939049_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
AVV70590.1|1939057_1941157_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.6	0.0e+00
AVV70591.1|1941153_1941366_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AVV70592.1|1941365_1942874_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.5e-287
AVV70593.1|1942818_1944846_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
AVV70594.1|1944887_1945256_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
AVV70595.1|1945248_1945524_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AVV70596.1|1945535_1946114_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
AVV73242.1|1946110_1946512_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
AVV70597.1|1946522_1947266_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
AVV73241.1|1947326_1947713_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AVV70598.1|1947721_1948051_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AVV70599.1|1951086_1951416_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AVV70600.1|1951425_1952124_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
AVV70601.1|1952128_1952872_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
AVV70602.1|1952769_1953417_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	5.0e-112
AVV70603.1|1953477_1956873_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
AVV70604.1|1956940_1957540_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
AVV70605.1|1957604_1958918_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
AVV70606.1|1958919_1959189_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
AVV70607.1|1959460_1960096_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	75.3	1.8e-61
AVV70608.1|1961378_1962005_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.8	5.9e-25
AVV70609.1|1962188_1962779_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AVV70610.1|1963238_1963403_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	87.2	8.5e-16
AVV70611.1|1963635_1964499_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AVV70612.1|1964482_1965619_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AVV73243.1|1965597_1965813_-	hypothetical protein	NA	NA	NA	NA	NA
AVV70613.1|1965868_1967095_+	peptidase T	NA	NA	NA	NA	NA
AVV70614.1|1967143_1968265_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVV70615.1|1968340_1969801_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AVV70616.1|1969800_1970472_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AVV70617.1|1970640_1972011_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
AVV73244.1|1972014_1972656_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AVV70618.1|1972691_1973798_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	2707067	2764497	4754025	head,terminase,integrase,tail,transposase,lysis,holin,capsid,portal	Enterobacteria_phage(38.0%)	76	2716219:2716278	2764550:2764611
AVV71313.1|2707067_2708141_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AVV71314.1|2709358_2710210_+	protein deglycase HchA	NA	NA	NA	NA	NA
AVV71315.1|2710317_2711676_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AVV73281.1|2711675_2712347_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
AVV71316.1|2712479_2712893_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVV71317.1|2713001_2714006_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AVV71318.1|2714006_2714642_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AVV71319.1|2714898_2715549_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AVV71320.1|2715584_2715914_+	hypothetical protein	NA	NA	NA	NA	NA
2716219:2716278	attL	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGAC	NA	NA	NA	NA
AVV71321.1|2716993_2717563_-	type III effector	NA	NA	NA	NA	NA
AVV71322.1|2718692_2718824_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
AVV71323.1|2718846_2719110_-	T3SS effector NleC domain protein	NA	NA	NA	NA	NA
AVV71324.1|2719170_2720151_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
AVV71325.1|2720327_2720597_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
AVV71326.1|2720598_2721912_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
AVV73282.1|2721976_2722600_-	hypothetical protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	3.9e-69
AVV71327.1|2722668_2726145_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.6	0.0e+00
AVV71328.1|2726278_2726806_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
AVV71329.1|2726836_2727043_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71330.1|2726996_2727677_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	4.3e-114
AVV71331.1|2727574_2728318_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.6e-147
AVV71332.1|2728323_2729022_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
AVV71333.1|2729021_2729351_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AVV71334.1|2729347_2731927_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
AVV71335.1|2731907_2732321_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
AVV71336.1|2732347_2732779_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AVV71337.1|2732792_2733545_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
AVV71338.1|2733552_2733948_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
AVV71339.1|2733944_2734478_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
AVV71340.1|2734493_2734847_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
AVV71341.1|2734839_2735262_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71342.1|2735265_2736294_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
AVV71343.1|2736351_2736699_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AVV71344.1|2736735_2738241_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
AVV71345.1|2738230_2739823_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
AVV71346.1|2739819_2740026_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AVV71347.1|2740009_2741938_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
AVV71348.1|2741909_2742419_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AVV71349.1|2742821_2743046_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
AVV71350.1|2743127_2743442_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVV71351.1|2743684_2743825_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71352.1|2743907_2744375_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
AVV71353.1|2744376_2744490_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AVV71354.1|2744710_2745244_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AVV71355.1|2745276_2745471_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71356.1|2745439_2745676_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71357.1|2745624_2745969_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71358.1|2745931_2746147_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
AVV71359.1|2746145_2746307_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71360.1|2746585_2748436_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
AVV71361.1|2748849_2749116_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71362.1|2749606_2750428_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
AVV71363.1|2750424_2750799_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
AVV71364.1|2750811_2751861_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	7.9e-107
AVV71365.1|2751862_2752141_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
AVV71366.1|2752307_2752463_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AVV71367.1|2752534_2753623_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AVV71368.1|2753809_2753914_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71369.1|2754029_2754899_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
AVV71370.1|2754909_2755173_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
AVV71371.1|2755174_2755393_-	sugar acetyltransferase inhibitor	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
AVV71372.1|2755425_2755638_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
AVV71373.1|2756064_2756490_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	2.4e-62
AVV71374.1|2756530_2757493_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
AVV71375.1|2757515_2757941_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVV71376.1|2757924_2758248_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AVV71377.1|2758372_2758849_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AVV73283.1|2759167_2759323_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AVV71378.1|2759324_2759453_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71379.1|2759482_2759701_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71380.1|2759704_2759920_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71381.1|2760269_2760458_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVV71382.1|2760454_2760646_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVV71383.1|2760738_2763210_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
AVV71384.1|2763268_2763472_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVV71385.1|2763471_2764497_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
2764550:2764611	attR	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGACCG	NA	NA	NA	NA
>prophage 7
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	2883804	2924133	4754025	head,terminase,integrase,tail,transposase,lysis,holin,capsid,portal	Enterobacteria_phage(34.29%)	52	2871014:2871031	2927678:2927695
2871014:2871031	attL	GGAAGAGATCGACGCCCG	NA	NA	NA	NA
AVV71494.1|2883804_2884972_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
AVV73288.1|2885482_2885539_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71495.1|2885959_2886658_-	T3SS effector protein NleD	NA	NA	NA	NA	NA
AVV71496.1|2887126_2888119_-	peptidase M85	NA	NA	NA	NA	NA
AVV71497.1|2888179_2889160_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.2	8.5e-87
AVV73289.1|2889521_2890031_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.1	4.8e-49
AVV71498.1|2890213_2890483_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	4.2e-44
AVV71499.1|2890484_2891798_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	8.8e-79
AVV71500.1|2891862_2892462_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
AVV71501.1|2892530_2893744_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.4	2.6e-101
AVV73290.1|2893764_2894040_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.6	1.5e-44
AVV71502.1|2894047_2894443_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.1e-69
AVV71503.1|2894439_2894973_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	73.4	3.6e-63
AVV71504.1|2894984_2895338_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.0e-62
AVV71505.1|2895349_2895748_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.0e-59
AVV71506.1|2896715_2896907_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71507.1|2896929_2897691_+	abortive phage resistance protein	NA	NA	NA	NA	NA
AVV71508.1|2898683_2899331_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	90.7	2.4e-106
AVV71509.1|2899371_2899755_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVV71510.1|2899766_2900108_-|head	head decoration protein	head	NA	NA	NA	NA
AVV71511.1|2900117_2901158_-|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.6e-65
AVV71512.1|2901375_2901825_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVV71513.1|2901821_2902079_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71514.1|2904115_2904415_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVV71515.1|2904432_2904654_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71516.1|2904654_2904846_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
AVV71517.1|2904845_2905031_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71518.1|2905023_2905311_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71519.1|2905366_2905561_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVV71520.1|2905585_2906311_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71521.1|2906351_2906585_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVV73291.1|2907953_2908223_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
AVV71522.1|2908284_2908617_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	7.1e-54
AVV71523.1|2908626_2909946_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.4e-233
AVV71524.1|2909926_2911528_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AVV71525.1|2911524_2911731_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVV71526.1|2911727_2913653_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AVV71527.1|2913627_2914173_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AVV71528.1|2914662_2915280_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
AVV71529.1|2915429_2915867_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	2.9e-71
AVV71530.1|2915863_2916361_-	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
AVV71531.1|2916360_2916576_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AVV71532.1|2917441_2918158_-	hypothetical protein	NA	NA	NA	NA	NA
AVV71533.1|2918436_2919060_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	98.1	4.4e-113
AVV71534.1|2919056_2919722_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	97.3	1.4e-128
AVV71535.1|2919718_2920339_-	recombination protein NinG	NA	Q716C3	Shigella_phage	97.1	3.7e-96
AVV71536.1|2920331_2920502_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
AVV71537.1|2920498_2920681_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
AVV71538.1|2920677_2921088_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	2.0e-69
AVV71539.1|2921374_2921665_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AVV71540.1|2921977_2923145_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
AVV71541.1|2923185_2924133_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	96.2	3.3e-168
2927678:2927695	attR	CGGGCGTCGATCTCTTCC	NA	NA	NA	NA
>prophage 8
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	3197388	3257151	4754025	integrase,terminase,tail,transposase,plate,tRNA,capsid,holin,portal	Enterobacteria_phage(72.34%)	69	3212580:3212599	3251210:3251229
AVV71765.1|3197388_3198291_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
AVV71766.1|3198486_3199260_-	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AVV71767.1|3199267_3199984_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AVV71768.1|3199980_3200667_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AVV71769.1|3200756_3201539_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AVV71770.1|3201759_3202542_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
AVV71771.1|3202807_3203377_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AVV71772.1|3203471_3204989_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AVV71773.1|3205025_3205514_-	colicin V production protein	NA	NA	NA	NA	NA
AVV71774.1|3205772_3206435_-	cell division protein DedD	NA	NA	NA	NA	NA
AVV71775.1|3206424_3207693_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AVV71776.1|3207762_3208677_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AVV71777.1|3208832_3209492_-	DedA family protein	NA	NA	NA	NA	NA
AVV71778.1|3209574_3210387_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AVV71779.1|3210386_3211400_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVV71780.1|3211465_3212623_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.6e-23
3212580:3212599	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
AVV71781.1|3212781_3213786_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
AVV73296.1|3213882_3214203_-	XRE family transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
AVV71782.1|3214316_3214604_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.9e-23
AVV71783.1|3214610_3214817_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71784.1|3215069_3215411_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
AVV71785.1|3215421_3215709_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
AVV71786.1|3215720_3215963_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AVV71787.1|3216159_3216363_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
AVV71788.1|3216359_3216605_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	100.0	6.7e-41
AVV71789.1|3216601_3216901_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
AVV71790.1|3217223_3217454_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	100.0	2.8e-33
AVV71791.1|3217526_3217892_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
AVV73297.1|3218036_3220724_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
AVV71792.1|3220909_3221755_+	DNA methyltransferase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	1.6e-09
AVV71793.1|3221772_3223470_+	AAA family ATPase	NA	NA	NA	NA	NA
AVV71794.1|3224160_3225207_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AVV71795.1|3225206_3226958_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AVV71796.1|3227112_3227949_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
AVV71797.1|3227972_3229025_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AVV71798.1|3229070_3229871_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.1e-128
AVV71799.1|3229973_3230468_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
AVV71800.1|3230467_3230668_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AVV71801.1|3230670_3230994_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AVV71802.1|3230990_3231383_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AVV71803.1|3231379_3231787_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	6.1e-63
AVV73298.1|3231758_3231938_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71804.1|3231924_3232392_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.4e-84
AVV71805.1|3232384_3233020_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AVV71806.1|3233016_3233598_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
AVV71807.1|3233594_3233945_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AVV71808.1|3233948_3234845_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	2.1e-156
AVV71809.1|3234837_3235368_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
AVV71810.1|3235370_3237530_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	62.8	6.1e-194
AVV71811.1|3237531_3238056_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	95.4	7.5e-90
AVV71812.1|3238084_3238618_-|tail	phage tail protein	tail	A0A077SL44	Escherichia_phage	97.7	6.7e-94
AVV71813.1|3239645_3240233_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	1.7e-103
AVV71814.1|3240268_3240763_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.1e-85
AVV71815.1|3240769_3243577_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.9	0.0e+00
AVV71816.1|3243563_3243800_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AVV71817.1|3243727_3244102_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.5	9.0e-37
AVV71818.1|3244157_3244670_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AVV71819.1|3244669_3245854_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
AVV71820.1|3246011_3247121_+	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
AVV71821.1|3247243_3248029_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AVV71822.1|3248224_3248485_+	hypothetical protein	NA	NA	NA	NA	NA
AVV71823.1|3248625_3249714_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
AVV71824.1|3249777_3249918_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
AVV71825.1|3250167_3250365_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVV71826.1|3250309_3251101_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.6	5.1e-66
AVV71827.1|3251330_3252326_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
3251210:3251229	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
AVV71828.1|3252322_3253501_-	arabinose transporter	NA	NA	NA	NA	NA
AVV71829.1|3253765_3254986_-	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AVV71830.1|3255144_3257151_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 9
CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	3627933	3635073	4754025		Escherichia_phage(83.33%)	6	NA	NA
AVV72145.1|3627933_3630495_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AVV72146.1|3630600_3631257_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
AVV72147.1|3631307_3632075_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
AVV72148.1|3632270_3633179_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	7.3e-117
AVV72149.1|3633175_3634438_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AVV72150.1|3634434_3635073_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
