The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	0	49579	5288751	tail,terminase,portal,holin,lysis,tRNA,head,plate,capsid	Escherichia_phage(60.0%)	55	NA	NA
AWL49198.1|0_2289_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
AWL49199.1|2559_2853_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49200.1|2889_3198_+	XRE family transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
AWL49201.1|3175_4126_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
AWL49202.1|4250_4688_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
AWL49203.1|4911_5181_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
AWL49204.1|5393_6428_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
AWL49205.1|6427_8200_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AWL49206.1|8373_9228_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
AWL49207.1|9286_10360_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
AWL49208.1|10363_11107_+|terminase	terminase	terminase	U5N091	Enterobacteria_phage	98.4	1.7e-124
AWL49209.1|11206_11716_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AWL49210.1|11715_11919_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
AWL49211.1|11922_12204_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWL49212.1|12203_12701_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
AWL49213.1|12715_13144_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	96.5	1.5e-59
AWL49214.1|13128_13554_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	3.0e-65
AWL49215.1|13525_13699_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AWL49216.1|13661_14129_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AWL49217.1|14121_14574_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AWL49218.1|14640_15276_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.0e-109
AWL49219.1|15272_15620_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AWL49220.1|15624_16533_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
AWL49221.1|16525_17137_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
AWL49222.1|17133_18465_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.2	6.6e-175
AWL49223.1|18464_19067_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.5	1.1e-95
AWL49224.1|19038_19479_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.7e-50
AWL49225.1|19481_19880_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.1	1.3e-12
AWL49226.1|19907_20501_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	97.5	4.6e-104
AWL49227.1|20560_21751_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
AWL49228.1|21763_22282_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AWL49229.1|22337_22613_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AWL54029.1|22645_22765_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWL49230.1|22757_25205_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
AWL49231.1|25219_25699_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
AWL49232.1|25698_26862_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
AWL49233.1|26907_27162_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWL49234.1|27481_29764_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	8.4e-162
AWL49235.1|29815_30673_-	formate transporter FocA	NA	NA	NA	NA	NA
AWL54030.1|31058_32819_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AWL49236.1|32934_33627_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AWL49237.1|33815_34904_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	5.9e-81
AWL49238.1|34977_36261_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AWL49239.1|36435_37119_+	cytidylate kinase	NA	NA	NA	NA	NA
AWL49240.1|37252_38926_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AWL49241.1|39077_39365_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
AWL49242.1|39570_41835_+	ComEC family protein	NA	NA	NA	NA	NA
AWL49243.1|41871_43620_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	4.6e-59
AWL49244.1|43616_44597_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AWL49245.1|44651_45881_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWL49246.1|45944_46127_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49247.1|46123_46870_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AWL49248.1|47007_47901_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49249.1|47877_48657_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AWL49250.1|48778_49579_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 2
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	60983	64055	5288751	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
AWL49258.1|60983_62063_-	porin OmpK35	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
AWL49259.1|62654_64055_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
>prophage 3
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	70117	75240	5288751		Agrobacterium_phage(33.33%)	3	NA	NA
AWL49264.1|70117_71320_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
AWL49265.1|71646_74262_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
AWL49266.1|74466_75240_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.9e-29
>prophage 4
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	84006	85914	5288751		Tupanvirus(100.0%)	1	NA	NA
AWL49275.1|84006_85914_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-49
>prophage 5
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	98605	100660	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL49290.1|98605_100660_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 6
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	105602	106262	5288751	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL49299.1|105602_106262_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 7
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	129405	133119	5288751		Enterobacteria_phage(100.0%)	4	NA	NA
AWL49321.1|129405_129579_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
AWL49322.1|129741_130680_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWL49323.1|131280_132603_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.6	4.1e-201
AWL49324.1|132624_133119_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
>prophage 8
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	149683	150742	5288751		Cronobacter_phage(100.0%)	1	NA	NA
AWL49339.1|149683_150742_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 9
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	159619	160147	5288751		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AWL49348.1|159619_160147_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 10
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	168498	169419	5288751		Morganella_phage(100.0%)	1	NA	NA
AWL49356.1|168498_169419_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 11
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	172660	172912	5288751		Salmonella_phage(100.0%)	1	NA	NA
AWL49362.1|172660_172912_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.1e-12
>prophage 12
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	192069	193251	5288751		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AWL49379.1|192069_192804_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
AWL49380.1|193014_193251_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 13
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	196530	197172	5288751		Pseudomonas_phage(100.0%)	1	NA	NA
AWL49384.1|196530_197172_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 14
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	216896	222962	5288751		Planktothrix_phage(33.33%)	6	NA	NA
AWL49400.1|216896_217598_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
AWL49401.1|217597_218842_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AWL49402.1|218890_219802_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AWL49403.1|219816_220647_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
AWL49404.1|220737_221082_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49405.1|221333_222962_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.9e-27
>prophage 15
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	227395	228532	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL49410.1|227395_228532_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 16
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	235096	318454	5288751	transposase,terminase,tail,portal,integrase,tRNA,plate,capsid	Enterobacteria_phage(43.9%)	97	265560:265577	302133:302150
AWL49417.1|235096_236467_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	9.4e-108
AWL49418.1|236470_237112_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AWL54039.1|237166_238273_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWL49419.1|238329_238788_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AWL49420.1|238804_239455_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWL49421.1|239695_240946_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWL49422.1|241218_241932_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49423.1|241928_242321_-	amino acid-binding protein	NA	NA	NA	NA	NA
AWL49424.1|242313_242637_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWL49425.1|242880_243066_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49426.1|243086_243314_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AWL49427.1|243426_244620_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWL49428.1|245241_245427_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWL49429.1|245517_246012_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWL49430.1|246038_246545_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWL49431.1|246561_247449_+	manganese catalase family protein	NA	NA	NA	NA	NA
AWL49432.1|247504_248911_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWL49433.1|248907_249918_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWL49434.1|250033_250231_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49435.1|250797_251430_+	DNA-binding protein	NA	NA	NA	NA	NA
AWL49436.1|251469_251649_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49437.1|251977_252175_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49438.1|252173_253154_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL54040.1|253192_253324_-	ABC transporter	NA	NA	NA	NA	NA
AWL49439.1|253267_253933_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWL49440.1|254243_255752_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AWL49441.1|255872_256763_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49442.1|256769_258554_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWL49443.1|258627_259836_-	HD domain-containing protein	NA	NA	NA	NA	NA
AWL49444.1|260138_261182_+	type II asparaginase	NA	NA	NA	NA	NA
AWL49445.1|261435_261627_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49446.1|261842_262757_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWL49447.1|262846_263485_+	leucine efflux protein	NA	NA	NA	NA	NA
AWL49448.1|263615_263879_+	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWL49449.1|263938_264064_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54041.1|264181_264256_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49450.1|264255_264357_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49451.1|264414_265428_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
265560:265577	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AWL49452.1|265693_266677_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	79.8	8.4e-151
AWL49453.1|266792_267092_-	XRE family transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
AWL49454.1|267213_267492_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.8	2.4e-42
AWL49455.1|267512_267731_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AWL49456.1|267746_268124_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49457.1|268139_268403_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49458.1|268480_268705_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49459.1|268701_269268_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
AWL54042.1|269276_269504_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AWL49460.1|273024_273543_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49461.1|274128_275301_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49462.1|275293_277087_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49463.1|277732_278794_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.0	4.1e-143
AWL49464.1|278787_280515_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.4	3.7e-234
AWL49465.1|280671_281511_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	2.1e-94
AWL49466.1|281520_282555_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AWL49467.1|282604_283462_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.7	9.8e-71
AWL49468.1|283574_284090_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	50.0	4.8e-41
AWL49469.1|284089_284290_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AWL49470.1|284280_284565_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWL49471.1|284561_285107_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	7.4e-32
AWL54043.1|285118_285448_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWL49472.1|285629_286097_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.1	2.7e-46
AWL49473.1|286093_286729_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	1.0e-56
AWL49474.1|286725_287313_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	1.5e-59
AWL49475.1|287309_287660_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
AWL49476.1|287661_288585_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
AWL49477.1|288574_291601_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AWL49478.1|291597_291810_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49479.1|291809_292907_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	74.4	5.2e-08
AWL49480.1|293069_294527_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49481.1|294770_295262_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.2	1.1e-53
AWL49482.1|295277_298253_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	6.8e-220
AWL54044.1|298239_298398_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	4.6e-11
AWL49483.1|298397_298715_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.3	3.9e-17
AWL49484.1|298760_299276_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AWL49485.1|299275_300448_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	3.8e-158
AWL49486.1|300602_301742_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	1.0e-144
AWL49487.1|301785_302037_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	9.0e-09
AWL49488.1|302301_302541_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
302133:302150	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AWL49489.1|302530_302887_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWL49490.1|302873_303383_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWL49491.1|303528_304221_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49492.1|304252_305437_-	cyanate MFS transporter	NA	NA	NA	NA	NA
AWL54045.1|305538_306330_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL49493.1|306313_306760_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWL49494.1|306876_307377_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWL49495.1|307620_308760_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AWL49496.1|308930_309173_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
AWL49497.1|309443_309863_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AWL49498.1|309865_311131_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.1	1.9e-195
AWL49499.1|311137_312043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49500.1|312209_312959_+	KR domain-containing protein	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
AWL49501.1|312955_314173_-	MFS transporter	NA	NA	NA	NA	NA
AWL49502.1|314348_315230_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49503.1|315487_315799_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49504.1|315920_316403_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AWL49505.1|316561_317125_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49506.1|317170_318454_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
>prophage 17
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	321728	322583	5288751		Indivirus(100.0%)	1	NA	NA
AWL49509.1|321728_322583_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	4.7e-17
>prophage 18
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	326267	328333	5288751		Artogeia_rapae_granulovirus(50.0%)	2	NA	NA
AWL49515.1|326267_327521_-	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
AWL49516.1|327691_328333_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.4e-18
>prophage 19
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	334826	336773	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL49522.1|334826_336773_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 20
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	342075	342708	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL49527.1|342075_342708_-	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 21
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	348765	349986	5288751		Klosneuvirus(100.0%)	1	NA	NA
AWL49534.1|348765_349986_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 22
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	356669	357497	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL49541.1|356669_357497_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 23
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	363761	369495	5288751		Tupanvirus(50.0%)	5	NA	NA
AWL49549.1|363761_366020_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	1.0e-143
AWL49550.1|366132_366465_+	cell division activator CedA	NA	NA	NA	NA	NA
AWL49551.1|366524_367916_-	L-cystine transporter	NA	NA	NA	NA	NA
AWL49552.1|368051_368642_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AWL49553.1|368733_369495_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 24
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	376789	377467	5288751		Cyanophage(100.0%)	1	NA	NA
AWL49561.1|376789_377467_-	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 25
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	384764	387722	5288751		Acinetobacter_phage(100.0%)	2	NA	NA
AWL49568.1|384764_386123_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	4.3e-36
AWL49569.1|386126_387722_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
>prophage 26
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	394841	400212	5288751	protease	Chrysochromulina_ericina_virus(50.0%)	6	NA	NA
AWL49577.1|394841_395603_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	9.4e-09
AWL49578.1|395597_395813_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49579.1|395857_396904_+|protease	protease SohB	protease	NA	NA	NA	NA
AWL49580.1|396951_397203_-	DUF2498 domain-containing protein	NA	NA	NA	NA	NA
AWL49581.1|397131_397353_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49582.1|397614_400212_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
>prophage 27
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	405052	405655	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL49587.1|405052_405655_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 28
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	411245	413180	5288751		Bodo_saltans_virus(100.0%)	1	NA	NA
AWL49596.1|411245_413180_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
>prophage 29
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	417810	419614	5288751		Staphylococcus_phage(50.0%)	2	NA	NA
AWL49600.1|417810_418620_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
AWL49601.1|418621_419614_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
>prophage 30
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	450303	455746	5288751		Staphylococcus_phage(33.33%)	6	NA	NA
AWL49628.1|450303_451173_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	3.3e-50
AWL49629.1|451340_451649_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AWL49630.1|451724_451913_-	cold-shock protein	NA	NA	NA	NA	NA
AWL49631.1|452213_453128_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49632.1|453235_453997_+	KR domain-containing protein	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
AWL49633.1|454213_455746_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
>prophage 31
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	463732	468758	5288751		Cronobacter_phage(50.0%)	2	NA	NA
AWL49640.1|463732_466387_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.3	8.5e-97
AWL49641.1|466379_468758_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.1	1.8e-18
>prophage 32
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	501269	502283	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL49673.1|501269_502283_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 33
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	509891	517007	5288751	tRNA	Escherichia_phage(40.0%)	8	NA	NA
AWL54052.1|509891_510635_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	1.0e-15
AWL49682.1|510913_511897_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AWL49683.1|512213_512408_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49684.1|512422_513796_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
AWL49685.1|513841_514777_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AWL49686.1|515010_515445_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
AWL49687.1|515526_515739_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AWL49688.1|515882_517007_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
>prophage 34
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	522125	523115	5288751		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL49693.1|522125_523115_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	3.3e-70
>prophage 35
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	549308	553946	5288751		Klosneuvirus(50.0%)	2	NA	NA
AWL49719.1|549308_553211_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	3.8e-53
AWL49720.1|553271_553946_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	4.6e-31
>prophage 36
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	562632	563838	5288751		Klosneuvirus(100.0%)	1	NA	NA
AWL49728.1|562632_563838_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	6.9e-22
>prophage 37
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	576016	579544	5288751		Enterobacteria_phage(50.0%)	6	NA	NA
AWL49739.1|576016_576409_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	2.3e-19
AWL49740.1|576659_576893_-	putative sulfurtransferase YedF	NA	NA	NA	NA	NA
AWL49741.1|576889_578098_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AWL49742.1|578201_578555_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AWL49743.1|578752_579271_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49744.1|579340_579544_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
>prophage 38
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	592364	593666	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL49754.1|592364_593666_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 39
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	604910	605426	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL49767.1|604910_605426_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 40
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	624352	627130	5288751		Lactobacillus_phage(100.0%)	1	NA	NA
AWL49784.1|624352_627130_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	7.3e-67
>prophage 41
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	636573	637533	5288751		Salmonella_phage(100.0%)	1	NA	NA
AWL49794.1|636573_637533_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	4.6e-53
>prophage 42
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	654657	671541	5288751		Escherichia_phage(44.44%)	18	NA	NA
AWL49810.1|654657_655266_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	1.7e-24
AWL49811.1|655307_656165_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
AWL49812.1|656166_656784_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AWL49813.1|656794_659230_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.9e-214
AWL49814.1|659380_659650_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWL49815.1|659751_660462_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWL49816.1|660455_661016_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWL49817.1|661094_661436_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWL49818.1|661580_661907_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
AWL49819.1|662021_663305_+	MFS transporter	NA	NA	NA	NA	NA
AWL49820.1|663568_665032_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.3e-43
AWL49821.1|665296_665728_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
AWL49822.1|665778_666465_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49823.1|666556_667306_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AWL49824.1|667436_669482_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.7	3.5e-18
AWL49825.1|669559_669952_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AWL54058.1|669973_670816_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL49826.1|670866_671541_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.5	1.1e-82
>prophage 43
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	680684	696580	5288751		Escherichia_phage(70.0%)	16	NA	NA
AWL49836.1|680684_681305_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	2.3e-114
AWL49837.1|681297_682563_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	1.5e-232
AWL49838.1|682574_683477_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.0e-158
AWL49839.1|683514_683748_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49840.1|683738_684500_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWL49841.1|684520_685381_-	class A extended-spectrum beta-lactamase SHV-31	NA	A0A077SL40	Escherichia_phage	99.0	8.4e-155
AWL49842.1|685678_685939_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AWL49843.1|686025_687114_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	5.2e-210
AWL49844.1|687144_688410_-	MFS transporter	NA	NA	NA	NA	NA
AWL49845.1|688464_691572_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWL49846.1|691768_692833_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.5	1.5e-65
AWL49847.1|693087_693528_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL49848.1|693580_693796_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
AWL49849.1|693764_694862_-	transcriptional regulator FtrA	NA	NA	NA	NA	NA
AWL49850.1|694929_695328_+	rhodanese	NA	NA	NA	NA	NA
AWL49851.1|695476_696580_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	1.4e-101
>prophage 44
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	700731	709287	5288751	transposase,integrase	Brazilian_cedratvirus(25.0%)	12	NA	NA
AWL49855.1|700731_701529_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	1.8e-10
AWL49856.1|701538_702237_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-15
AWL49857.1|702526_702961_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWL49858.1|703032_703383_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AWL49859.1|703396_703672_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AWL54060.1|703707_704130_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWL49860.1|704181_705876_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWL49861.1|705893_706256_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL49862.1|706252_706489_+	mercury resistance protein	NA	NA	NA	NA	NA
AWL49863.1|706485_707193_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWL49864.1|707231_708536_+|integrase	integrase	integrase	NA	NA	NA	NA
AWL49865.1|708582_709287_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 45
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	712625	713390	5288751	transposase	Escherichia_phage(100.0%)	1	NA	NA
AWL49870.1|712625_713390_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 46
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	718167	724031	5288751	transposase,integrase	Salmonella_phage(50.0%)	5	715280:715312	724024:724056
715280:715312	attL	CGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
AWL49880.1|718167_718665_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWL49881.1|718809_719823_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWL49882.1|719761_720376_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWL49883.1|720501_721062_+	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWL49884.1|721064_724031_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
724024:724056	attR	CGGCTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 47
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	727059	727434	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL54061.1|727059_727434_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 48
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	732511	733462	5288751		Catovirus(100.0%)	1	NA	NA
AWL49893.1|732511_733462_-	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	34.1	7.3e-35
>prophage 49
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	737985	738747	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL49898.1|737985_738747_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 50
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	744195	745569	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL54063.1|744195_745569_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 51
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	758604	759396	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL49921.1|758604_759396_-	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.0	1.6e-19
>prophage 52
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	769889	771269	5288751		Enterobacteria_phage(100.0%)	1	NA	NA
AWL49933.1|769889_771269_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	5.3e-18
>prophage 53
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	797058	798234	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL49959.1|797058_798234_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	7.9e-39
>prophage 54
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	805596	807153	5288751		Catovirus(100.0%)	1	NA	NA
AWL49966.1|805596_807153_-	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	25.2	2.3e-17
>prophage 55
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	814448	815222	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL49974.1|814448_815222_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	1.5e-22
>prophage 56
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	829282	829801	5288751		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL49985.1|829282_829801_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	37.6	1.3e-25
>prophage 57
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	841292	842075	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL49995.1|841292_842075_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 58
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	856748	857801	5288751		Enterobacteria_phage(100.0%)	1	NA	NA
AWL50013.1|856748_857801_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 59
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	874706	875444	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL50032.1|874706_875444_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
>prophage 60
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	899202	900459	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL50056.1|899202_900459_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	3.0e-20
>prophage 61
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	906450	910568	5288751		Pithovirus(50.0%)	4	NA	NA
AWL50061.1|906450_907179_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.6	1.1e-17
AWL50062.1|907175_907916_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL50063.1|907940_908876_+	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AWL50064.1|909182_910568_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
>prophage 62
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	914771	916852	5288751		Bacillus_phage(100.0%)	2	NA	NA
AWL50068.1|914771_916115_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	4.0e-10
AWL50069.1|916111_916852_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.9e-30
>prophage 63
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	933374	934055	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL50084.1|933374_934055_-	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	1.6e-15
>prophage 64
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	944641	945046	5288751		Stx_converting_phage(100.0%)	1	NA	NA
AWL50095.1|944641_945046_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 65
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	949853	952191	5288751		Mycobacterium_phage(50.0%)	5	NA	NA
AWL50102.1|949853_950069_-	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
AWL50103.1|950094_950325_+	hypothetical protein	NA	NA	NA	NA	NA
AWL50104.1|950227_950428_-	hypothetical protein	NA	NA	NA	NA	NA
AWL50105.1|950434_950620_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWL54071.1|951318_952191_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
>prophage 66
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	958675	963417	5288751		Streptococcus_phage(33.33%)	4	NA	NA
AWL50113.1|958675_960391_+	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.6	5.8e-30
AWL50114.1|960427_961381_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWL50115.1|961554_962154_-	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	38.4	8.5e-21
AWL50116.1|962406_963417_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
>prophage 67
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	967005	968622	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL50120.1|967005_968622_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	5.6e-19
>prophage 68
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	979893	980667	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL50131.1|979893_980667_-	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 69
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	987146	988646	5288751		Mycobacterium_phage(100.0%)	1	NA	NA
AWL50139.1|987146_988646_-	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 70
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	994753	996298	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL50143.1|994753_996298_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.4e-19
>prophage 71
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1001821	1002523	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL54072.1|1001821_1002523_-	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.2e-31
>prophage 72
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1011960	1012740	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL50159.1|1011960_1012740_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 73
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1018678	1019230	5288751		Leuconostoc_phage(100.0%)	1	NA	NA
AWL50166.1|1018678_1019230_-	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	1.8e-09
>prophage 74
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1023808	1025899	5288751		Salmonella_phage(100.0%)	1	NA	NA
AWL54073.1|1023808_1025899_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 75
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1041590	1042604	5288751		Mycoplasma_phage(100.0%)	1	NA	NA
AWL50189.1|1041590_1042604_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 76
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1049476	1051438	5288751	protease	Phage_TP(100.0%)	1	NA	NA
AWL50196.1|1049476_1051438_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.0	3.9e-22
>prophage 77
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1061869	1064510	5288751		Moumouvirus(100.0%)	2	NA	NA
AWL50208.1|1061869_1062958_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	24.4	6.9e-05
AWL50209.1|1063004_1064510_-	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
>prophage 78
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1071335	1073386	5288751		Prochlorococcus_phage(50.0%)	3	NA	NA
AWL50215.1|1071335_1072454_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.5	6.8e-32
AWL50216.1|1072478_1072754_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AWL50217.1|1072858_1073386_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	45.9	2.9e-17
>prophage 79
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1078937	1080308	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL50225.1|1078937_1080308_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 80
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1091563	1092838	5288751	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AWL50237.1|1091563_1092838_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.4e-86
>prophage 81
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1096174	1097536	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL50242.1|1096174_1097536_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 82
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1101342	1102830	5288751		Salmonella_phage(50.0%)	2	NA	NA
AWL50247.1|1101342_1101864_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	3.1e-51
AWL50248.1|1101933_1102830_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	1.8e-06
>prophage 83
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1107017	1107890	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL50255.1|1107017_1107890_+	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 84
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1111161	1119361	5288751		Enterobacteria_phage(25.0%)	8	NA	NA
AWL50260.1|1111161_1112187_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
AWL50261.1|1112113_1113118_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL50262.1|1113230_1114412_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AWL50263.1|1114704_1115853_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
AWL50264.1|1115889_1116525_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AWL50265.1|1116754_1118128_+	multidrug transporter MdtK	NA	NA	NA	NA	NA
AWL50266.1|1118303_1118642_+	acid-shock protein	NA	NA	NA	NA	NA
AWL50267.1|1118782_1119361_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	5.9e-19
>prophage 85
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1123324	1124209	5288751		Burkholderia_virus(100.0%)	1	NA	NA
AWL50271.1|1123324_1124209_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.7	1.5e-21
>prophage 86
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1129684	1130455	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL50279.1|1129684_1130455_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 87
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1135639	1137588	5288751		Bacillus_virus(50.0%)	2	NA	NA
AWL50284.1|1135639_1136620_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
AWL50285.1|1136616_1137588_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
>prophage 88
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1151286	1155804	5288751		Bacillus_virus(50.0%)	4	NA	NA
AWL50300.1|1151286_1152117_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.9e-26
AWL50301.1|1152118_1152934_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL54080.1|1152963_1154382_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AWL50302.1|1154436_1155804_-	chromate transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.0	2.3e-29
>prophage 89
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1174676	1180322	5288751		Leptospira_phage(50.0%)	4	NA	NA
AWL50323.1|1174676_1177793_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	1.2e-54
AWL50324.1|1177830_1178715_-	hypothetical protein	NA	NA	NA	NA	NA
AWL50325.1|1178944_1179295_-	transporter	NA	NA	NA	NA	NA
AWL50326.1|1179617_1180322_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	2.1e-26
>prophage 90
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1193455	1194079	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL50344.1|1193455_1194079_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	1.4e-05
>prophage 91
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1198935	1200006	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL50348.1|1198935_1200006_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 92
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1206291	1210354	5288751	transposase	Salmonella_phage(66.67%)	3	NA	NA
AWL50351.1|1206291_1207887_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	98.9	1.3e-95
AWL50352.1|1207966_1208842_-	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
AWL50353.1|1209091_1210354_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 93
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1227237	1231756	5288751		Planktothrix_phage(50.0%)	3	NA	NA
AWL50369.1|1227237_1228059_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
AWL50370.1|1228564_1230637_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWL50371.1|1230982_1231756_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	1.5e-30
>prophage 94
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1242412	1244376	5288751		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AWL50381.1|1242412_1243429_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.9e-41
AWL50382.1|1243425_1244376_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	2.1e-34
>prophage 95
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1251813	1252563	5288751		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL50390.1|1251813_1252563_+	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	3.7e-05
>prophage 96
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1262483	1265696	5288751		environmental_halophage(50.0%)	3	NA	NA
AWL50402.1|1262483_1263704_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
AWL50403.1|1263700_1264975_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AWL50404.1|1264949_1265696_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.5	3.0e-07
>prophage 97
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1280188	1280950	5288751		Indivirus(100.0%)	1	NA	NA
AWL50418.1|1280188_1280950_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 98
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1290929	1298898	5288751		Hokovirus(25.0%)	7	NA	NA
AWL50428.1|1290929_1293308_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
AWL54084.1|1293647_1294481_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AWL54085.1|1294635_1295682_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
AWL50429.1|1295789_1296017_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AWL50430.1|1296046_1297489_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.0	1.1e-55
AWL50431.1|1297602_1298067_-	lipoprotein	NA	NA	NA	NA	NA
AWL50432.1|1298148_1298898_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	3.8e-10
>prophage 99
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1305966	1313135	5288751	tRNA	Geobacillus_virus(25.0%)	7	NA	NA
AWL50440.1|1305966_1306266_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AWL50441.1|1306270_1308658_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AWL50442.1|1308673_1309657_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AWL50443.1|1309963_1310320_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWL50444.1|1310370_1310568_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWL50445.1|1310660_1311203_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AWL50446.1|1311206_1313135_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
>prophage 100
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1322789	1325687	5288751		Lactobacillus_phage(33.33%)	3	NA	NA
AWL50458.1|1322789_1323617_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
AWL50459.1|1323672_1324677_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AWL50460.1|1324673_1325687_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
>prophage 101
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1333946	1340216	5288751		Citrobacter_phage(25.0%)	7	NA	NA
AWL50467.1|1333946_1334564_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	9.2e-55
AWL50468.1|1335125_1335533_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AWL50469.1|1335654_1336557_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.2e-58
AWL50470.1|1336754_1337768_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AWL50471.1|1337857_1338760_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AWL50472.1|1338860_1339331_+	hypothetical protein	NA	NA	NA	NA	NA
AWL50473.1|1339373_1340216_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
>prophage 102
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1344052	1345588	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL50478.1|1344052_1345588_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 103
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1362081	1362870	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL50486.1|1362081_1362870_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 104
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1368381	1374095	5288751		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
AWL50492.1|1368381_1368612_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
AWL50493.1|1368875_1369976_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AWL50494.1|1370062_1370917_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AWL50495.1|1370956_1371769_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AWL50496.1|1371772_1372165_-	siroheme synthase	NA	NA	NA	NA	NA
AWL50497.1|1372164_1373013_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AWL50498.1|1373012_1374095_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 105
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1377307	1380059	5288751		Tupanvirus(50.0%)	2	NA	NA
AWL50502.1|1377307_1378255_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
AWL50503.1|1378379_1380059_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
>prophage 106
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1396593	1400699	5288751		Microcystis_phage(75.0%)	4	NA	NA
AWL50520.1|1396593_1397484_-	sulfatase modifying factor 1	NA	A0A7H6	Microcystis_virus	28.9	1.2e-10
AWL50521.1|1397659_1398553_-	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	26.7	6.9e-11
AWL50522.1|1398728_1399622_-	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
AWL50523.1|1399805_1400699_-	sulfatase modifying factor 1	NA	A0A075BSL8	Microcystis_phage	28.8	8.8e-14
>prophage 107
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1409222	1419096	5288751		Staphylococcus_phage(50.0%)	10	NA	NA
AWL50531.1|1409222_1409921_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
AWL50532.1|1410111_1410594_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
AWL50533.1|1410703_1411603_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL50534.1|1411577_1412384_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL50535.1|1412398_1413694_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
AWL50536.1|1413997_1414924_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL50537.1|1415024_1415501_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL50538.1|1415550_1417194_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
AWL50539.1|1417477_1418371_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWL50540.1|1418376_1419096_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
>prophage 108
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1423820	1426115	5288751		Tetraselmis_virus(100.0%)	1	NA	NA
AWL50545.1|1423820_1426115_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	3.9e-159
>prophage 109
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1442150	1442762	5288751		Geobacillus_virus(100.0%)	1	NA	NA
AWL50561.1|1442150_1442762_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	6.6e-05
>prophage 110
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1458387	1472424	5288751	tRNA,transposase	Staphylococcus_phage(20.0%)	13	NA	NA
AWL54089.1|1458387_1460073_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
AWL50577.1|1460278_1460860_-	hypothetical protein	NA	NA	NA	NA	NA
AWL50578.1|1460898_1461594_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AWL50579.1|1461739_1463650_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	1.5e-90
AWL50580.1|1463781_1464126_+	RidA family protein	NA	NA	NA	NA	NA
AWL50581.1|1464126_1464312_-	YoaH family protein	NA	NA	NA	NA	NA
AWL50582.1|1464400_1465756_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
AWL50583.1|1465759_1466338_+	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AWL50584.1|1466500_1467865_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AWL54090.1|1467998_1468109_+	ABC transporter	NA	NA	NA	NA	NA
AWL50585.1|1468147_1469128_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWL50586.1|1469247_1470831_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWL50587.1|1470864_1472424_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 111
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1479864	1480074	5288751		Morganella_phage(100.0%)	1	NA	NA
AWL50594.1|1479864_1480074_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 112
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1485311	1487360	5288751		Moraxella_phage(100.0%)	1	NA	NA
AWL50602.1|1485311_1487360_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	8.0e-87
>prophage 113
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1494867	1495521	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL50610.1|1494867_1495521_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.0e-56
>prophage 114
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1499243	1500212	5288751		Pectobacterium_phage(50.0%)	2	NA	NA
AWL50614.1|1499243_1499474_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
AWL50615.1|1499552_1500212_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.2	4.9e-14
>prophage 115
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1507636	1509112	5288751		Cyanophage(100.0%)	1	NA	NA
AWL50622.1|1507636_1509112_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 116
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1513037	1529584	5288751	tRNA	Tupanvirus(25.0%)	18	NA	NA
AWL50627.1|1513037_1514357_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
AWL50628.1|1514372_1515317_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AWL50629.1|1515395_1516148_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
AWL50630.1|1516147_1516933_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AWL50631.1|1516996_1518007_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AWL50632.1|1518015_1518627_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AWL50633.1|1518706_1519228_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AWL50634.1|1519262_1520003_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWL50635.1|1520030_1520474_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AWL50636.1|1520475_1522263_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AWL50637.1|1522530_1523097_+	hydrolase	NA	NA	NA	NA	NA
AWL50638.1|1523093_1523912_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AWL50639.1|1523964_1524360_+	hypothetical protein	NA	NA	NA	NA	NA
AWL50640.1|1524399_1525143_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AWL50641.1|1525139_1526144_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AWL50642.1|1526225_1526969_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AWL50643.1|1527045_1527615_-	VOC family protein	NA	NA	NA	NA	NA
AWL50644.1|1527850_1529584_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
>prophage 117
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1536522	1538037	5288751		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL50651.1|1536522_1538037_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 118
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1554644	1555397	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL50671.1|1554644_1555397_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 119
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1561999	1570443	5288751		Burkholderia_phage(40.0%)	8	NA	NA
AWL50680.1|1561999_1563679_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
AWL50681.1|1563794_1564706_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AWL50682.1|1564889_1565801_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AWL54095.1|1565775_1566270_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
AWL50683.1|1566250_1567684_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
AWL50684.1|1567727_1568435_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AWL50685.1|1568477_1568759_-	hypothetical protein	NA	NA	NA	NA	NA
AWL50686.1|1569297_1570443_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
>prophage 120
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1588028	1612684	5288751		Bacillus_phage(40.0%)	8	NA	NA
AWL50700.1|1588028_1589291_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.8	8.7e-76
AWL50701.1|1589484_1590789_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AWL50702.1|1590816_1592097_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AWL50703.1|1592089_1593892_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	27.1	3.2e-23
AWL50704.1|1593878_1595681_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	1.1e-31
AWL50705.1|1595847_1596807_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AWL50706.1|1596997_1603105_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.5	4.7e-34
AWL50707.1|1603192_1612684_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 121
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1620251	1620437	5288751		Vibrio_phage(100.0%)	1	NA	NA
AWL50713.1|1620251_1620437_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 122
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1637178	1642210	5288751		Caulobacter_phage(20.0%)	5	NA	NA
AWL50735.1|1637178_1638126_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	1.9e-54
AWL50736.1|1639036_1640122_+	thymidylate synthase	NA	A0A2I7RW46	Vibrio_phage	36.1	4.7e-54
AWL50737.1|1640118_1640676_+	adenylate kinase	NA	S6CFB8	Klebsiella_phage	31.1	7.9e-13
AWL50738.1|1640665_1641697_+	hypothetical protein	NA	A0A075E0Y9	Dickeya_phage	31.0	7.0e-39
AWL50739.1|1641718_1642210_+	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	45.7	1.4e-05
>prophage 123
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1647802	1648414	5288751		Enterococcus_phage(100.0%)	1	NA	NA
AWL50745.1|1647802_1648414_-	hypothetical protein	NA	A0A0S2MYG4	Enterococcus_phage	32.8	1.4e-15
>prophage 124
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1652179	1653016	5288751		Mycobacterium_phage(100.0%)	1	NA	NA
AWL50749.1|1652179_1653016_-	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 125
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1668536	1673625	5288751		Stx2-converting_phage(50.0%)	3	NA	NA
AWL50767.1|1668536_1669706_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.7	7.6e-183
AWL50768.1|1669880_1671305_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AWL50769.1|1671522_1673625_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	1.7e-63
>prophage 126
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1678132	1679032	5288751		Cellulophaga_phage(100.0%)	1	NA	NA
AWL54101.1|1678132_1679032_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 127
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1685279	1702120	5288751		Catovirus(14.29%)	12	NA	NA
AWL50781.1|1685279_1686596_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	34.9	1.9e-12
AWL50782.1|1686716_1687850_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AWL50783.1|1687862_1688756_-	glycosyl transferase	NA	NA	NA	NA	NA
AWL50784.1|1688752_1689907_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	6.5e-78
AWL50785.1|1689922_1691818_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
AWL50786.1|1691833_1692574_-	O-antigen export system ATP-binding protein RfbB	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.0e-07
AWL54102.1|1692573_1693341_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL50787.1|1694384_1695389_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
AWL50788.1|1696332_1697499_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AWL50789.1|1697662_1699033_-	phosphomannomutase	NA	NA	NA	NA	NA
AWL50790.1|1699055_1700471_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.1e-53
AWL50791.1|1700713_1702120_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	6.2e-38
>prophage 128
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1706852	1708512	5288751	transposase	Escherichia_phage(100.0%)	2	NA	NA
AWL50796.1|1706852_1707776_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	4.1e-176
AWL50797.1|1707833_1708512_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	94.7	5.8e-127
>prophage 129
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1715857	1716838	5288751	transposase	Escherichia_phage(100.0%)	1	NA	NA
AWL50802.1|1715857_1716838_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 130
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1723128	1730199	5288751		Bacillus_phage(25.0%)	5	NA	NA
AWL54106.1|1723128_1724019_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.0	5.6e-45
AWL50808.1|1724784_1726368_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AWL50809.1|1727007_1728855_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AWL50810.1|1728885_1729467_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AWL50811.1|1729557_1730199_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
>prophage 131
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1747319	1754226	5288751		Bacillus_phage(33.33%)	6	NA	NA
AWL50822.1|1747319_1748798_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AWL50823.1|1748794_1749517_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWL50824.1|1749835_1751197_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWL54108.1|1751442_1752336_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWL50825.1|1752578_1753352_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWL54109.1|1753362_1754226_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 132
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1781244	1788301	5288751	tRNA	Enterobacteria_phage(50.0%)	7	NA	NA
AWL54112.1|1781244_1783278_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
AWL50848.1|1783395_1783866_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
AWL50849.1|1783913_1784633_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AWL54113.1|1784626_1786315_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.1	5.5e-259
AWL50850.1|1786544_1786658_+	hypothetical protein	NA	NA	NA	NA	NA
AWL50851.1|1786632_1787370_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL50852.1|1787353_1788301_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.5e-24
>prophage 133
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1794835	1795390	5288751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL50857.1|1794835_1795390_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 134
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1799664	1800399	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL50862.1|1799664_1800399_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.7	1.5e-48
>prophage 135
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1812038	1813559	5288751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL50873.1|1812038_1813559_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 136
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1817323	1821230	5288751		Cellulophaga_phage(50.0%)	3	NA	NA
AWL50877.1|1817323_1817992_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
AWL50878.1|1818352_1819186_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AWL50879.1|1819256_1821230_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
>prophage 137
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1825629	1826484	5288751		Catovirus(100.0%)	1	NA	NA
AWL50884.1|1825629_1826484_+	endonuclease	NA	A0A1V0SBL9	Catovirus	33.2	1.5e-23
>prophage 138
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1834316	1838628	5288751		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AWL50893.1|1834316_1835783_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.3	9.2e-45
AWL50894.1|1835903_1836881_+	GTP-binding protein	NA	NA	NA	NA	NA
AWL54114.1|1836924_1837632_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AWL50895.1|1838058_1838628_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
>prophage 139
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1844382	1850469	5288751		Planktothrix_phage(33.33%)	5	NA	NA
AWL50900.1|1844382_1845972_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
AWL50901.1|1845975_1846320_-	hypothetical protein	NA	NA	NA	NA	NA
AWL50902.1|1846651_1847848_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
AWL50903.1|1847844_1848564_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AWL50904.1|1848711_1850469_+	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.9e-101
>prophage 140
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1854705	1855713	5288751		Vibrio_phage(100.0%)	1	NA	NA
AWL50910.1|1854705_1855713_-	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	49.8	2.4e-84
>prophage 141
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1862079	1863240	5288751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL54115.1|1862079_1863240_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	3.8e-78
>prophage 142
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1867158	1870565	5288751		Acanthamoeba_polyphaga_mimivirus(50.0%)	3	NA	NA
AWL50920.1|1867158_1868223_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	3.5e-17
AWL50921.1|1868296_1869349_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AWL50922.1|1869452_1870565_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.6	2.6e-116
>prophage 143
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1874705	1886836	5288751		Pseudomonas_phage(33.33%)	9	NA	NA
AWL50925.1|1874705_1877546_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
AWL50926.1|1877677_1880311_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	3.5e-95
AWL50927.1|1880457_1881186_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AWL50928.1|1881229_1881418_+	hypothetical protein	NA	NA	NA	NA	NA
AWL50929.1|1881530_1883816_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
AWL50930.1|1883917_1885048_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AWL50931.1|1885047_1885302_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
AWL54116.1|1885361_1885769_+	oxidoreductase	NA	NA	NA	NA	NA
AWL50932.1|1885765_1886836_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
>prophage 144
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1894681	1895887	5288751		Oenococcus_phage(100.0%)	1	NA	NA
AWL50939.1|1894681_1895887_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
>prophage 145
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1899002	1899956	5288751	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWL50944.1|1899002_1899956_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 146
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1927985	1928585	5288751		Salmonella_phage(100.0%)	1	NA	NA
AWL50969.1|1927985_1928585_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 147
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1940987	1941761	5288751		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL50983.1|1940987_1941761_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 148
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1953947	1955465	5288751		Mollivirus(100.0%)	1	NA	NA
AWL50993.1|1953947_1955465_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.0e-86
>prophage 149
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1961907	1963020	5288751		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL54118.1|1961907_1963020_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.3	1.2e-20
>prophage 150
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1971529	1972615	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL51007.1|1971529_1972615_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 151
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1981731	1986314	5288751		Enterobacteria_phage(25.0%)	5	NA	NA
AWL51016.1|1981731_1982661_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
AWL51017.1|1983073_1983556_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AWL51018.1|1983923_1984805_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AWL51019.1|1984814_1985723_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
AWL51020.1|1985855_1986314_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
>prophage 152
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	1989584	1992031	5288751		Enterobacteria_phage(50.0%)	2	NA	NA
AWL51024.1|1989584_1991282_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	2.3e-47
AWL54122.1|1991293_1992031_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
>prophage 153
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2006754	2016681	5288751		Lactobacillus_phage(25.0%)	9	NA	NA
AWL51035.1|2006754_2007681_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
AWL51036.1|2007769_2008768_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AWL51037.1|2008764_2008983_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51038.1|2008984_2011000_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.5	6.3e-145
AWL54124.1|2011069_2012128_-	cell division protein ZipA	NA	NA	NA	NA	NA
AWL51039.1|2012361_2013123_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AWL51040.1|2013299_2014271_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
AWL51041.1|2014651_2014909_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AWL51042.1|2014953_2016681_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 154
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2020289	2022414	5288751		Lactococcus_phage(50.0%)	2	NA	NA
AWL51048.1|2020289_2021201_-	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.0	6.3e-52
AWL51049.1|2021319_2022414_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
>prophage 155
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2025767	2029344	5288751		Pandoravirus(50.0%)	5	NA	NA
AWL51053.1|2025767_2026667_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
AWL51054.1|2026761_2027337_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AWL51055.1|2027398_2027848_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AWL51056.1|2027834_2028260_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AWL51057.1|2028471_2029344_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
>prophage 156
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2064243	2064957	5288751		Cyanophage(100.0%)	1	NA	NA
AWL51090.1|2064243_2064957_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 157
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2071603	2074598	5288751	transposase	Sodalis_phage(50.0%)	3	NA	NA
AWL51098.1|2071603_2072515_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AWL51099.1|2072511_2073213_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
AWL51100.1|2073311_2074598_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
>prophage 158
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2078137	2079813	5288751		Prochlorococcus_phage(100.0%)	2	NA	NA
AWL51104.1|2078137_2079175_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AWL51105.1|2079171_2079813_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
>prophage 159
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2086224	2086416	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL51109.1|2086224_2086416_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 160
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2090185	2096810	5288751		Tetraselmis_virus(33.33%)	4	NA	NA
AWL51113.1|2090185_2092054_+	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.7	1.2e-07
AWL51114.1|2092148_2093726_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWL51115.1|2093793_2095260_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AWL51116.1|2095418_2096810_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
>prophage 161
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2107005	2107437	5288751		Powai_lake_megavirus(100.0%)	1	NA	NA
AWL51127.1|2107005_2107437_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 162
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2117932	2124253	5288751		Mycoplasma_phage(20.0%)	8	NA	NA
AWL51133.1|2117932_2119219_-	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	9.9e-35
AWL51134.1|2119289_2119490_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWL51135.1|2119491_2119827_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AWL51136.1|2119828_2121679_-	molecular chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
AWL51137.1|2121694_2122210_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AWL51138.1|2122284_2122608_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AWL51139.1|2122625_2123012_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AWL51140.1|2123038_2124253_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
>prophage 163
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2139500	2161568	5288751	tRNA	Bacillus_phage(25.0%)	20	NA	NA
AWL51153.1|2139500_2140754_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
AWL51154.1|2140772_2141039_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51155.1|2141079_2142270_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AWL51156.1|2142344_2142683_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AWL51157.1|2142748_2144086_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AWL51158.1|2144072_2144780_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AWL51159.1|2144788_2146210_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	4.1e-13
AWL51160.1|2146800_2150688_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AWL51161.1|2150862_2152479_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AWL51162.1|2152475_2153018_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AWL51163.1|2153047_2153683_-	acid phosphatase AphA	NA	NA	NA	NA	NA
AWL51164.1|2153896_2154745_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AWL51165.1|2154801_2155062_+	4Fe-4S dicluster domain-containing protein	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.9e-17
AWL51166.1|2155074_2155455_-	holo-ACP synthase	NA	NA	NA	NA	NA
AWL51167.1|2155454_2156186_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWL51168.1|2156197_2156935_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWL51169.1|2156946_2157852_-	GTPase Era	NA	NA	NA	NA	NA
AWL51170.1|2157848_2158529_-	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AWL51171.1|2158778_2159753_-	signal peptidase I	NA	NA	NA	NA	NA
AWL51172.1|2159768_2161568_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
>prophage 164
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2166468	2261293	5288751	tail,transposase,portal,integrase,tRNA,head,plate,capsid,lysis	Salmonella_phage(67.92%)	104	2211104:2211150	2246278:2246324
AWL51178.1|2166468_2167206_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWL51179.1|2167337_2168663_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AWL51180.1|2168708_2169092_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AWL51181.1|2169404_2170094_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AWL51182.1|2170151_2171237_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWL51183.1|2171440_2171866_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	2.7e-13
AWL51184.1|2171935_2172634_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWL51185.1|2172668_2175320_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWL51186.1|2175440_2176796_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWL51187.1|2176837_2177161_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51188.1|2177164_2178463_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
AWL51189.1|2184376_2186950_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AWL51190.1|2187079_2187811_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWL51191.1|2187807_2188788_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWL51192.1|2188919_2189657_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWL51193.1|2189927_2190263_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AWL54127.1|2190369_2190417_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51194.1|2190517_2191678_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWL51195.1|2191674_2192547_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AWL51196.1|2192609_2193731_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWL51197.1|2193740_2194811_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AWL51198.1|2195153_2195663_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWL51199.1|2195655_2196879_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWL51200.1|2196892_2197375_+	OmpA family protein	NA	NA	NA	NA	NA
AWL51201.1|2197383_2198754_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWL51202.1|2198810_2199269_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AWL51203.1|2199388_2199736_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWL51204.1|2199775_2200543_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWL51205.1|2200574_2201123_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWL51206.1|2201141_2201390_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWL51207.1|2201649_2203014_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWL51208.1|2203177_2203969_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWL51209.1|2203988_2205275_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWL51210.1|2205394_2205985_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWL51211.1|2206109_2206988_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWL51212.1|2207074_2208736_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWL51213.1|2208883_2209225_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWL51214.1|2209291_2209582_-	RnfH family protein	NA	NA	NA	NA	NA
AWL51215.1|2209571_2210048_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWL51216.1|2210158_2210641_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2211104:2211150	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AWL51217.1|2211244_2211616_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51218.1|2211674_2211893_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	73.6	2.9e-27
AWL51219.1|2211959_2213057_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	4.3e-172
AWL51220.1|2213053_2213539_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	1.2e-57
AWL51221.1|2213535_2216163_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	1.2e-116
AWL51222.1|2216155_2216275_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWL51223.1|2216289_2216589_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
AWL51224.1|2216641_2217157_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWL51225.1|2217166_2218339_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	8.6e-211
AWL51226.1|2218486_2219560_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	51.6	4.9e-35
AWL51227.1|2219569_2220373_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51228.1|2220376_2222491_-	SGNH/GDSL hydrolase family protein	NA	A0A2D1GNM3	Pseudomonas_phage	51.0	7.9e-05
AWL51229.1|2222492_2223095_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.6	1.1e-60
AWL51230.1|2223087_2223996_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	3.4e-106
AWL51231.1|2223982_2224342_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.6	6.8e-50
AWL51232.1|2224338_2224911_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.2	1.1e-75
AWL51233.1|2225004_2225754_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51234.1|2225750_2226200_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	75.2	6.3e-53
AWL51235.1|2226192_2226624_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	79.0	4.6e-61
AWL51236.1|2226719_2227148_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWL51237.1|2227144_2227528_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	1.6e-17
AWL51238.1|2227532_2228042_-	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	2.8e-81
AWL51239.1|2228022_2228238_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AWL51240.1|2228241_2228445_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AWL51241.1|2228444_2228909_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	2.5e-73
AWL51242.1|2229005_2229656_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AWL51243.1|2229659_2230724_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	3.3e-185
AWL51244.1|2230740_2231574_-|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	75.8	3.0e-101
AWL51245.1|2231714_2233478_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
AWL51246.1|2233477_2234506_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	5.1e-175
AWL51247.1|2234543_2235140_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51248.1|2235854_2236049_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51249.1|2236076_2236334_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54128.1|2236409_2236643_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.5e-31
AWL51250.1|2236656_2236845_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	1.4e-25
AWL51251.1|2236987_2238208_+|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWL51252.1|2238341_2240747_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.3	0.0e+00
AWL51253.1|2240727_2241615_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.1	2.0e-111
AWL51254.1|2241611_2241839_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	85.3	2.4e-32
AWL51255.1|2241838_2242072_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	7.8e-31
AWL51256.1|2242139_2242481_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
AWL51257.1|2242444_2242645_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	83.1	1.4e-25
AWL51258.1|2242652_2243162_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	2.9e-78
AWL51259.1|2243194_2243437_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	96.2	1.2e-37
AWL51260.1|2243556_2244189_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	93.3	7.4e-108
AWL51261.1|2244190_2245225_+|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	2.5e-190
AWL51262.1|2245230_2246148_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51263.1|2246525_2247767_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	47.5	1.3e-103
2246278:2246324	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AWL51264.1|2247940_2248663_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51265.1|2248788_2249022_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	46.7	6.0e-07
AWL54129.1|2249513_2250404_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51266.1|2251010_2251739_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
AWL51267.1|2251798_2252476_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AWL54130.1|2252583_2252988_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51268.1|2253042_2253402_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51269.1|2253482_2253695_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51270.1|2253805_2254627_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	34.7	2.9e-40
AWL51271.1|2254705_2255185_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	31.8	1.7e-11
AWL51272.1|2255195_2255429_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51273.1|2255425_2255908_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AWL51274.1|2255921_2256143_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AWL51275.1|2256165_2256525_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AWL51276.1|2257045_2260012_-	restriction endonuclease subunit R	NA	A0A2H4P9W3	Gordonia_phage	24.7	6.7e-10
AWL51277.1|2260312_2261293_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 165
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2277038	2278019	5288751	transposase	Escherichia_phage(100.0%)	1	NA	NA
AWL51286.1|2277038_2278019_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 166
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2283276	2284797	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL51292.1|2283276_2284797_+	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 167
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2306956	2307859	5288751		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL51311.1|2306956_2307859_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 168
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2313040	2318339	5288751		Ralstonia_phage(25.0%)	5	NA	NA
AWL51318.1|2313040_2313286_+	NrdH-redoxin	NA	A0A0K2QRD6	Ralstonia_phage	36.5	1.6e-05
AWL51319.1|2313282_2313693_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AWL51320.1|2313665_2315807_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.9	2.1e-191
AWL51321.1|2315817_2316780_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
AWL51322.1|2317136_2318339_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	9.3e-27
>prophage 169
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2333054	2341259	5288751	tRNA	Vibrio_phage(20.0%)	9	NA	NA
AWL51337.1|2333054_2333240_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AWL51338.1|2333349_2333532_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51339.1|2333603_2336231_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
AWL51340.1|2336481_2336982_-	recombination regulator RecX	NA	NA	NA	NA	NA
AWL51341.1|2337049_2338108_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
AWL51342.1|2338198_2338696_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.3e-30
AWL51343.1|2338835_2339714_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL51344.1|2339721_2340585_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AWL51345.1|2340581_2341259_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
>prophage 170
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2347043	2348009	5288751		Tetraselmis_virus(100.0%)	1	NA	NA
AWL51354.1|2347043_2348009_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 171
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2374949	2376350	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL51381.1|2374949_2376350_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	4.0e-45
>prophage 172
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2386715	2387537	5288751		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL51392.1|2386715_2387537_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.0	7.3e-15
>prophage 173
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2399280	2400060	5288751		Cedratvirus(100.0%)	1	NA	NA
AWL51403.1|2399280_2400060_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	9.3e-12
>prophage 174
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2408698	2417600	5288751	transposase,integrase	Staphylococcus_phage(20.0%)	6	2396591:2396606	2420997:2421012
2396591:2396606	attL	CGCCTGAGCGATGACG	NA	NA	NA	NA
AWL51408.1|2408698_2409809_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	1.3e-06
AWL51409.1|2411047_2411563_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	47.9	3.8e-38
AWL51410.1|2411690_2412674_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	22.9	6.7e-07
AWL51411.1|2412832_2413417_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51412.1|2413428_2414886_-|integrase	integrase	integrase	A0A0R6PGY7	Moraxella_phage	28.1	5.8e-23
AWL54139.1|2415032_2417600_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	5.1e-30
2420997:2421012	attR	CGCCTGAGCGATGACG	NA	NA	NA	NA
>prophage 175
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2421067	2427486	5288751		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AWL51417.1|2421067_2421955_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	1.1e-05
AWL51418.1|2422063_2423266_+	MFS transporter	NA	NA	NA	NA	NA
AWL51419.1|2423262_2423640_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AWL51420.1|2423692_2424685_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AWL51421.1|2424842_2425979_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
AWL51422.1|2426104_2426731_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
AWL51423.1|2426724_2427486_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
>prophage 176
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2430556	2432589	5288751		Tupanvirus(50.0%)	2	NA	NA
AWL51429.1|2430556_2431162_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
AWL51430.1|2431161_2432589_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.9	1.4e-34
>prophage 177
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2441355	2446692	5288751		Vibrio_phage(33.33%)	4	NA	NA
AWL51437.1|2441355_2442027_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	2.5e-13
AWL51438.1|2442501_2443611_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AWL51439.1|2443674_2444973_-	enolase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AWL51440.1|2445054_2446692_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
>prophage 178
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2450234	2455700	5288751		Erysipelothrix_phage(33.33%)	3	NA	NA
AWL51443.1|2450234_2451539_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	3.8e-34
AWL51444.1|2451652_2454403_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
AWL51445.1|2454560_2455700_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
>prophage 179
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2463114	2463960	5288751		Vibrio_phage(100.0%)	1	NA	NA
AWL51453.1|2463114_2463960_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	2.5e-42
>prophage 180
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2474215	2475238	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL51463.1|2474215_2475238_-	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
>prophage 181
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2481642	2482398	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL51468.1|2481642_2482398_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.0e-10
>prophage 182
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2493931	2496432	5288751	tRNA	environmental_halophage(50.0%)	3	NA	NA
AWL51479.1|2493931_2495137_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
AWL51480.1|2495136_2495568_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AWL51481.1|2495610_2496432_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
>prophage 183
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2501376	2502201	5288751		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWL51486.1|2501376_2502201_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	9.6e-07
>prophage 184
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2534854	2546533	5288751		Deep-sea_thermophilic_phage(25.0%)	6	NA	NA
AWL51526.1|2534854_2536108_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
AWL51527.1|2536335_2537667_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AWL51528.1|2537896_2538217_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51529.1|2538273_2540118_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.8	9.0e-21
AWL51530.1|2540114_2543651_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
AWL51531.1|2543647_2546533_-	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.8	5.3e-44
>prophage 185
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2552047	2563966	5288751		Cronobacter_phage(25.0%)	10	NA	NA
AWL51536.1|2552047_2552842_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	3.1e-119
AWL51537.1|2552848_2553724_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AWL51538.1|2553969_2556216_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
AWL51539.1|2556228_2556759_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AWL51540.1|2557441_2558137_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AWL51541.1|2558200_2558914_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
AWL51542.1|2559037_2559256_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AWL51543.1|2559476_2560517_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AWL51544.1|2560620_2561814_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AWL51545.1|2561806_2563966_-	bifunctional 2-acylglycerophosphoethanolamine acyltransferase/acyl-ACP synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
>prophage 186
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2569944	2570955	5288751		Enterobacteria_phage(100.0%)	1	NA	NA
AWL51553.1|2569944_2570955_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 187
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2576668	2577796	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL51560.1|2576668_2577796_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 188
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2583559	2587030	5288751		Enterobacteria_phage(33.33%)	3	NA	NA
AWL51564.1|2583559_2584555_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.8e-13
AWL51565.1|2584551_2585973_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
AWL51566.1|2586268_2587030_-	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
>prophage 189
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2607627	2609305	5288751	integrase	Escherichia_phage(100.0%)	2	2605493:2605507	2615280:2615294
2605493:2605507	attL	CGGCACCACGCTGAA	NA	NA	NA	NA
AWL51587.1|2607627_2608233_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
AWL51588.1|2608696_2609305_+	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	50.7	2.6e-49
2615280:2615294	attR	CGGCACCACGCTGAA	NA	NA	NA	NA
>prophage 190
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2623978	2628108	5288751		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AWL51601.1|2623978_2625532_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	56.9	3.6e-156
AWL51602.1|2626003_2626426_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.0	1.7e-44
AWL51603.1|2626435_2627728_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.2	7.9e-165
AWL51604.1|2627778_2628108_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
>prophage 191
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2631605	2632625	5288751		Klosneuvirus(100.0%)	1	NA	NA
AWL51611.1|2631605_2632625_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 192
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2636594	2644496	5288751	tRNA	Clostridium_phage(20.0%)	8	NA	NA
AWL51615.1|2636594_2637308_-	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	35.0	1.5e-11
AWL51616.1|2637358_2637547_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51617.1|2637624_2638179_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AWL51618.1|2638413_2639931_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	6.6e-86
AWL51619.1|2639940_2641039_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AWL51620.1|2641124_2642858_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	6.4e-61
AWL51621.1|2642863_2643577_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AWL51622.1|2643599_2644496_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
>prophage 193
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2649192	2650626	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL51630.1|2649192_2650626_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.6	7.9e-33
>prophage 194
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2655201	2658075	5288751		Prochlorococcus_phage(100.0%)	1	NA	NA
AWL51636.1|2655201_2658075_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.6	5.7e-264
>prophage 195
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2666018	2667251	5288751		Catovirus(100.0%)	1	NA	NA
AWL51645.1|2666018_2667251_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	3.1e-102
>prophage 196
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2684503	2685298	5288751		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AWL51660.1|2684503_2685298_-	short chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.7	1.4e-07
>prophage 197
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2699054	2700209	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL51676.1|2699054_2700209_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 198
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2715078	2716161	5288751		Geobacillus_virus(100.0%)	1	NA	NA
AWL51696.1|2715078_2716161_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 199
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2721503	2722874	5288751		Lactococcus_phage(100.0%)	1	NA	NA
AWL54149.1|2721503_2722874_+	CBS domain-containing protein	NA	A0A1W6JHY1	Lactococcus_phage	36.7	1.9e-44
>prophage 200
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2742582	2752485	5288751		Staphylococcus_phage(25.0%)	8	NA	NA
AWL51721.1|2742582_2743410_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
AWL51722.1|2743445_2743973_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWL51723.1|2744030_2746214_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
AWL51724.1|2746337_2747750_-	cell division protein FtsP	NA	NA	NA	NA	NA
AWL51725.1|2747833_2748571_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AWL51726.1|2748762_2751021_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
AWL51727.1|2751142_2752012_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWL51728.1|2752089_2752485_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
>prophage 201
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2755796	2757692	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL51733.1|2755796_2757692_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 202
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2762037	2768918	5288751		Erwinia_phage(25.0%)	9	NA	NA
AWL51739.1|2762037_2762709_+	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	48.3	9.7e-42
AWL51740.1|2762714_2763875_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.1e-88
AWL51741.1|2763919_2764711_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AWL51742.1|2764897_2765668_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AWL51743.1|2765729_2766383_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
AWL51744.1|2766760_2767033_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51745.1|2767068_2767266_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AWL51746.1|2767257_2767449_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51747.1|2767484_2768918_-	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	1.5e-39
>prophage 203
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2774029	2775271	5288751	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AWL51750.1|2774029_2775271_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	4.0e-89
>prophage 204
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2784564	2789948	5288751	tRNA	Moraxella_phage(33.33%)	5	NA	NA
AWL51763.1|2784564_2785578_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
AWL51764.1|2785586_2785817_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51765.1|2785815_2786031_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AWL51766.1|2786142_2787888_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AWL51767.1|2788106_2789948_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
>prophage 205
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2795005	2804191	5288751	transposase	Escherichia_phage(40.0%)	8	NA	NA
AWL51772.1|2795005_2795710_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL51773.1|2796748_2797405_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AWL51774.1|2798184_2799780_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	98.9	1.3e-95
AWL51775.1|2799859_2800735_-	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
AWL51776.1|2800984_2802247_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWL51777.1|2802432_2803002_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AWL51778.1|2803028_2803334_+	acid-resistance protein	NA	NA	NA	NA	NA
AWL51779.1|2803387_2804191_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
>prophage 206
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2822269	2823649	5288751		Klosneuvirus(100.0%)	1	NA	NA
AWL51796.1|2822269_2823649_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 207
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2827920	2829408	5288751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL51802.1|2827920_2829408_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	27.3	1.1e-08
>prophage 208
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2838969	2839941	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL51811.1|2838969_2839941_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.4	8.9e-36
>prophage 209
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2856849	2857995	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL51831.1|2856849_2857995_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.2	9.7e-50
>prophage 210
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2863269	2871145	5288751		Streptococcus_phage(25.0%)	10	NA	NA
AWL51836.1|2863269_2864133_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
AWL51837.1|2864196_2866305_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AWL51838.1|2866262_2866649_+	YraN family protein	NA	NA	NA	NA	NA
AWL51839.1|2866674_2867265_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AWL51840.1|2867274_2867850_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AWL51841.1|2867971_2869012_-	permease	NA	NA	NA	NA	NA
AWL51842.1|2869087_2869735_-	hypothetical protein	NA	NA	NA	NA	NA
AWL51843.1|2869863_2870400_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	9.3e-11
AWL51844.1|2870361_2870805_-	hypothetical protein	NA	NA	NA	NA	NA
AWL54154.1|2870860_2871145_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
>prophage 211
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2888020	2889952	5288751		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWL51864.1|2888020_2889952_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 212
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2895366	2901985	5288751		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AWL51872.1|2895366_2898057_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
AWL51873.1|2898081_2899569_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AWL51874.1|2899596_2900049_-	ribosome maturation factor	NA	NA	NA	NA	NA
AWL51875.1|2900641_2901985_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 213
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2906249	2909126	5288751	protease	Pandoravirus(50.0%)	2	NA	NA
AWL51881.1|2906249_2907098_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
AWL51882.1|2907191_2909126_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
>prophage 214
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2915724	2917166	5288751		Indivirus(50.0%)	2	NA	NA
AWL51891.1|2915724_2916696_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
AWL51892.1|2916893_2917166_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
>prophage 215
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2921215	2934146	5288751		Bacillus_virus(16.67%)	16	NA	NA
AWL51899.1|2921215_2922028_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
AWL51900.1|2922019_2922223_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51901.1|2922237_2923215_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AWL51902.1|2923229_2924216_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
AWL51903.1|2924230_2924797_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
AWL51904.1|2924793_2925369_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AWL51905.1|2925337_2925883_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AWL51906.1|2925889_2926615_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AWL51907.1|2926662_2928096_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AWL51908.1|2928118_2928406_+	hypothetical protein	NA	NA	NA	NA	NA
AWL51909.1|2928476_2928965_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AWL51910.1|2929010_2929865_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AWL51911.1|2929861_2930134_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AWL51912.1|2930197_2930923_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AWL51913.1|2930919_2931573_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AWL51914.1|2931806_2934146_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
>prophage 216
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2938090	2939023	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL51918.1|2938090_2939023_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 217
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2946468	2946963	5288751	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AWL51922.1|2946468_2946963_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 218
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2950908	2952276	5288751	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWL51928.1|2950908_2952276_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 219
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2969985	2971029	5288751		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AWL51945.1|2969985_2971029_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 220
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	2998567	3000039	5288751	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AWL51969.1|2998567_2999077_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
AWL51970.1|2999091_3000039_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 221
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3019942	3023311	5288751		Tupanvirus(50.0%)	2	NA	NA
AWL52007.1|3019942_3021127_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AWL52008.1|3021196_3023311_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
>prophage 222
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3031156	3040800	5288751		Tupanvirus(25.0%)	11	NA	NA
AWL52021.1|3031156_3033061_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	8.5e-75
AWL54159.1|3033123_3033324_-	hypothetical protein	NA	NA	NA	NA	NA
AWL52022.1|3033264_3034287_+	hydrolase	NA	NA	NA	NA	NA
AWL52023.1|3034283_3034502_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AWL52024.1|3034538_3035408_+	phosphoribulokinase	NA	NA	NA	NA	NA
AWL52025.1|3035462_3035867_-	OsmC family protein	NA	NA	NA	NA	NA
AWL54160.1|3035826_3036015_+	hypothetical protein	NA	NA	NA	NA	NA
AWL52026.1|3036173_3036806_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AWL52027.1|3036857_3038936_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
AWL52028.1|3038925_3040146_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AWL52029.1|3040236_3040800_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	1.1e-57
>prophage 223
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3052201	3053029	5288751		Vibrio_phage(100.0%)	1	NA	NA
AWL52041.1|3052201_3053029_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 224
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3067852	3071624	5288751		Bacillus_phage(66.67%)	3	NA	NA
AWL52056.1|3067852_3069475_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.3	1.0e-140
AWL52057.1|3069552_3070908_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
AWL52058.1|3070904_3071624_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 225
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3084449	3086840	5288751		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AWL52070.1|3084449_3086840_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 226
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3090185	3090944	5288751		Escherichia_phage(100.0%)	1	NA	NA
AWL52073.1|3090185_3090944_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 227
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3094801	3097249	5288751		Dickeya_phage(100.0%)	1	NA	NA
AWL52079.1|3094801_3097249_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 228
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3114994	3116802	5288751		Enterococcus_phage(50.0%)	2	NA	NA
AWL52095.1|3114994_3115735_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
AWL52096.1|3115731_3116802_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 229
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3120228	3122461	5288751		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
AWL52100.1|3120228_3120597_-	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	2.0e-09
AWL52101.1|3120593_3120815_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AWL52102.1|3120978_3121692_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
AWL52103.1|3121693_3122461_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
>prophage 230
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3129780	3135581	5288751		Klosneuvirus(25.0%)	5	NA	NA
AWL52111.1|3129780_3131046_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.0e-23
AWL52112.1|3131164_3132688_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
AWL52113.1|3132740_3133595_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AWL52114.1|3133864_3134920_-	cell division protein FtsX	NA	NA	NA	NA	NA
AWL52115.1|3134912_3135581_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
>prophage 231
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3138665	3142802	5288751		Dickeya_phage(50.0%)	4	NA	NA
AWL52120.1|3138665_3139292_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.1e-30
AWL52121.1|3139370_3141581_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.4e-113
AWL52122.1|3141684_3141930_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	8.0e-10
AWL52123.1|3142136_3142802_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
>prophage 232
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3149102	3153209	5288751		Tupanvirus(66.67%)	3	NA	NA
AWL52131.1|3149102_3151088_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
AWL52132.1|3151084_3152068_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
AWL52133.1|3152069_3153209_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.1	4.7e-28
>prophage 233
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3159311	3160103	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL52140.1|3159311_3160103_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	27.8	5.0e-13
>prophage 234
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3168626	3170669	5288751		Indivirus(100.0%)	1	NA	NA
AWL52149.1|3168626_3170669_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 235
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3214402	3220375	5288751		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AWL52178.1|3214402_3216514_-	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
AWL52179.1|3216533_3217337_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AWL52180.1|3217327_3217867_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AWL52181.1|3218183_3218363_-	hypothetical protein	NA	NA	NA	NA	NA
AWL52182.1|3218381_3219395_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AWL52183.1|3219391_3220375_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
>prophage 236
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3231433	3234173	5288751		Streptococcus_phage(50.0%)	2	NA	NA
AWL52192.1|3231433_3231874_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.3e-15
AWL52193.1|3231842_3234173_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	9.8e-65
>prophage 237
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3239332	3240304	5288751		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWL52199.1|3239332_3240304_+	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 238
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3243707	3245638	5288751		Morganella_phage(50.0%)	2	NA	NA
AWL52204.1|3243707_3243920_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AWL52205.1|3244018_3245638_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	25.4	1.5e-24
>prophage 239
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3250014	3251010	5288751		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AWL52210.1|3250014_3251010_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	1.6e-08
>prophage 240
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3256478	3258020	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL52216.1|3256478_3258020_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 241
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3265994	3267836	5288751	tRNA	Tupanvirus(100.0%)	1	NA	NA
AWL52225.1|3265994_3267836_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 242
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3283696	3292857	5288751		Rhizobium_phage(20.0%)	9	NA	NA
AWL52242.1|3283696_3283948_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
AWL52243.1|3284052_3284484_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AWL52244.1|3284729_3286274_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AWL52245.1|3286283_3287555_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
AWL52246.1|3287558_3288515_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AWL52247.1|3288520_3289309_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AWL52248.1|3289479_3290505_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
AWL52249.1|3290517_3291711_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
AWL52250.1|3291924_3292857_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
>prophage 243
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3305625	3310368	5288751		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AWL52261.1|3305625_3306105_+	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
AWL52262.1|3306293_3307103_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.2e-24
AWL52263.1|3307238_3307406_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AWL52264.1|3307426_3307663_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AWL52265.1|3307879_3308545_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AWL54170.1|3308717_3309932_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.5	8.5e-44
AWL54169.1|3309912_3310368_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
>prophage 244
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3315007	3315925	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL52270.1|3315007_3315925_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	1.3e-23
>prophage 245
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3320967	3329258	5288751		Acanthamoeba_polyphaga_mimivirus(25.0%)	7	NA	NA
AWL52275.1|3320967_3322026_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	4.8e-19
AWL52276.1|3322081_3323332_-	chloride channel protein	NA	NA	NA	NA	NA
AWL52277.1|3323607_3324225_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AWL52278.1|3324230_3325907_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.6	5.6e-22
AWL52279.1|3326165_3326789_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AWL52280.1|3326843_3327119_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AWL52281.1|3327137_3329258_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 246
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3340239	3341091	5288751		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AWL52293.1|3340239_3341091_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 247
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3344225	3345617	5288751		environmental_Halophage(100.0%)	1	NA	NA
AWL52296.1|3344225_3345617_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 248
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3358873	3359923	5288751		Tupanvirus(100.0%)	1	NA	NA
AWL52307.1|3358873_3359923_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 249
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3376932	3378096	5288751		Salmonella_phage(100.0%)	1	NA	NA
AWL52324.1|3376932_3378096_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.9	4.5e-26
>prophage 250
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3396351	3397464	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL52342.1|3396351_3397464_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 251
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3403689	3411939	5288751	transposase	Escherichia_phage(60.0%)	7	NA	NA
AWL52350.1|3403689_3404394_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL52351.1|3404370_3404661_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AWL52352.1|3404697_3405402_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL52353.1|3406440_3407097_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AWL52354.1|3407876_3409472_-	hypothetical protein	NA	Q9MCT5	Escherichia_phage	98.9	1.3e-95
AWL52355.1|3409551_3410427_-	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
AWL52356.1|3410676_3411939_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 252
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3419576	3425016	5288751		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
AWL52365.1|3419576_3421265_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
AWL52366.1|3421369_3421465_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AWL52367.1|3422127_3422217_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AWL52368.1|3422307_3422754_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL52369.1|3422822_3423656_+	EamA family transporter	NA	NA	NA	NA	NA
AWL52370.1|3423831_3425016_+	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
>prophage 253
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3436987	3437946	5288751		Lake_Baikal_phage(50.0%)	2	NA	NA
AWL52381.1|3436987_3437416_-	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
AWL52382.1|3437532_3437946_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 254
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3441387	3442536	5288751		Oenococcus_phage(100.0%)	1	NA	NA
AWL52386.1|3441387_3442536_-	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 255
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3448303	3455894	5288751		Bacillus_virus(33.33%)	7	NA	NA
AWL52393.1|3448303_3450718_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
AWL52394.1|3450746_3451820_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AWL52395.1|3452027_3453128_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
AWL52396.1|3453132_3454536_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AWL52397.1|3455157_3455298_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AWL52398.1|3455313_3455673_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AWL52399.1|3455636_3455894_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 256
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3463396	3464734	5288751		Moraxella_phage(100.0%)	1	NA	NA
AWL52407.1|3463396_3464734_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 257
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3470509	3478069	5288751		Bacillus_phage(25.0%)	6	NA	NA
AWL52414.1|3470509_3471283_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
AWL52415.1|3471330_3472221_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AWL52416.1|3472220_3473180_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AWL52417.1|3473308_3474349_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AWL52418.1|3474685_3476515_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
AWL52419.1|3476698_3478069_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
>prophage 258
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3490420	3491413	5288751		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AWL52433.1|3490420_3491413_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 259
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3494578	3500457	5288751		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AWL52436.1|3494578_3496447_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
AWL52437.1|3496632_3497052_+	D-ribose pyranase	NA	NA	NA	NA	NA
AWL52438.1|3497062_3498568_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	4.0e-19
AWL52439.1|3498573_3499539_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AWL52440.1|3499566_3500457_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
>prophage 260
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3515015	3517808	5288751		uncultured_virus(100.0%)	1	NA	NA
AWL52451.1|3515015_3517808_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	8.4e-71
>prophage 261
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3521696	3524164	5288751		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AWL52456.1|3521696_3523106_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
AWL52457.1|3523114_3524164_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
>prophage 262
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3530986	3531904	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL52464.1|3530986_3531904_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	29.2	6.0e-18
>prophage 263
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3549655	3551167	5288751		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AWL52483.1|3549655_3551167_-	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 264
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3559505	3563009	5288751		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
AWL52492.1|3559505_3560126_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
AWL52493.1|3560198_3560873_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AWL52494.1|3560940_3562314_-	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AWL52495.1|3562310_3563009_-	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 265
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3567511	3568846	5288751		Erwinia_phage(100.0%)	1	NA	NA
AWL52500.1|3567511_3568846_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 266
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3586238	3586901	5288751		Cyanophage(100.0%)	1	NA	NA
AWL52516.1|3586238_3586901_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
>prophage 267
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3601531	3603370	5288751		Acinetobacter_phage(100.0%)	1	NA	NA
AWL52529.1|3601531_3603370_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 268
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3613435	3615082	5288751		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL52535.1|3613435_3615082_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 269
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3623185	3625207	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL52544.1|3623185_3625207_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.1e-112
>prophage 270
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3629698	3631635	5288751		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AWL52550.1|3629698_3630964_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
AWL52551.1|3631305_3631635_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
>prophage 271
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3635685	3641827	5288751		Catovirus(20.0%)	6	NA	NA
AWL52556.1|3635685_3636816_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
AWL52557.1|3636812_3638075_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	3.8e-23
AWL52558.1|3638071_3639139_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.3	8.1e-99
AWL52559.1|3639157_3640039_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	6.0e-108
AWL52560.1|3640016_3640691_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AWL52561.1|3640696_3641827_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
>prophage 272
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3658194	3662039	5288751		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AWL52576.1|3658194_3659097_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	7.7e-18
AWL52577.1|3659096_3659813_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AWL52578.1|3659876_3662039_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 273
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3665875	3669337	5288751	transposase	Catovirus(50.0%)	3	NA	NA
AWL52584.1|3665875_3667702_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	4.3e-84
AWL52585.1|3667763_3668384_+	threonine export protein RhtC	NA	NA	NA	NA	NA
AWL52586.1|3668428_3669337_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	6.3e-68
>prophage 274
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3681338	3684682	5288751		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AWL52598.1|3681338_3682979_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
AWL52599.1|3683108_3683360_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AWL52600.1|3683363_3683900_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AWL52601.1|3683902_3684682_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
>prophage 275
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3693399	3694014	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL52609.1|3693399_3694014_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 276
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3703950	3707071	5288751		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWL52615.1|3703950_3704901_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
AWL52616.1|3705886_3707071_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 277
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3711232	3723613	5288751		Chrysochromulina_ericina_virus(33.33%)	6	NA	NA
AWL52625.1|3711232_3715261_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
AWL52626.1|3715337_3719561_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
AWL52627.1|3719961_3721302_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AWL52628.1|3721344_3721662_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AWL52629.1|3721665_3721971_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AWL54180.1|3722143_3723613_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.1e-12
>prophage 278
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3732101	3733865	5288751		Klosneuvirus(50.0%)	3	NA	NA
AWL52640.1|3732101_3732773_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
AWL52641.1|3732815_3733406_+	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AWL52642.1|3733592_3733865_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
>prophage 279
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3739286	3740876	5288751		Prochlorococcus_phage(100.0%)	1	NA	NA
AWL52647.1|3739286_3740876_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.0	1.8e-70
>prophage 280
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3754517	3758201	5288751		Dickeya_phage(100.0%)	1	NA	NA
AWL52655.1|3754517_3758201_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 281
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3764769	3765573	5288751		Moumouvirus(100.0%)	1	NA	NA
AWL52663.1|3764769_3765573_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	24.0	2.3e-05
>prophage 282
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3782082	3783192	5288751		Mycoplasma_phage(100.0%)	1	NA	NA
AWL52679.1|3782082_3783192_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 283
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3790258	3790867	5288751		Lactococcus_phage(100.0%)	1	NA	NA
AWL52686.1|3790258_3790867_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 284
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3796869	3799396	5288751		Escherichia_phage(50.0%)	2	NA	NA
AWL52694.1|3796869_3798285_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.8	5.7e-201
AWL52695.1|3798316_3799396_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.4	1.9e-26
>prophage 285
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3802577	3807881	5288751		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AWL52700.1|3802577_3805403_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
AWL52701.1|3805654_3806179_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AWL52702.1|3806300_3807881_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
>prophage 286
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3819860	3820892	5288751		Mycoplasma_phage(100.0%)	1	NA	NA
AWL54186.1|3819860_3820892_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 287
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3828421	3829771	5288751		Moraxella_phage(100.0%)	1	NA	NA
AWL52721.1|3828421_3829771_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 288
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3842053	3848838	5288751		Staphylococcus_phage(50.0%)	5	NA	NA
AWL52733.1|3842053_3844012_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
AWL52734.1|3844112_3844313_+	hypothetical protein	NA	NA	NA	NA	NA
AWL52735.1|3844424_3845738_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AWL52736.1|3845774_3846461_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AWL52737.1|3846690_3848838_-	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 289
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3854778	3856299	5288751		Pithovirus(100.0%)	1	NA	NA
AWL52743.1|3854778_3856299_-	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 290
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3861679	3863226	5288751		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AWL52749.1|3861679_3862360_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	6.7e-06
AWL52750.1|3862467_3863226_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.1	2.3e-15
>prophage 291
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3868586	3870089	5288751		Burkholderia_virus(100.0%)	1	NA	NA
AWL52758.1|3868586_3870089_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 292
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3874453	3878963	5288751		Escherichia_phage(50.0%)	5	NA	NA
AWL52763.1|3874453_3875410_+	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.6e-143
AWL52764.1|3875419_3875791_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	52.8	3.6e-22
AWL52765.1|3876911_3877217_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
AWL52766.1|3877216_3878134_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AWL52767.1|3878279_3878963_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
>prophage 293
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3899231	3904879	5288751		Cronobacter_phage(33.33%)	5	NA	NA
AWL52781.1|3899231_3899525_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
AWL52782.1|3899562_3901209_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AWL52783.1|3901469_3901823_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AWL52784.1|3901877_3902741_-	hypothetical protein	NA	NA	NA	NA	NA
AWL52785.1|3902755_3904879_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	9.6e-27
>prophage 294
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3915725	3920919	5288751		Morganella_phage(33.33%)	6	NA	NA
AWL52797.1|3915725_3916259_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	50.0	5.0e-41
AWL52798.1|3916372_3916732_-	fumarate reductase subunit D	NA	NA	NA	NA	NA
AWL52799.1|3916742_3917138_-	fumarate reductase subunit C	NA	NA	NA	NA	NA
AWL52800.1|3917148_3917883_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AWL52801.1|3917875_3919666_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
AWL52802.1|3919941_3920919_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
>prophage 295
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3928273	3928819	5288751		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AWL52808.1|3928273_3928819_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 296
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3933661	3936887	5288751		Vibrio_phage(50.0%)	2	NA	NA
AWL52814.1|3933661_3935017_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.8e-18
AWL52815.1|3935027_3936887_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
>prophage 297
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3942817	3947161	5288751		Pithovirus(50.0%)	3	NA	NA
AWL52823.1|3942817_3944116_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
AWL52824.1|3944266_3944692_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL52825.1|3944728_3947161_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.9e-66
>prophage 298
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3966758	3967583	5288751		Bordetella_phage(100.0%)	1	NA	NA
AWL52850.1|3966758_3967583_-	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.9e-07
>prophage 299
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	3984083	3990662	5288751		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
AWL52864.1|3984083_3984614_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
AWL52865.1|3985017_3985974_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL52866.1|3986097_3987600_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AWL52867.1|3987610_3988636_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL52868.1|3988622_3989621_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AWL52869.1|3989663_3990662_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
>prophage 300
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4006796	4009928	5288751		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
AWL52887.1|4006796_4007081_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	2.4e-26
AWL52888.1|4007084_4007549_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
AWL52889.1|4007789_4009928_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
>prophage 301
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4017685	4023743	5288751		Enterobacteria_phage(33.33%)	6	NA	NA
AWL52895.1|4017685_4018633_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	8.7e-12
AWL54195.1|4018669_4018867_+	hypothetical protein	NA	NA	NA	NA	NA
AWL52896.1|4019012_4021721_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
AWL52897.1|4021793_4022180_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AWL52898.1|4022332_4022794_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AWL52899.1|4022807_4023743_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
>prophage 302
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4033836	4042886	5288751	tRNA	Klosneuvirus(33.33%)	7	NA	NA
AWL52911.1|4033836_4036692_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	6.0e-141
AWL52912.1|4036691_4037135_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AWL52913.1|4037254_4038766_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AWL52914.1|4039046_4039166_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWL52915.1|4039155_4040253_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AWL52916.1|4040252_4041335_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AWL52917.1|4041383_4042886_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
>prophage 303
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4057164	4061990	5288751		Planktothrix_phage(50.0%)	5	NA	NA
AWL52928.1|4057164_4058238_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
AWL52929.1|4058243_4059068_-	phosphodiesterase	NA	NA	NA	NA	NA
AWL52930.1|4059078_4059966_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AWL54198.1|4059955_4060828_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AWL52931.1|4060970_4061990_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
>prophage 304
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4065104	4066358	5288751		Stenotrophomonas_phage(100.0%)	1	NA	NA
AWL52934.1|4065104_4066358_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.2	9.6e-75
>prophage 305
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4069687	4075526	5288751		Enterobacteria_phage(100.0%)	7	NA	NA
AWL52937.1|4069687_4070254_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-58
AWL52938.1|4070271_4070517_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AWL52939.1|4070570_4071251_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	58.2	1.7e-62
AWL52940.1|4072073_4072631_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	63.9	8.7e-28
AWL52941.1|4072627_4072855_+	hypothetical protein	NA	NA	NA	NA	NA
AWL52942.1|4072851_4073172_+	hypothetical protein	NA	NA	NA	NA	NA
AWL52943.1|4073183_4075526_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
>prophage 306
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4099523	4104481	5288751		Enterobacteria_phage(33.33%)	4	NA	NA
AWL52964.1|4099523_4100252_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
AWL52965.1|4100368_4100902_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AWL52966.1|4100911_4101259_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AWL52967.1|4101331_4104481_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	3.7e-59
>prophage 307
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4107717	4109824	5288751		Bacillus_phage(50.0%)	2	NA	NA
AWL52970.1|4107717_4108401_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
AWL52971.1|4108390_4109824_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	28.0	1.2e-12
>prophage 308
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4119589	4122334	5288751		Staphylococcus_phage(100.0%)	1	NA	NA
AWL52978.1|4119589_4122334_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	3.5e-21
>prophage 309
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4143321	4144224	5288751	transposase	Sodalis_phage(100.0%)	1	NA	NA
AWL53000.1|4143321_4144224_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.3	1.6e-71
>prophage 310
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4179057	4182225	5288751	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AWL53037.1|4179057_4180119_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.1e-07
AWL53038.1|4180115_4181147_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AWL54202.1|4181286_4182225_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	3.4e-69
>prophage 311
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4185384	4186664	5288751		Shigella_phage(50.0%)	2	NA	NA
AWL53041.1|4185384_4186122_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
AWL53042.1|4186124_4186664_-	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
>prophage 312
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4199886	4202607	5288751		Streptococcus_phage(50.0%)	3	NA	NA
AWL53056.1|4199886_4201476_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
AWL53057.1|4201695_4202316_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AWL53058.1|4202445_4202607_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
>prophage 313
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4207342	4208665	5288751		Geobacillus_virus(100.0%)	1	NA	NA
AWL53062.1|4207342_4208665_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.9	2.0e-78
>prophage 314
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4214996	4220156	5288751		Enterococcus_phage(33.33%)	3	NA	NA
AWL53069.1|4214996_4216229_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
AWL53070.1|4216322_4217990_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
AWL54206.1|4218218_4220156_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
>prophage 315
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4237311	4238265	5288751		Cyanophage(100.0%)	1	NA	NA
AWL53087.1|4237311_4238265_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	3.7e-10
>prophage 316
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4242659	4252612	5288751	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
AWL53093.1|4242659_4244576_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
AWL53094.1|4244663_4245797_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AWL53095.1|4245974_4247150_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	3.2e-88
AWL53096.1|4247204_4248101_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AWL53097.1|4248220_4248484_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AWL54209.1|4248734_4248806_+	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
AWL53098.1|4248813_4249752_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AWL54210.1|4249795_4252612_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 317
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4259178	4260327	5288751		Halovirus(100.0%)	1	NA	NA
AWL53108.1|4259178_4260327_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	9.1e-48
>prophage 318
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4266810	4268391	5288751		Bacillus_phage(50.0%)	3	NA	NA
AWL53113.1|4266810_4267290_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
AWL53114.1|4267389_4267590_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53115.1|4267542_4268391_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
>prophage 319
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4280849	4286301	5288751		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AWL53128.1|4280849_4283756_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
AWL53129.1|4283943_4286301_-	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	5.2e-13
>prophage 320
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4292596	4293298	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL53135.1|4292596_4293298_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	8.1e-23
>prophage 321
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4301997	4302753	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL53143.1|4301997_4302753_-	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 322
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4314152	4315877	5288751		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AWL53154.1|4314152_4315877_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 323
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4342069	4343113	5288751		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AWL53180.1|4342069_4343113_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 324
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4347380	4347944	5288751		Sphingobium_phage(100.0%)	1	NA	NA
AWL53185.1|4347380_4347944_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 325
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4359284	4360709	5288751		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL54212.1|4359284_4360709_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 326
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4372283	4378930	5288751		Mamastrovirus(33.33%)	5	NA	NA
AWL53202.1|4372283_4373882_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	51.1	7.5e-16
AWL53203.1|4373965_4376356_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AWL53204.1|4376560_4377097_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
AWL53205.1|4377156_4377819_-	carbonate dehydratase	NA	NA	NA	NA	NA
AWL53206.1|4378003_4378930_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
>prophage 327
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4384334	4391105	5288751	tRNA	unidentified_phage(50.0%)	6	NA	NA
AWL53214.1|4384334_4385729_-	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
AWL53215.1|4385791_4386673_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AWL53216.1|4386732_4387188_-	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
AWL53217.1|4387350_4388067_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AWL53218.1|4388066_4388603_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AWL53219.1|4388675_4391105_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.5e-39
>prophage 328
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4413261	4414059	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL53237.1|4413261_4414059_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 329
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4420025	4420370	5288751		Lake_Baikal_phage(100.0%)	1	NA	NA
AWL53242.1|4420025_4420370_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.3	1.6e-27
>prophage 330
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4424325	4425759	5288751	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AWL53247.1|4424325_4425759_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.7	3.0e-24
>prophage 331
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4437337	4438096	5288751		Flavobacterium_phage(100.0%)	1	NA	NA
AWL53258.1|4437337_4438096_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 332
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4446927	4451027	5288751		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AWL53267.1|4446927_4447527_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
AWL53268.1|4447544_4451027_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
>prophage 333
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4464010	4465042	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL53282.1|4464010_4465042_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 334
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4471615	4472419	5288751		Indivirus(100.0%)	1	NA	NA
AWL53284.1|4471615_4472419_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	9.2e-39
>prophage 335
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4476484	4480694	5288751		Lactobacillus_phage(33.33%)	5	NA	NA
AWL53288.1|4476484_4477852_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
AWL53289.1|4477923_4478679_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AWL53290.1|4478711_4479434_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWL53291.1|4479430_4479898_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
AWL53292.1|4479962_4480694_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
>prophage 336
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4486202	4486784	5288751		Caulobacter_phage(100.0%)	1	NA	NA
AWL53297.1|4486202_4486784_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 337
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4503957	4505241	5288751		Klosneuvirus(100.0%)	1	NA	NA
AWL53317.1|4503957_4505241_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	8.4e-34
>prophage 338
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4512774	4513770	5288751		Catovirus(100.0%)	1	NA	NA
AWL53324.1|4512774_4513770_-	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 339
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4518418	4519816	5288751		Erysipelothrix_phage(100.0%)	1	NA	NA
AWL53331.1|4518418_4519816_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	2.2e-43
>prophage 340
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4529816	4533526	5288751		Streptococcus_phage(66.67%)	3	NA	NA
AWL53338.1|4529816_4531070_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
AWL53339.1|4531080_4532184_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AWL53340.1|4532473_4533526_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 341
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4539811	4540654	5288751		Brazilian_cedratvirus(100.0%)	1	NA	NA
AWL53349.1|4539811_4540654_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 342
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4549728	4553450	5288751		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
AWL53357.1|4549728_4550547_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	4.1e-34
AWL53358.1|4550548_4551358_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL53359.1|4551692_4551863_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53360.1|4551979_4552675_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
AWL53361.1|4552667_4553450_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	3.3e-09
>prophage 343
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4564453	4565221	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL53371.1|4564453_4565221_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 344
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4585815	4594333	5288751		Bacillus_phage(60.0%)	6	NA	NA
AWL53392.1|4585815_4586727_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
AWL54225.1|4586816_4587731_+	fructokinase	NA	NA	NA	NA	NA
AWL53393.1|4587804_4590942_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
AWL53394.1|4590938_4592144_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
AWL53395.1|4592326_4593016_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
AWL53396.1|4593037_4594333_+	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
>prophage 345
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4611138	4615477	5288751	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AWL53412.1|4611138_4612266_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
AWL53413.1|4612288_4612621_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AWL53414.1|4612647_4614495_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AWL53415.1|4614505_4615477_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
>prophage 346
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4619075	4623735	5288751		Indivirus(33.33%)	6	NA	NA
AWL53421.1|4619075_4620179_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
AWL53422.1|4620266_4620737_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AWL53423.1|4620756_4621176_+	N utilization substance protein B	NA	NA	NA	NA	NA
AWL53424.1|4621247_4622219_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AWL53425.1|4622211_4622715_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AWL53426.1|4622760_4623735_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.5	2.4e-09
>prophage 347
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4636530	4638219	5288751		Lactobacillus_phage(100.0%)	1	NA	NA
AWL53439.1|4636530_4638219_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	2.5e-17
>prophage 348
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4652522	4657691	5288751	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AWL53455.1|4652522_4653146_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
AWL53456.1|4653396_4654671_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AWL53457.1|4654854_4657209_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
AWL53458.1|4657418_4657691_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 349
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4660921	4661623	5288751		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AWL53462.1|4660921_4661623_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 350
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4666050	4669594	5288751		Bacillus_phage(100.0%)	2	NA	NA
AWL53467.1|4666050_4667823_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.1e-47
AWL53468.1|4667815_4669594_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
>prophage 351
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4680499	4681609	5288751		Bacillus_phage(100.0%)	1	NA	NA
AWL53481.1|4680499_4681609_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	32.7	5.4e-13
>prophage 352
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4690783	4700174	5288751		Enterobacteria_phage(33.33%)	10	NA	NA
AWL53489.1|4690783_4691854_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	4.6e-70
AWL53490.1|4691969_4692233_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AWL53491.1|4692232_4692373_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AWL53492.1|4692369_4693068_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWL53493.1|4693168_4694620_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AWL53494.1|4694594_4695065_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53495.1|4695197_4695764_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AWL53496.1|4695922_4696141_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL53497.1|4696167_4696542_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AWL53498.1|4697027_4700174_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
>prophage 353
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4705695	4713518	5288751	transposase	Sodalis_phage(25.0%)	9	NA	NA
AWL53502.1|4705695_4706607_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	4.2e-64
AWL53503.1|4706674_4706848_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AWL53504.1|4706860_4707388_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AWL53505.1|4707457_4707835_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AWL53506.1|4707985_4708537_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AWL53507.1|4708629_4710537_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
AWL53508.1|4710594_4710927_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AWL53509.1|4710926_4711532_+	recombination protein RecR	NA	NA	NA	NA	NA
AWL53510.1|4711643_4713518_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
>prophage 354
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4723637	4728843	5288751		uncultured_virus(50.0%)	5	NA	NA
AWL54227.1|4723637_4726139_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
AWL53519.1|4726245_4726656_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AWL53520.1|4726652_4727111_-	NfeD family protein	NA	NA	NA	NA	NA
AWL53521.1|4727107_4728025_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AWL53522.1|4728165_4728843_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
>prophage 355
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4732025	4732712	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL53527.1|4732025_4732712_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
>prophage 356
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4741257	4743769	5288751	tRNA	Moumouvirus(50.0%)	3	NA	NA
AWL53537.1|4741257_4742643_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AWL53538.1|4742688_4742901_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53539.1|4742902_4743769_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 357
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4755458	4756379	5288751		Morganella_phage(100.0%)	1	NA	NA
AWL53552.1|4755458_4756379_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 358
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4762606	4765931	5288751	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AWL53557.1|4762606_4764082_+	dipeptide permease	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AWL53558.1|4764413_4765931_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
>prophage 359
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4774033	4779835	5288751		Amsacta_moorei_entomopoxvirus(50.0%)	5	NA	NA
AWL53566.1|4774033_4775518_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
AWL53567.1|4775528_4776560_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL53568.1|4776743_4777385_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54228.1|4777400_4778405_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL53569.1|4778434_4779835_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	22.8	8.1e-14
>prophage 360
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4786457	4787255	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL53575.1|4786457_4787255_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 361
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4802558	4803674	5288751		Tupanvirus(100.0%)	1	NA	NA
AWL53589.1|4802558_4803674_+	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 362
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4846595	4849310	5288751		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AWL53627.1|4846595_4849310_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	7.9e-66
>prophage 363
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4858264	4862944	5288751		Streptococcus_phage(50.0%)	5	NA	NA
AWL53634.1|4858264_4859728_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	4.8e-17
AWL53635.1|4859969_4860821_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL53636.1|4860868_4861510_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AWL53637.1|4861524_4862190_+	ABC transporter permease	NA	NA	NA	NA	NA
AWL53638.1|4862182_4862944_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
>prophage 364
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4866022	4867550	5288751		Planktothrix_phage(100.0%)	2	NA	NA
AWL53641.1|4866022_4866727_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	3.9e-25
AWL53642.1|4866713_4867550_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-13
>prophage 365
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4872107	4878021	5288751	holin	Catovirus(50.0%)	5	NA	NA
AWL53647.1|4872107_4873772_-|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
AWL53648.1|4873785_4875258_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWL53649.1|4875271_4875859_-	transcriptional regulator	NA	NA	NA	NA	NA
AWL54232.1|4875775_4875991_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53650.1|4875987_4878021_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
>prophage 366
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4884726	4886271	5288751		Bacillus_virus(100.0%)	1	NA	NA
AWL53658.1|4884726_4886271_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 367
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4897653	4902394	5288751		Tupanvirus(50.0%)	2	NA	NA
AWL53669.1|4897653_4901535_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	27.6	1.2e-54
AWL53670.1|4901599_4902394_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.7	1.5e-09
>prophage 368
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4914738	4919156	5288751		Burkholderia_phage(50.0%)	5	NA	NA
AWL53680.1|4914738_4915143_-	transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	2.3e-06
AWL53681.1|4915117_4915417_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWL53682.1|4915600_4916344_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
AWL53683.1|4916401_4917490_-	oxidoreductase	NA	NA	NA	NA	NA
AWL53684.1|4917653_4919156_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.1e-16
>prophage 369
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4936271	4949986	5288751	tRNA	Cedratvirus(20.0%)	12	NA	NA
AWL53698.1|4936271_4937300_+	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.0	7.2e-28
AWL53699.1|4937342_4938284_-	sugar kinase	NA	NA	NA	NA	NA
AWL53700.1|4938295_4939300_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL53701.1|4939296_4940286_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL53702.1|4940282_4941833_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.5e-16
AWL53703.1|4941829_4942810_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL53704.1|4943218_4945528_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.3	7.9e-83
AWL53705.1|4945635_4946178_-	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
AWL53706.1|4946174_4946864_-	acireductone synthase	NA	NA	NA	NA	NA
AWL53707.1|4946990_4948151_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AWL53708.1|4948151_4948778_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	48.7	3.9e-53
AWL53709.1|4948762_4949986_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.9	3.4e-61
>prophage 370
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4953121	4955192	5288751		Bacillus_virus(50.0%)	2	NA	NA
AWL53713.1|4953121_4954687_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	6.4e-44
AWL53714.1|4954763_4955192_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
>prophage 371
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4959282	4959943	5288751		Morganella_phage(50.0%)	2	NA	NA
AWL53719.1|4959282_4959492_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
AWL53720.1|4959559_4959943_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
>prophage 372
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4964821	4967308	5288751		Stx2-converting_phage(50.0%)	2	NA	NA
AWL53727.1|4964821_4966021_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
AWL53728.1|4966159_4967308_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
>prophage 373
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4974352	4982318	5288751	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
AWL53737.1|4974352_4976935_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	8.0e-185
AWL54238.1|4977161_4977644_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AWL53738.1|4977689_4979483_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.9	1.6e-27
AWL53739.1|4979548_4981219_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AWL53740.1|4981592_4982318_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 374
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4988322	4989369	5288751		Pseudomonas_phage(100.0%)	1	NA	NA
AWL53746.1|4988322_4989369_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 375
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4993409	4995074	5288751		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AWL53750.1|4993409_4995074_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 376
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	4999827	5003629	5288751	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AWL53756.1|4999827_5001783_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
AWL53757.1|5001961_5003629_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.3	0.0e+00
>prophage 377
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5008318	5009092	5288751		Mycobacterium_phage(100.0%)	1	NA	NA
AWL53764.1|5008318_5009092_-	esterase	NA	A0A222ZNA0	Mycobacterium_phage	31.6	2.9e-05
>prophage 378
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5015918	5023348	5288751		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AWL53771.1|5015918_5017967_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.1	2.3e-25
AWL53772.1|5017987_5019667_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AWL53773.1|5019666_5019756_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AWL54240.1|5020065_5020272_+	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AWL53774.1|5020455_5021898_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	5.1e-56
AWL53775.1|5021869_5023348_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.3	6.5e-46
>prophage 379
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5029157	5029949	5288751		Kaumoebavirus(100.0%)	1	NA	NA
AWL53783.1|5029157_5029949_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.6	7.3e-12
>prophage 380
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5054497	5058008	5288751		Vibriophage(33.33%)	4	NA	NA
AWL53804.1|5054497_5055217_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.6	2.0e-24
AWL53805.1|5055213_5056158_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
AWL53806.1|5056275_5056641_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53807.1|5056955_5058008_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	1.2e-81
>prophage 381
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5062369	5068892	5288751		Tupanvirus(33.33%)	7	NA	NA
AWL53811.1|5062369_5063386_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	8.9e-79
AWL53812.1|5063595_5065068_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
AWL53813.1|5065135_5065924_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AWL53814.1|5066076_5066226_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AWL53815.1|5066368_5067142_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL53816.1|5067141_5067831_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AWL54244.1|5067833_5068892_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
>prophage 382
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5073738	5074473	5288751		Enterobacteria_phage(100.0%)	1	NA	NA
AWL53823.1|5073738_5074473_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 383
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5077582	5085438	5288751		Leptospira_phage(33.33%)	4	NA	NA
AWL53828.1|5077582_5080648_-	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	20.6	8.7e-21
AWL53829.1|5080648_5081734_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL53830.1|5082267_5082699_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	41.4	2.9e-23
AWL53831.1|5082750_5085438_+	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.4	4.4e-69
>prophage 384
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5092033	5097658	5288751		Catovirus(50.0%)	5	NA	NA
AWL53837.1|5092033_5093560_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	1.7e-81
AWL53838.1|5093658_5095041_+	amino acid permease	NA	NA	NA	NA	NA
AWL53839.1|5095286_5095556_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53840.1|5095821_5096298_-	kinase inhibitor	NA	NA	NA	NA	NA
AWL53841.1|5096368_5097658_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
>prophage 385
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5101461	5102184	5288751		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWL53846.1|5101461_5102184_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 386
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5108680	5109586	5288751		Streptococcus_phage(100.0%)	1	NA	NA
AWL53855.1|5108680_5109586_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.8	1.7e-28
>prophage 387
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5119753	5121493	5288751		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AWL53870.1|5119753_5121493_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	4.3e-17
>prophage 388
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5126698	5134693	5288751		Micromonas_pusilla_virus(20.0%)	8	NA	NA
AWL53876.1|5126698_5127544_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
AWL53877.1|5127543_5128536_+	transketolase family protein	NA	NA	NA	NA	NA
AWL53878.1|5128750_5130106_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-48
AWL53879.1|5130293_5132462_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	1.5e-43
AWL53880.1|5132491_5133460_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AWL53881.1|5133569_5133830_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWL53882.1|5134115_5134382_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	1.6e-16
AWL53883.1|5134402_5134693_-	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.1e-05
>prophage 389
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5138737	5143889	5288751		Planktothrix_phage(33.33%)	6	NA	NA
AWL53887.1|5138737_5139460_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
AWL53888.1|5139456_5140116_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AWL53889.1|5140241_5140988_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AWL53890.1|5141396_5141900_-	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
AWL53891.1|5142137_5143025_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AWL53892.1|5143376_5143889_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
>prophage 390
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5147891	5149268	5288751		Pandoravirus(100.0%)	1	NA	NA
AWL53897.1|5147891_5149268_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.8	7.2e-23
>prophage 391
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5152276	5153869	5288751		Tupanvirus(100.0%)	1	NA	NA
AWL53901.1|5152276_5153869_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 392
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5161471	5163904	5288751		Bacteriophage(100.0%)	1	NA	NA
AWL53906.1|5161471_5163904_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 393
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5168147	5170007	5288751		Planktothrix_phage(100.0%)	1	NA	NA
AWL53911.1|5168147_5170007_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 394
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5181725	5183725	5288751		Stx2-converting_phage(50.0%)	2	NA	NA
AWL53922.1|5181725_5182928_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
AWL53923.1|5182966_5183725_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
>prophage 395
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5189176	5237152	5288751	tail,portal,integrase,lysis,head,plate,capsid	Salmonella_phage(74.47%)	60	5188708:5188726	5223074:5223092
5188708:5188726	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AWL53931.1|5189176_5190208_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.3e-105
AWL53932.1|5190288_5191620_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.6	7.9e-19
AWL54246.1|5191651_5192227_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.5	2.8e-37
AWL53933.1|5192372_5192576_+	regulator	NA	P79674	Haemophilus_phage	41.9	6.4e-05
AWL53934.1|5192640_5193150_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	99.4	2.0e-87
AWL54247.1|5193157_5193358_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AWL53935.1|5193321_5193663_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWL53936.1|5193730_5193964_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AWL53937.1|5193963_5194191_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AWL53938.1|5194187_5195045_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	9.5e-159
AWL53939.1|5195041_5197456_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
AWL53940.1|5197609_5197798_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWL53941.1|5197736_5198042_+	DinI family protein	NA	E5G6M1	Salmonella_phage	87.0	3.2e-32
AWL53942.1|5198352_5199342_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53943.1|5199338_5200031_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53944.1|5200065_5201091_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.7	6.0e-168
AWL53945.1|5201090_5202857_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AWL53946.1|5202999_5203833_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWL53947.1|5203849_5204908_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
AWL53948.1|5204911_5205562_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWL53949.1|5205657_5206122_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	1.9e-76
AWL53950.1|5206121_5206325_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
AWL53951.1|5206328_5206544_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AWL54248.1|5206563_5207037_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AWL53952.1|5207038_5207416_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
AWL53953.1|5207412_5207841_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	2.4e-46
AWL54249.1|5207728_5207974_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	72.8	4.5e-29
AWL53954.1|5207936_5208368_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
AWL53955.1|5208360_5208807_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	5.3e-60
AWL53956.1|5208784_5209945_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53957.1|5210021_5210600_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
AWL53958.1|5210596_5210956_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	4.7e-51
AWL53959.1|5210942_5211851_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	3.9e-142
AWL53960.1|5211843_5212449_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AWL54250.1|5214089_5214242_+	hypothetical protein	NA	U5P083	Shigella_phage	71.1	5.8e-11
AWL53961.1|5214222_5214405_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53962.1|5215145_5215712_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	84.6	3.0e-84
AWL53963.1|5215854_5217027_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	5.1e-203
AWL53964.1|5217036_5217552_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AWL53965.1|5217606_5217909_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AWL53966.1|5217923_5218043_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWL53967.1|5218035_5221113_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
AWL53968.1|5221109_5221595_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AWL53969.1|5221591_5222692_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	8.4e-176
AWL53970.1|5222782_5223001_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWL54251.1|5223222_5224908_-	transporter	NA	NA	NA	NA	NA
5223074:5223092	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
AWL53971.1|5225174_5225558_+	hypothetical protein	NA	NA	NA	NA	NA
AWL53972.1|5225564_5225828_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWL54252.1|5226030_5226318_+	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
AWL53973.1|5226301_5227024_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AWL53974.1|5227138_5228041_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWL53975.1|5228129_5228609_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWL53976.1|5228957_5230070_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWL54253.1|5230233_5231367_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWL53977.1|5231377_5232331_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWL53978.1|5232327_5233173_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWL53979.1|5233230_5233719_+	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWL53980.1|5233760_5234888_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWL53981.1|5234966_5235683_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	9.4e-35
AWL53982.1|5235679_5237152_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
>prophage 396
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5240296	5244647	5288751		Planktothrix_phage(50.0%)	5	NA	NA
AWL53986.1|5240296_5241025_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWL53987.1|5241251_5241767_-	lipoprotein	NA	NA	NA	NA	NA
AWL53988.1|5242413_5242593_-	hypothetical protein	NA	NA	NA	NA	NA
AWL53989.1|5242645_5243785_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWL53990.1|5243816_5244647_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
>prophage 397
CP029388	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 chromosome, complete genome	5288751	5257462	5288490	5288751	protease,tRNA,integrase	Escherichia_phage(36.36%)	30	5282779:5282792	5286364:5286377
AWL53999.1|5257462_5258578_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWL54000.1|5258574_5260515_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWL54001.1|5260454_5260637_+	hypothetical protein	NA	NA	NA	NA	NA
AWL54002.1|5260591_5260813_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWL54003.1|5261138_5261456_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWL54004.1|5261486_5263766_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWL54005.1|5263886_5264105_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWL54006.1|5264458_5265160_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWL54007.1|5265204_5266926_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWL54008.1|5266926_5268693_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWL54009.1|5268807_5269776_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	5.5e-62
AWL54010.1|5270308_5270803_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWL54011.1|5270938_5275120_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.1e-88
AWL54012.1|5275242_5275854_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWL54013.1|5275862_5277206_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWL54014.1|5277296_5278589_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWL54015.1|5278789_5281228_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	1.0e-218
AWL54016.1|5281238_5281856_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AWL54017.1|5281857_5282721_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AWL54018.1|5282732_5282879_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
5282779:5282792	attL	ATGAAATTTTTCAA	NA	NA	NA	NA
AWL54019.1|5282995_5284144_+	MFS transporter	NA	NA	NA	NA	NA
AWL54020.1|5284306_5285104_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	2.3e-21
AWL54021.1|5285135_5286131_-|integrase	integrase	integrase	A0A0F7LA05	Escherichia_phage	100.0	7.1e-190
AWL54258.1|5286224_5286536_-	XRE family transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
5286364:5286377	attR	TTGAAAAATTTCAT	NA	NA	NA	NA
AWL54022.1|5286640_5286997_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AWL54023.1|5286980_5287178_+	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AWL54024.1|5287174_5287675_+	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AWL54025.1|5287739_5287964_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWL54026.1|5287963_5288266_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
AWL54027.1|5288265_5288490_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
>prophage 1
CP029386	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence	52989	4690	31017	52989	coat,transposase	Escherichia_phage(46.15%)	38	NA	NA
AWL48907.1|4690_5851_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AWL48961.1|5853_6399_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AWL48908.1|6643_6859_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48909.1|7232_7571_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48910.1|7664_7907_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48911.1|7896_8109_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48912.1|8174_8726_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48913.1|8785_9022_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48914.1|9080_9596_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
AWL48915.1|10948_11962_+	replication initiation protein	NA	NA	NA	NA	NA
AWL48962.1|11970_12414_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48963.1|12601_12955_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AWL48916.1|12975_13260_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48917.1|13295_13607_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48918.1|13812_14097_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWL48919.1|14196_14859_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AWL48964.1|15239_15902_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AWL48920.1|15990_17211_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
AWL48965.1|17312_17552_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AWL48921.1|17554_17911_+	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AWL48922.1|17944_18649_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL48923.1|19265_19499_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48924.1|19489_20251_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWL48925.1|20271_21132_-	class A extended-spectrum beta-lactamase SHV-31	NA	A0A077SL40	Escherichia_phage	99.0	8.4e-155
AWL48926.1|21095_21278_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48927.1|21268_21973_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL48966.1|22002_22278_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48928.1|22333_22528_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48929.1|22488_24018_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWL48930.1|24206_25847_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AWL48931.1|25902_26193_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AWL48932.1|26386_26716_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AWL48933.1|26720_27752_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AWL48934.1|27762_28401_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AWL48935.1|28405_28771_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AWL48936.1|28774_29587_-	subclass B1 metallo-beta-lactamase NDM-6	NA	NA	NA	NA	NA
AWL48967.1|29840_29963_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	2.5e-12
AWL48937.1|30000_31017_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 1
CP029387	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence	226524	4961	66699	226524	protease,transposase,holin	uncultured_Caudovirales_phage(29.41%)	55	NA	NA
AWL48974.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AWL48975.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
AWL48976.1|7416_8871_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWL48977.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AWL48978.1|11193_13197_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AWL49178.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
AWL48979.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AWL48980.1|17548_19024_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AWL48981.1|19016_19697_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AWL48982.1|19886_21272_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48983.1|21300_21654_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL48984.1|21767_23060_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWL48985.1|23070_26217_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.0e-60
AWL48986.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
AWL48987.1|26870_29318_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AWL48988.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AWL48989.1|29589_30327_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AWL48990.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
AWL48991.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWL48992.1|33115_34012_+	copper resistance protein B	NA	NA	NA	NA	NA
AWL48993.1|34051_34432_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWL48994.1|34436_35366_+	copper resistance protein D	NA	NA	NA	NA	NA
AWL48995.1|35420_36101_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWL48996.1|36097_37498_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWL48997.1|37714_38149_+	copper-binding protein	NA	NA	NA	NA	NA
AWL49179.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWL48998.1|40302_40812_+	porin	NA	NA	NA	NA	NA
AWL48999.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWL49000.1|41690_42017_+	transcriptional regulator	NA	NA	NA	NA	NA
AWL49180.1|42016_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWL49001.1|42735_43281_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWL49002.1|43356_43719_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL49003.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL49004.1|46184_46610_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWL49005.1|46622_47912_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWL49006.1|47959_49711_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWL49007.1|49728_50091_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWL49008.1|50140_50491_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWL49009.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49010.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49011.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
AWL49012.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49013.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWL49014.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49015.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49016.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWL49017.1|53920_54403_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWL49181.1|54614_55961_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWL49018.1|57803_58766_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AWL49019.1|58752_59502_-	diguanylate cyclase	NA	NA	NA	NA	NA
AWL49020.1|59739_59937_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49021.1|59936_62732_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWL49022.1|62846_63416_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWL49182.1|63450_63732_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AWL49023.1|65718_66699_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
CP029387	Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence	226524	73168	118065	226524	integrase,transposase	Escherichia_phage(16.67%)	39	65411:65429	113713:113731
65411:65429	attL	TGCATGACAAAGTCATCGG	NA	NA	NA	NA
AWL49028.1|73168_73873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWL49029.1|73884_74541_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWL49030.1|74636_75821_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AWL49031.1|75915_77025_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AWL49032.1|77513_78218_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWL49033.1|78208_78481_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49034.1|79131_80865_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AWL49035.1|80872_81820_-	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AWL49036.1|81864_83469_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL49037.1|83481_84402_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL49038.1|84401_85250_-	ABC transporter permease	NA	NA	NA	NA	NA
AWL49039.1|85246_85840_-	response regulator	NA	NA	NA	NA	NA
AWL49040.1|85836_86964_-	regulator	NA	NA	NA	NA	NA
AWL49041.1|87248_87416_-|integrase	integrase	integrase	NA	NA	NA	NA
AWL49042.1|88518_89040_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AWL49043.1|89036_89990_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AWL49044.1|90076_92395_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AWL49045.1|92439_93342_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AWL49046.1|93338_94337_+	iron-dicitrate transporter permease FecC	NA	NA	NA	NA	NA
AWL49047.1|94333_95290_+	iron-dicitrate transporter subunit FecD	NA	NA	NA	NA	NA
AWL49048.1|95290_96058_+	iron-dicitrate ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AWL49049.1|96156_96450_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AWL49186.1|96780_97023_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49050.1|97401_98412_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AWL49051.1|98434_98650_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49052.1|98872_99955_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
AWL49053.1|100076_103151_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.6	0.0e+00
AWL49054.1|103202_104456_+	MFS transporter	NA	NA	NA	NA	NA
AWL49055.1|104512_104683_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AWL49056.1|105900_106479_+	hypothetical protein	NA	NA	NA	NA	NA
AWL49187.1|106481_106841_-	hypothetical protein	NA	NA	NA	NA	NA
AWL49057.1|106991_108141_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.3	5.9e-172
AWL49058.1|109336_110575_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.1	6.2e-10
AWL49188.1|111019_112018_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AWL49189.1|112212_112686_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWL49059.1|113810_114155_+	hypothetical protein	NA	NA	NA	NA	NA
113713:113731	attR	TGCATGACAAAGTCATCGG	NA	NA	NA	NA
AWL49060.1|114372_115632_+	MFS transporter	NA	NA	NA	NA	NA
AWL49061.1|115648_116767_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
AWL49062.1|116918_118065_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
