The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	1371972	1381643	4071006		Streptococcus_phage(25.0%)	10	NA	NA
AVV36831.1|1371972_1373085_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.0	1.6e-110
AVV36832.1|1373323_1374427_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.7e-59
AVV36833.1|1374437_1375691_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.1	1.5e-91
AVV36834.1|1376051_1376783_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.5	4.9e-47
AVV36835.1|1377205_1377484_+	hypothetical protein	NA	NA	NA	NA	NA
AVV36836.1|1377688_1378156_+	lysozyme	NA	H9C148	Vibrio_phage	45.3	1.0e-26
AVV36837.1|1378152_1378500_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	44.7	2.4e-20
AVV36838.1|1378496_1378790_+	hypothetical protein	NA	NA	NA	NA	NA
AVV36839.1|1378994_1380749_+	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	46.5	2.7e-152
AVV36840.1|1381430_1381643_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	9.3e-23
>prophage 2
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	1443393	1451119	4071006	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
AVV36892.1|1443393_1444542_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	2.5e-90
AVV36893.1|1444541_1444874_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	5.7e-11
AVV36894.1|1444899_1446747_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVV36895.1|1446757_1447726_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.3	2.1e-45
AVV36896.1|1447785_1448364_-	hypothetical protein	NA	NA	NA	NA	NA
AVV36897.1|1448380_1448818_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	51.9	2.5e-06
AVV36898.1|1449004_1449454_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVV36899.1|1449457_1450558_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	4.3e-47
AVV36900.1|1450648_1451119_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	2.7e-30
>prophage 3
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	1923801	1964980	4071006	capsid,integrase,portal,terminase,tail,holin,head,plate	Enterobacteria_phage(25.58%)	57	1923641:1923700	1965103:1965162
1923641:1923700	attL	GATTTAAAATCCCTCGGCTGTAAGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATAT	NA	NA	NA	NA
AVV37317.1|1923801_1924824_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	62.4	9.4e-121
AVV39253.1|1924823_1925051_-	hypothetical protein	NA	K7PHA0	Enterobacterial_phage	43.1	2.5e-10
AVV37318.1|1925056_1925533_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
AVV37319.1|1925532_1925847_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	61.5	3.9e-33
AVV37320.1|1925859_1926264_-	hypothetical protein	NA	A0A248SL59	Klebsiella_phage	40.7	1.8e-14
AVV37321.1|1926260_1926704_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37322.1|1927665_1928127_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37323.1|1928490_1928694_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	43.3	6.4e-05
AVV39254.1|1928950_1929589_-	LexA family transcriptional repressor	NA	K7PH19	Enterobacteria_phage	87.7	4.4e-108
AVV37324.1|1929706_1929922_+	transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	72.9	5.0e-24
AVV37325.1|1929975_1930524_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	62.0	2.8e-55
AVV37326.1|1930710_1930953_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	62.3	1.3e-09
AVV37327.1|1930882_1931776_+	transcriptional regulator	NA	A0A248SL49	Klebsiella_phage	48.0	2.9e-33
AVV37328.1|1931789_1932224_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37329.1|1932339_1933641_+	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	70.0	4.2e-81
AVV37330.1|1933763_1934297_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37331.1|1934941_1935982_+	hypothetical protein	NA	NA	NA	NA	NA
AVV39255.1|1936243_1937023_+	DNA-binding protein	NA	Q8SBE6	Shigella_phage	63.2	4.2e-89
AVV37332.1|1937030_1938053_+	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	52.4	9.5e-97
AVV37333.1|1938074_1938479_+	antitermination protein	NA	S5M7R9	Escherichia_phage	47.2	1.7e-25
AVV37334.1|1938607_1938889_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37335.1|1938982_1939192_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37336.1|1939266_1939629_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AVV37337.1|1939612_1940245_+	hypothetical protein	NA	F1C5D2	Cronobacter_phage	46.7	6.8e-45
AVV37338.1|1940232_1940688_+	Rz lytic protein	NA	NA	NA	NA	NA
AVV37339.1|1940902_1941427_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37340.1|1941560_1941770_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	50.0	7.7e-14
AVV37341.1|1941820_1942171_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	71.3	1.5e-41
AVV37342.1|1942701_1943166_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	8.2e-48
AVV37343.1|1943119_1944865_+|terminase	phage terminase small subunit P27 family	terminase	M4QNU0	Tetraselmis_viridis_virus	43.5	8.8e-135
AVV37344.1|1944864_1946169_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	75.6	6.2e-194
AVV37345.1|1946180_1947026_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	70.5	7.8e-105
AVV37346.1|1947038_1948253_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	80.8	5.6e-181
AVV37347.1|1948641_1948971_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	51.0	1.6e-21
AVV37348.1|1948972_1949362_+|head,tail	head-tail adaptor protein	head,tail	U5P0R0	Shigella_phage	58.1	5.6e-34
AVV37349.1|1949354_1949861_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	77.1	2.9e-70
AVV37350.1|1949857_1950418_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	66.1	4.6e-69
AVV37351.1|1950421_1950610_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	63.0	6.1e-10
AVV37352.1|1950609_1952106_+|tail	phage tail protein	tail	U5P0H3	Shigella_phage	62.7	2.2e-171
AVV37353.1|1952105_1952462_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	83.1	2.0e-49
AVV37354.1|1952458_1952728_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	77.5	1.1e-33
AVV39256.1|1952694_1952877_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37355.1|1952869_1954753_+|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	75.2	2.2e-171
AVV37356.1|1954814_1955342_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37357.1|1955394_1956771_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	53.5	9.7e-129
AVV37358.1|1956767_1957838_+|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	69.1	5.0e-141
AVV37359.1|1957837_1958395_+|plate	baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	64.9	7.8e-61
AVV37360.1|1958391_1958805_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	62.8	1.7e-44
AVV37361.1|1958797_1959865_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	65.4	3.0e-130
AVV37362.1|1959855_1960437_+	hypothetical protein	NA	O22003	Shigella_phage	63.2	6.4e-66
AVV37363.1|1960439_1960958_+	hypothetical protein	NA	O22004	Shigella_phage	39.4	9.6e-21
AVV37364.1|1960959_1961370_+	hypothetical protein	NA	U5P083	Shigella_phage	45.0	1.8e-22
AVV37365.1|1961353_1962529_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37366.1|1962682_1962925_+	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	54.2	7.6e-13
AVV37367.1|1963069_1964134_-	hypothetical protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.6	2.7e-14
AVV37368.1|1964414_1964654_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37369.1|1964656_1964980_+	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	71.0	6.3e-39
1965103:1965162	attR	GATTTAAAATCCCTCGGCTGTAAGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATAT	NA	NA	NA	NA
>prophage 4
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	2303135	2316986	4071006	tRNA	Tupanvirus(11.11%)	14	NA	NA
AVV37661.1|2303135_2305064_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.8e-126
AVV37662.1|2305067_2305619_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	1.7e-15
AVV37663.1|2305718_2305916_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVV37664.1|2305960_2306317_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVV37665.1|2306631_2307615_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
AVV37666.1|2307629_2310017_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	5.4e-10
AVV37667.1|2310021_2310324_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
AVV37668.1|2310503_2311487_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AVV37669.1|2311537_2312083_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	7.7e-13
AVV37670.1|2312083_2312833_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.9	1.3e-07
AVV37671.1|2312901_2313360_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	37.5	5.5e-12
AVV37672.1|2313654_2314401_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVV37673.1|2314480_2315932_+	YdiU family protein	NA	NA	NA	NA	NA
AVV37674.1|2315939_2316986_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	50.0	9.4e-84
>prophage 5
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	2447444	2487166	4071006	capsid,integrase,portal,terminase,tail,holin,head	Klebsiella_phage(21.74%)	57	2446646:2446661	2490628:2490643
2446646:2446661	attL	ATCCCCATGATGGTCG	NA	NA	NA	NA
AVV37791.1|2447444_2449286_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.8	4.3e-132
AVV37792.1|2449531_2450710_+|integrase	integrase	integrase	F1C5A4	Cronobacter_phage	71.4	9.7e-170
AVV39280.1|2450690_2450882_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	55.7	2.3e-12
AVV37793.1|2450932_2451280_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	66.1	7.5e-38
AVV37794.1|2451279_2451756_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.2	6.9e-66
AVV37795.1|2451755_2452340_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37796.1|2452352_2452757_-	hypothetical protein	NA	A0A248SL59	Klebsiella_phage	40.7	4.7e-15
AVV37797.1|2452753_2453197_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37798.1|2453208_2453373_-	DUF1317 domain-containing protein	NA	NA	NA	NA	NA
AVV37799.1|2453359_2453878_-	hypothetical protein	NA	A0A248SL95	Klebsiella_phage	43.0	2.3e-38
AVV39281.1|2454858_2455512_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	57.1	6.5e-67
AVV37800.1|2455611_2455809_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	54.2	1.4e-12
AVV37801.1|2455833_2456370_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	38.2	6.8e-22
AVV37802.1|2456469_2456658_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37803.1|2456657_2456840_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVV37804.1|2456836_2457733_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	62.2	3.7e-36
AVV37805.1|2457745_2458180_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37806.1|2458295_2459759_+	chromosome partitioning protein ParB	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.0	2.4e-77
AVV37807.1|2459755_2460052_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	64.6	9.9e-31
AVV37808.1|2460048_2460246_+	hypothetical protein	NA	NA	NA	NA	NA
AVV39282.1|2460242_2460608_+	hypothetical protein	NA	A5LH74	Enterobacteria_phage	60.8	6.0e-38
AVV37809.1|2460762_2461479_+	phage regulatory protein/antirepressor Ant	NA	A0A059VF66	Pseudomonas_phage	51.1	4.7e-50
AVV37810.1|2461475_2462492_+	hypothetical protein	NA	A0A1C9IHZ5	Salmonella_phage	53.0	1.6e-96
AVV37811.1|2462513_2462942_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	69.2	4.6e-45
AVV37812.1|2462992_2463178_+	hypothetical protein	NA	NA	NA	NA	NA
AVV37813.1|2463245_2463422_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.8	2.5e-13
AVV37814.1|2463470_2463878_+	antitoxin	NA	F1C593	Cronobacter_phage	64.4	1.1e-40
AVV37815.1|2464034_2464388_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AVV37816.1|2464371_2464797_+	lysozyme	NA	A0A0B5KZG2	Acinetobacter_phage	60.0	1.2e-37
AVV37817.1|2464793_2465228_+	Rz lytic protein	NA	NA	NA	NA	NA
AVV37818.1|2465118_2465373_+	peptidase	NA	U5P461	Shigella_phage	42.9	3.5e-08
AVV37819.1|2465381_2465621_+	hypothetical protein	NA	A0A291LBC4	Klebsiella_phage	55.1	1.5e-16
AVV37820.1|2465663_2465852_-	hypothetical protein	NA	NA	NA	NA	NA
AVV37821.1|2466004_2466184_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	59.3	1.7e-14
AVV37822.1|2466303_2467761_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	72.8	3.8e-216
AVV37823.1|2467745_2468360_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	73.7	5.5e-84
AVV37824.1|2468328_2468682_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	73.3	6.2e-48
AVV37825.1|2468899_2469373_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	73.9	3.7e-64
AVV37826.1|2469376_2471107_+|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	77.1	2.6e-272
AVV37827.1|2471106_2472411_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	80.6	3.9e-204
AVV37828.1|2472421_2473270_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	66.2	2.8e-94
AVV37829.1|2473279_2474491_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	73.9	4.9e-161
AVV37830.1|2474533_2474860_+	hypothetical protein	NA	K7PKT4	Enterobacteria_phage	51.9	9.2e-30
AVV37831.1|2474856_2475192_+|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	54.1	3.3e-22
AVV37832.1|2475184_2475568_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	53.2	5.9e-36
AVV39283.1|2475570_2475972_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	76.5	1.1e-48
AVV37833.1|2476005_2476458_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	75.5	7.0e-60
AVV37834.1|2476512_2476881_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	52.5	5.4e-26
AVV37835.1|2476901_2477123_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	58.9	1.2e-17
AVV37836.1|2477122_2480470_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	63.2	5.5e-295
AVV37837.1|2480472_2480814_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	55.9	8.7e-31
AVV37838.1|2480865_2481603_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	81.2	1.8e-121
AVV37839.1|2481605_2482325_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	68.5	3.8e-100
AVV37840.1|2482317_2482941_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	60.4	1.1e-63
AVV37841.1|2482997_2486204_+	host specificity protein	NA	E4WL39	Enterobacteria_phage	64.1	0.0e+00
AVV37842.1|2486213_2486519_+	hypothetical protein	NA	A0A192Y8D4	Enterobacteria_phage	41.2	1.4e-11
AVV37843.1|2486515_2487166_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	40.6	1.1e-45
2490628:2490643	attR	ATCCCCATGATGGTCG	NA	NA	NA	NA
>prophage 6
CP028349	Pantoea vagans strain PV989 chromosome, complete genome	4071006	3143884	3164318	4071006	tRNA	Synechococcus_phage(35.71%)	21	NA	NA
AVV38413.1|3143884_3144496_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	28.6	7.8e-14
AVV38414.1|3144610_3145087_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVV38415.1|3145153_3145945_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVV38416.1|3146051_3147350_+	hypothetical protein	NA	NA	NA	NA	NA
AVV38417.1|3147385_3148795_-	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QGJ9	Cyanophage	30.4	2.5e-31
AVV38418.1|3148946_3150008_-	hypothetical protein	NA	A0A1D8KNV9	Synechococcus_phage	35.0	9.7e-36
AVV38419.1|3150012_3150648_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	41.7	1.6e-38
AVV38420.1|3150637_3151279_-	hypothetical protein	NA	A0A2H4UUJ1	Bodo_saltans_virus	36.7	8.5e-19
AVV38421.1|3151291_3152017_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	7.4e-11
AVV38422.1|3152013_3152832_-	ABC transporter permease	NA	NA	NA	NA	NA
AVV38423.1|3152831_3153887_-	hypothetical protein	NA	NA	NA	NA	NA
AVV38424.1|3153918_3154851_-	hypothetical protein	NA	M4R1H4	Synechococcus_phage	24.0	1.9e-11
AVV38425.1|3154837_3155866_-	hypothetical protein	NA	NA	NA	NA	NA
AVV38426.1|3155858_3157502_-	hypothetical protein	NA	NA	NA	NA	NA
AVV38427.1|3157504_3158260_-	glycosyl transferase family 2	NA	A0A1D8KNV9	Synechococcus_phage	50.2	2.6e-59
AVV38428.1|3158261_3158588_-	hypothetical protein	NA	A0A222YXE6	Synechococcus_phage	36.4	1.7e-12
AVV38429.1|3159131_3160214_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.9	8.5e-96
AVV38430.1|3160213_3161077_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.4	6.7e-112
AVV38431.1|3161119_3162274_+	acyltransferase	NA	Q9MC93	Pseudomonas_phage	28.3	3.3e-05
AVV38432.1|3162359_3163373_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.1	1.7e-74
AVV38433.1|3163415_3164318_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.1	9.7e-45
>prophage 1
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	0	5332	93831		Klebsiella_phage(25.0%)	7	NA	NA
AVV39947.1|426_762_+	hypothetical protein	NA	NA	NA	NA	NA
AVV39948.1|1130_1385_+	hypothetical protein	NA	A0A248SLB9	Klebsiella_phage	52.8	3.6e-05
AVV39949.1|1567_2017_+	SamA	NA	A0A1W6JNS2	Morganella_phage	52.1	2.7e-27
AVV39950.1|2026_3301_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.9	1.8e-145
AVV39951.1|3423_3756_-	hypothetical protein	NA	NA	NA	NA	NA
AVV39952.1|3752_4208_-	hypothetical protein	NA	NA	NA	NA	NA
AVV39953.1|4207_5332_-	chromosome partitioning protein ParB	NA	S5WII0	Leptospira_phage	25.4	3.4e-07
>prophage 2
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	10039	10792	93831		Macacine_betaherpesvirus(100.0%)	1	NA	NA
AVV39957.1|10039_10792_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	43.0	7.9e-16
>prophage 3
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	18580	21683	93831		Pseudomonas_phage(50.0%)	2	NA	NA
AVV39962.1|18580_20605_+	acyltransferase	NA	B5WZU0	Pseudomonas_phage	30.8	5.4e-43
AVV39963.1|20657_21683_-	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	54.8	4.9e-101
>prophage 4
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	26387	28805	93831		Streptococcus_phage(50.0%)	3	NA	NA
AVV39969.1|26387_27677_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	53.2	3.5e-120
AVV39970.1|27720_28428_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVV39971.1|28424_28805_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	58.3	8.2e-30
>prophage 5
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	32906	34103	93831		Morganella_phage(50.0%)	2	NA	NA
AVV39975.1|32906_33284_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	39.1	3.7e-14
AVV39976.1|33422_34103_+	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	80.1	1.0e-110
>prophage 6
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	37537	38071	93831		Wolbachia_phage(100.0%)	1	NA	NA
AVV39980.1|37537_38071_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.9e-19
>prophage 7
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	59894	64676	93831		Idiomarinaceae_phage(100.0%)	1	NA	NA
AVV40003.1|59894_64676_-	DNA primase	NA	A0A088F8A2	Idiomarinaceae_phage	28.0	1.7e-15
>prophage 8
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	69659	70124	93831		Ralstonia_phage(100.0%)	1	NA	NA
AVV40010.1|69659_70124_-	lytic transglycosylase	NA	A0A0A8J856	Ralstonia_phage	36.1	3.4e-09
>prophage 9
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	79460	79844	93831		Salmonella_phage(100.0%)	1	NA	NA
AVV40020.1|79460_79844_-	HNH endonuclease	NA	A0A1P8DTS4	Salmonella_phage	39.4	1.9e-18
>prophage 10
CP028352	Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence	93831	86523	90141	93831		Escherichia_phage(66.67%)	5	NA	NA
AVV40029.1|86523_86841_-	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	52.3	1.0e-17
AVV40030.1|86840_87122_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	57.0	7.7e-25
AVV40031.1|87118_87925_-	hypothetical protein	NA	NA	NA	NA	NA
AVV40032.1|87921_88368_-	hypothetical protein	NA	NA	NA	NA	NA
AVV40033.1|88464_90141_-	restriction endonuclease subunit M	NA	A0A059VA49	Pseudomonas_phage	52.0	5.6e-155
