The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	1119290	1185606	4678516	transposase,capsid,tRNA,plate,portal,head,tail,integrase	Salmonella_phage(91.3%)	66	1122012:1122026	1124949:1124963
AVV01980.1|1119290_1120401_+|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
AVV01981.1|1121197_1122001_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
1122012:1122026	attL	CATGAATGGATATTA	NA	NA	NA	NA
AVV01982.1|1122399_1122993_-	hypothetical protein	NA	NA	NA	NA	NA
AVV01983.1|1123252_1124278_-|integrase	integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
AVV01984.1|1124281_1124914_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AVV01985.1|1125030_1125270_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
1124949:1124963	attR	TAATATCCATTCATG	NA	NA	NA	NA
AVV01986.1|1125305_1125815_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
AVV01987.1|1125822_1126056_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	4.7e-12
AVV01988.1|1126003_1126462_-	hypothetical protein	NA	NA	NA	NA	NA
AVV01989.1|1126681_1127023_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
AVV01990.1|1127090_1127324_+	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
AVV01991.1|1127323_1127551_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
AVV01992.1|1127547_1128405_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
AVV01993.1|1128395_1130825_+	endonuclease	NA	A0A1S6L028	Salmonella_phage	91.3	0.0e+00
AVV01994.1|1130977_1131166_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
AVV01995.1|1131104_1131410_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AVV01996.1|1131469_1132201_+	hypothetical protein	NA	NA	NA	NA	NA
AVV01997.1|1132514_1134179_+	abortive phage infection protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
AVV01998.1|1134282_1135323_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
AVV01999.1|1135322_1137089_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
AVV02000.1|1137231_1138065_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
AVV02001.1|1138081_1139143_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
AVV02002.1|1139146_1139797_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	100.0	4.9e-115
AVV02003.1|1139890_1140355_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
AVV02004.1|1140354_1140558_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AVV02005.1|1140561_1140777_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AVV02006.1|1140757_1141273_+	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
AVV02007.1|1141269_1141698_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	100.0	2.3e-68
AVV02008.1|1141627_1141831_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	8.3e-29
AVV02009.1|1141793_1142225_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
AVV02010.1|1142217_1142664_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
AVV02011.1|1142665_1143517_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
AVV02012.1|1143594_1144173_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
AVV02013.1|1144169_1144529_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
AVV02014.1|1144515_1145424_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
AVV02015.1|1145416_1146022_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
AVV02016.1|1146018_1147872_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
AVV02017.1|1147871_1148447_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
AVV02018.1|1149316_1149541_+	Hin recombinase	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
AVV02019.1|1149643_1150816_+|tail	phage tail protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
AVV02020.1|1150825_1151341_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
AVV02021.1|1151395_1151698_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
AVV02022.1|1151712_1151832_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
AVV02023.1|1151824_1154632_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
AVV02024.1|1154628_1155114_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
AVV02025.1|1155110_1156211_+	late control protein D	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
AVV05257.1|1156279_1156498_+	levansucrase regulator	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
AVV05258.1|1157049_1158213_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVV02026.1|1158220_1160401_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AVV02027.1|1160397_1161807_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AVV02028.1|1161871_1173346_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
AVV05259.1|1173960_1174443_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AVV02029.1|1174592_1175069_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
AVV02030.1|1175058_1175349_+	RnfH family protein	NA	NA	NA	NA	NA
AVV02031.1|1175514_1175853_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AVV02032.1|1176001_1177663_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AVV05261.1|1177748_1178627_-	NAD(+) kinase	NA	NA	NA	NA	NA
AVV05260.1|1178750_1179341_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AVV02033.1|1179375_1179981_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVV02034.1|1180101_1181343_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AVV02035.1|1181407_1182199_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AVV02036.1|1182144_1182441_-	hypothetical protein	NA	NA	NA	NA	NA
AVV02037.1|1182364_1183726_+	signal recognition particle protein	NA	NA	NA	NA	NA
AVV02038.1|1183978_1184227_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AVV05262.1|1184245_1184794_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AVV02039.1|1184838_1185606_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	1689927	1699098	4678516	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVV02478.1|1689927_1690875_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
AVV02479.1|1690858_1691590_+	ABC transporter permease	NA	NA	NA	NA	NA
AVV02480.1|1691570_1691678_-	hypothetical protein	NA	NA	NA	NA	NA
AVV02481.1|1691737_1692469_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
AVV02482.1|1692691_1694377_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
AVV02483.1|1694373_1695093_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVV02484.1|1695139_1695607_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
AVV02485.1|1695663_1696194_-	lipoprotein	NA	NA	NA	NA	NA
AVV02486.1|1696365_1696824_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
AVV02487.1|1697064_1699098_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	1766293	1776800	4678516		Enterobacteria_phage(37.5%)	10	NA	NA
AVV02539.1|1766293_1767697_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AVV02540.1|1767874_1768768_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVV02541.1|1769144_1770230_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AVV02542.1|1770229_1771129_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AVV05279.1|1771176_1772055_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
AVV02543.1|1772055_1772607_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
AVV02544.1|1772612_1773587_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
AVV02545.1|1773602_1774376_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVV02546.1|1774380_1775460_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
AVV02547.1|1775486_1776800_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	2428807	2444751	4678516	tRNA,holin	Escherichia_phage(66.67%)	21	NA	NA
AVV03181.1|2428807_2429242_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
AVV03182.1|2429291_2429630_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVV03183.1|2429622_2429775_-	multidrug transporter	NA	NA	NA	NA	NA
AVV03184.1|2430475_2431021_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
AVV03185.1|2431017_2431299_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
AVV03186.1|2431398_2431794_-	hypothetical protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
AVV03187.1|2433964_2434501_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
AVV03188.1|2434497_2434788_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
AVV03189.1|2434787_2435387_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
AVV03190.1|2435910_2436123_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
AVV03191.1|2436492_2437425_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03192.1|2437421_2437976_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03193.1|2438137_2438467_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
AVV03194.1|2438739_2439207_+	transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
AVV05305.1|2439591_2439747_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
AVV03195.1|2439854_2440376_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03196.1|2440813_2441035_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
AVV03197.1|2441119_2441437_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03198.1|2441464_2442082_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
AVV03199.1|2442398_2443334_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AVV03200.1|2443377_2444751_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 5
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	2636047	2685297	4678516	transposase,lysis,tail,integrase,protease,holin	Enterobacteria_phage(22.73%)	51	2665812:2665841	2685433:2685462
AVV03390.1|2636047_2636929_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVV03391.1|2637122_2639171_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVV03392.1|2639190_2639877_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVV03393.1|2639974_2640559_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AVV03394.1|2640600_2641884_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVV03395.1|2641846_2644486_+	MCE family protein	NA	NA	NA	NA	NA
AVV05316.1|2644563_2646003_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVV03396.1|2646117_2646357_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVV03397.1|2646467_2646659_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVV03398.1|2646677_2647328_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
AVV03399.1|2647551_2647716_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03400.1|2648000_2648723_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVV03401.1|2649406_2649802_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AVV03402.1|2650131_2650608_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03403.1|2650980_2651400_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVV03404.1|2651531_2651726_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03405.1|2651772_2652042_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
AVV03406.1|2652207_2652348_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03407.1|2652540_2653701_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.1	1.2e-39
AVV05317.1|2654668_2654869_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03408.1|2655486_2656401_+	protein PagO	NA	NA	NA	NA	NA
AVV03409.1|2656533_2656692_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03410.1|2656701_2657316_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVV03411.1|2658450_2658576_-	arsenic transporter	NA	NA	NA	NA	NA
AVV03412.1|2658838_2658955_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVV03413.1|2659145_2659346_+	phage virulence factor	NA	NA	NA	NA	NA
AVV03414.1|2662047_2662539_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
AVV03415.1|2662593_2662782_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03416.1|2662846_2663014_+	lytic enzyme	NA	NA	NA	NA	NA
AVV03417.1|2663270_2663804_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	1.6e-10
AVV03418.1|2663857_2664088_-	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVV05318.1|2664277_2664772_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
2665812:2665841	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AVV03419.1|2666629_2667430_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03420.1|2667909_2668632_+	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AVV03421.1|2669182_2670046_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
AVV03422.1|2672686_2673382_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AVV03423.1|2673471_2674005_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVV05320.1|2674899_2675379_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
AVV03424.1|2675396_2675849_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
AVV05319.1|2675832_2676162_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVV03425.1|2676437_2677124_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AVV03426.1|2677484_2677934_+	hypothetical protein	NA	NA	NA	NA	NA
AVV05321.1|2678307_2678832_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03427.1|2678928_2679618_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AVV03428.1|2679747_2679975_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AVV03429.1|2679971_2680571_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
AVV03430.1|2680634_2680940_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03431.1|2681362_2681554_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03432.1|2681571_2683551_-	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
AVV03433.1|2683964_2684243_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AVV03434.1|2684217_2685297_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2685433:2685462	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 6
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	2887159	2898384	4678516	tail	Salmonella_phage(40.0%)	11	NA	NA
AVV03648.1|2887159_2889772_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
AVV03649.1|2890198_2890390_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
AVV03650.1|2890660_2891347_+	virulence protein	NA	NA	NA	NA	NA
AVV03651.1|2891706_2892333_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	8.2e-67
AVV03652.1|2892980_2893949_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
AVV03653.1|2894174_2894423_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
AVV03654.1|2894426_2895008_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
AVV03655.1|2895007_2896717_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
AVV03656.1|2896713_2897340_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
AVV03657.1|2897323_2897953_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
AVV03658.1|2897973_2898384_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 7
CP025554	Salmonella enterica subsp. enterica serovar Enteritidis strain ATCC BAA-708 chromosome, complete genome	4678516	2969663	2976976	4678516	integrase,protease	Ralstonia_phage(16.67%)	8	2964460:2964474	2975712:2975726
2964460:2964474	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AVV03712.1|2969663_2970041_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
AVV03713.1|2970202_2970400_+	hypothetical protein	NA	NA	NA	NA	NA
AVV03714.1|2970612_2972889_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVV03715.1|2972919_2973240_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVV03716.1|2973563_2973785_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVV03717.1|2973739_2973934_-	hypothetical protein	NA	NA	NA	NA	NA
AVV03718.1|2973914_2975861_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2975712:2975726	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AVV03719.1|2975857_2976976_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
