The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	89966	131426	3031937	integrase,coat,portal,capsid,tail,terminase,holin	Listeria_phage(96.36%)	64	91041:91085	131526:131570
AVV11373.1|89966_90923_+	hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	1.6e-29
91041:91085	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
AVV11374.1|91189_92392_-|integrase	site-specific integrase	integrase	A0A059T666	Listeria_phage	99.2	1.9e-221
AVV11375.1|92486_93023_-	hypothetical protein	NA	NA	NA	NA	NA
AVV11376.1|93071_93239_-	hypothetical protein	NA	NA	NA	NA	NA
AVV11377.1|93396_93873_-	XRE family transcriptional regulator	NA	A8ASM2	Listeria_phage	62.7	1.2e-41
AVV11378.1|94028_94271_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVV11379.1|94267_94534_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
AVV11380.1|94462_94693_-	hypothetical protein	NA	Q9T185	Listeria_phage	98.7	2.3e-35
AVV11381.1|94757_94952_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	93.8	6.9e-25
AVV11382.1|94963_95230_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	69.7	1.8e-23
AVV11383.1|95383_95626_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	83.8	2.8e-31
AVV11384.1|95689_96460_+	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	71.7	7.4e-102
AVV11385.1|96582_97116_+	hypothetical protein	NA	A0A0B5D173	Listeria_phage	87.3	2.3e-78
AVV11386.1|97112_97328_+	hypothetical protein	NA	Q9T176	Listeria_phage	91.5	2.2e-27
AVV11387.1|97435_97624_+	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	2.0e-21
AVV11388.1|97855_98815_+	hypothetical protein	NA	A8ATY5	Listeria_phage	99.1	5.1e-177
AVV11389.1|98814_99630_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	98.5	1.7e-149
AVV11390.1|99650_100565_+	DnaD domain protein	NA	A0A0B5D175	Listeria_phage	92.8	1.7e-142
AVV11391.1|100561_100816_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	91.5	7.4e-35
AVV11392.1|100833_101811_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	40.2	8.3e-50
AVV11393.1|101807_102002_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11394.1|102028_102634_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	77.6	3.8e-85
AVV11395.1|102630_102810_+	hypothetical protein	NA	A0A059T5G0	Listeria_phage	93.2	3.5e-23
AVV11396.1|102988_103492_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	44.8	9.3e-29
AVV11397.1|103491_104193_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11398.1|104205_104475_+	hypothetical protein	NA	A0A059T7S7	Listeria_phage	89.5	5.8e-38
AVV11399.1|104471_104657_+	hypothetical protein	NA	A0A059T5G1	Listeria_phage	98.4	1.2e-26
AVV11400.1|104653_104944_+	hypothetical protein	NA	Q8W5X0	Listeria_phage	90.6	5.0e-43
AVV11401.1|104943_105129_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11402.1|105129_105357_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	96.0	1.9e-34
AVV11403.1|105367_105769_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	83.5	1.3e-54
AVV11404.1|105768_106251_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.9	3.9e-77
AVV11405.1|106282_106588_+	response regulator	NA	A8ATZ8	Listeria_phage	83.2	1.9e-37
AVV11406.1|106690_107095_+	hypothetical protein	NA	A8AU00	Listeria_phage	98.5	2.7e-71
AVV11407.1|107223_107388_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	7.4e-20
AVV11408.1|107406_107841_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
AVV11409.1|108101_108641_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11410.1|108686_109229_+|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.3	1.2e-90
AVV11411.1|109197_110529_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T5E2	Listeria_phage	99.5	1.3e-263
AVV11412.1|110541_112041_+|portal	portal protein	portal	A0A059T657	Listeria_phage	100.0	1.0e-277
AVV11413.1|112046_113186_+|capsid	minor capsid protein	capsid	A0A059T7W2	Listeria_phage	100.0	1.7e-208
AVV11414.1|113264_113855_+	scaffolding protein	NA	A0A059T7N8	Listeria_phage	100.0	2.5e-86
AVV11415.1|113854_114856_+|coat	coat protein	coat	A0A059T6D4	Listeria_phage	100.0	7.4e-187
AVV11416.1|114874_115270_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	100.0	5.1e-67
AVV11417.1|115269_115632_+|capsid	minor capsid protein	capsid	A0A059T658	Listeria_phage	100.0	8.3e-64
AVV11418.1|115631_115970_+|capsid	minor capsid protein	capsid	A0A059T7W4	Listeria_phage	100.0	2.9e-58
AVV11419.1|115969_116377_+|capsid	minor capsid protein	capsid	A0A059T7P0	Listeria_phage	100.0	2.4e-67
AVV11420.1|116379_116817_+|tail	phage tail protein	tail	A0A059T6D6	Listeria_phage	100.0	2.5e-78
AVV11421.1|116746_117079_+	Ig-like virion protein	NA	A0A059T5E4	Listeria_phage	100.0	1.7e-42
AVV11422.1|117131_117554_+	hypothetical protein	NA	A8ASK4	Listeria_phage	100.0	3.1e-70
AVV11423.1|117559_118165_+	hypothetical protein	NA	A0A059T7W8	Listeria_phage	99.5	2.9e-109
AVV11424.1|118175_123542_+|tail	tail tape measure protein	tail	A8ASK6	Listeria_phage	88.5	0.0e+00
AVV11425.1|123538_124366_+|tail	phage tail family protein	tail	A8ASK7	Listeria_phage	96.4	4.0e-154
AVV11426.1|124380_125403_+	hypothetical protein	NA	A8ASK8	Listeria_phage	97.1	1.7e-191
AVV11427.1|125403_126429_+	hypothetical protein	NA	A8ASK9	Listeria_phage	87.1	2.5e-166
AVV11428.1|126425_127505_+	DUF2479 domain-containing protein	NA	A0A0B5CTW3	Listeria_phage	78.2	9.7e-100
AVV11429.1|127501_127783_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11430.1|127787_127946_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
AVV11431.1|127986_128289_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	94.0	7.7e-39
AVV11432.1|128288_128552_+|holin	phage holin	holin	A8ATB7	Listeria_phage	66.3	1.0e-23
AVV11433.1|128544_129489_+	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	78.7	3.2e-147
AVV11434.1|129847_130747_+	abortive infection protein	NA	NA	NA	NA	NA
AVV11435.1|130989_131223_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	98.7	4.3e-37
AVV11436.1|131219_131426_+	hypothetical protein	NA	A0A059T5E7	Listeria_phage	100.0	1.8e-31
131526:131570	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
>prophage 2
CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	170934	177461	3031937	tail	Listeria_phage(33.33%)	10	NA	NA
AVV11469.1|170934_171387_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
AVV11470.1|171392_171728_-	XRE family transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
AVV11471.1|171944_172373_+	hypothetical protein	NA	NA	NA	NA	NA
AVV11472.1|172384_172801_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	3.2e-19
AVV11473.1|173080_173470_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
AVV11474.1|173482_173995_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
AVV11475.1|174042_174345_+	segregation and condensation protein B	NA	NA	NA	NA	NA
AVV11476.1|174386_174791_+	phenylalanine racemase	NA	NA	NA	NA	NA
AVV11477.1|174777_176646_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
AVV11478.1|176642_177461_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 3
CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	1270212	1367738	3031937	integrase,portal,capsid,tail,tRNA,protease,terminase,holin	Listeria_phage(83.1%)	115	1296001:1296024	1337184:1337207
AVV12533.1|1270212_1271265_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
AVV12534.1|1271264_1273673_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVV12535.1|1273833_1274535_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
AVV12536.1|1274548_1277959_+	ABC transporter permease	NA	NA	NA	NA	NA
AVV12537.1|1278056_1278509_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVV12538.1|1278524_1281725_+	MMPL family transporter	NA	NA	NA	NA	NA
AVV12539.1|1281828_1282503_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
AVV12540.1|1282540_1283467_-	ribonuclease HIII	NA	NA	NA	NA	NA
AVV12541.1|1283620_1283884_+	cell division protein ZapA	NA	NA	NA	NA	NA
AVV12542.1|1283883_1284426_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AVV12543.1|1284517_1286230_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
AVV12544.1|1286252_1288610_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
AVV12545.1|1288690_1289002_+	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
AVV12546.1|1289077_1290889_+	UvrABC system protein C	NA	NA	NA	NA	NA
AVV12547.1|1291069_1292284_+	aspartate kinase	NA	NA	NA	NA	NA
AVV12548.1|1292339_1292834_-	DUF2507 domain-containing protein	NA	NA	NA	NA	NA
AVV12549.1|1292981_1293782_+	glutamate racemase	NA	NA	NA	NA	NA
AVV12550.1|1293794_1294541_+	ribonuclease PH	NA	NA	NA	NA	NA
AVV12551.1|1294544_1295156_+	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
AVV12552.1|1295192_1295717_+	metallophosphoesterase	NA	NA	NA	NA	NA
1296001:1296024	attL	TTTTATTCCGTTGTTTTTGTGGCA	NA	NA	NA	NA
AVV12553.1|1296002_1297157_-|integrase	site-specific integrase	integrase	Q8W5Y3	Listeria_phage	100.0	2.9e-219
AVV12554.1|1297290_1297722_-	hypothetical protein	NA	R4IBV3	Listeria_phage	100.0	3.8e-71
AVV12555.1|1297772_1298225_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	100.0	1.2e-83
AVV12556.1|1298241_1298562_-	XRE family transcriptional regulator	NA	R4IDX0	Listeria_phage	100.0	1.6e-55
AVV12557.1|1298828_1299035_+	XRE family transcriptional regulator	NA	Q8W5X9	Listeria_phage	100.0	6.4e-29
AVV12558.1|1299037_1299280_+	hypothetical protein	NA	Q8W5X8	Listeria_phage	100.0	8.3e-44
AVV12559.1|1299282_1299468_+	hypothetical protein	NA	Q8W5X7	Listeria_phage	100.0	3.7e-28
AVV12560.1|1300162_1300414_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	100.0	1.1e-38
AVV12561.1|1300432_1300723_+	hypothetical protein	NA	Q8W5X4	Listeria_phage	100.0	2.7e-49
AVV12562.1|1300719_1301532_+	DNA methyltransferase	NA	R4IBV6	Listeria_phage	100.0	1.7e-157
AVV12563.1|1301528_1302134_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	100.0	9.2e-116
AVV12564.1|1302293_1302662_+	hypothetical protein	NA	Q8W5X1	Listeria_phage	100.0	2.4e-66
AVV12565.1|1302658_1303069_+	hypothetical protein	NA	R4ICD6	Listeria_phage	100.0	3.1e-75
AVV12566.1|1303072_1303255_+	hypothetical protein	NA	R4IBV7	Listeria_phage	100.0	2.3e-30
AVV12567.1|1303244_1303520_+	hypothetical protein	NA	R4IBL5	Listeria_phage	100.0	8.6e-45
AVV12568.1|1303506_1303965_+	hypothetical protein	NA	R4IDY1	Listeria_phage	100.0	1.3e-85
AVV12569.1|1303958_1304183_+	hypothetical protein	NA	R4IBJ7	Listeria_phage	100.0	3.1e-37
AVV12570.1|1304179_1304425_+	hypothetical protein	NA	R4ICD9	Listeria_phage	100.0	1.2e-42
AVV12571.1|1304421_1304697_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	100.0	2.8e-48
AVV12572.1|1304874_1305309_+	hypothetical protein	NA	R4IDY3	Listeria_phage	100.0	6.2e-74
AVV12573.1|1305305_1305572_+	hypothetical protein	NA	R4IBK0	Listeria_phage	100.0	5.9e-43
AVV12574.1|1305738_1306122_+	hypothetical protein	NA	R4IBW1	Listeria_phage	100.0	3.2e-66
AVV12575.1|1306123_1306603_+	hypothetical protein	NA	R4IBM0	Listeria_phage	100.0	7.1e-79
AVV12576.1|1306615_1307305_+	DNA-binding protein	NA	R4IDY8	Listeria_phage	100.0	1.2e-130
AVV12577.1|1307368_1308625_+	ATP-dependent helicase	NA	R4IBK4	Listeria_phage	100.0	1.4e-230
AVV12578.1|1308647_1309133_+	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	100.0	2.9e-88
AVV12579.1|1309155_1311429_+	DNA primase	NA	A0A059T6A4	Listeria_phage	98.4	0.0e+00
AVV12580.1|1311715_1312030_+	VRR-NUC domain-containing protein	NA	A0A059T805	Listeria_phage	99.0	1.3e-52
AVV12581.1|1312031_1312301_+	hypothetical protein	NA	W0GBM0	Listeria_phage	71.2	4.5e-14
AVV14230.1|1312411_1312939_+	hypothetical protein	NA	A0A059T7T5	Listeria_phage	84.1	3.2e-80
AVV12582.1|1312938_1313166_+	hypothetical protein	NA	NA	NA	NA	NA
AVV12583.1|1313178_1313604_+	hypothetical protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
AVV12584.1|1313701_1314445_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AVV12585.1|1314942_1315254_+	HNH endonuclease	NA	Q8W5V3	Listeria_phage	100.0	5.5e-56
AVV12586.1|1315259_1315532_+	hypothetical protein	NA	R4IDZ4	Listeria_phage	100.0	5.5e-44
AVV12587.1|1315636_1315999_+|terminase	terminase	terminase	R4IBJ0	Listeria_phage	100.0	1.6e-62
AVV12588.1|1315982_1317635_+|terminase	terminase large subunit	terminase	R4IDU8	Listeria_phage	100.0	0.0e+00
AVV12589.1|1317649_1318837_+|portal	phage portal protein	portal	R4IBH4	Listeria_phage	100.0	9.9e-223
AVV12590.1|1318814_1319567_+|protease	Clp protease ClpP	protease	R4ICB0	Listeria_phage	100.0	2.6e-128
AVV12591.1|1319563_1320736_+|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	100.0	1.1e-221
AVV12592.1|1320701_1320878_+	hypothetical protein	NA	Q858X0	Listeria_phage	83.3	6.3e-17
AVV12593.1|1320864_1321164_+	hypothetical protein	NA	R4IDV2	Listeria_phage	100.0	1.2e-47
AVV12594.1|1321144_1321483_+	hypothetical protein	NA	R4IBH7	Listeria_phage	100.0	4.4e-59
AVV12595.1|1321475_1321886_+	hypothetical protein	NA	R4ICB4	Listeria_phage	99.3	8.0e-71
AVV12596.1|1321875_1322298_+	hypothetical protein	NA	R4IBU7	Listeria_phage	100.0	6.7e-73
AVV12597.1|1322301_1322880_+|tail	phage tail protein	tail	R4IBJ8	Listeria_phage	100.0	1.3e-103
AVV12598.1|1323028_1323391_+	hypothetical protein	NA	R4IBH8	Listeria_phage	100.0	1.6e-59
AVV12599.1|1323572_1326653_+|tail	tail tape measure protein	tail	R4IBU8	Listeria_phage	100.0	0.0e+00
AVV12600.1|1326649_1327357_+|tail	phage tail protein	tail	Q8W5Z6	Listeria_phage	100.0	2.5e-136
AVV12601.1|1327356_1329483_+	hypothetical protein	NA	R4IDV9	Listeria_phage	100.0	0.0e+00
AVV12602.1|1329479_1330601_+	DUF2479 domain-containing protein	NA	R4IBI1	Listeria_phage	100.0	3.2e-178
AVV12603.1|1330597_1330939_+	hypothetical protein	NA	R4ICC1	Listeria_phage	100.0	4.2e-57
AVV12604.1|1330938_1331085_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	100.0	1.1e-19
AVV12605.1|1331121_1331487_+	hypothetical protein	NA	A8ASL3	Listeria_phage	100.0	1.3e-11
AVV12606.1|1331499_1331784_+|holin	holin	holin	R4IDW2	Listeria_phage	100.0	5.7e-44
AVV12607.1|1331780_1332014_+	hypothetical protein	NA	R4IBI3	Listeria_phage	100.0	1.4e-35
AVV12608.1|1332016_1332943_+	N-acetylmuramoyl-L-alanine amidase	NA	R4ICC5	Listeria_phage	96.4	4.9e-177
AVV12609.1|1333301_1334201_+	abortive infection protein	NA	NA	NA	NA	NA
AVV12610.1|1334257_1334467_-	hypothetical protein	NA	R4IBK5	Listeria_phage	100.0	4.2e-28
AVV12611.1|1334910_1335144_+	hypothetical protein	NA	R4IDW6	Listeria_phage	100.0	7.3e-37
AVV12612.1|1335140_1335332_+	hypothetical protein	NA	R4IBI5	Listeria_phage	100.0	1.2e-29
AVV12613.1|1335526_1335628_-|integrase	integrase	integrase	A0A059T688	Listeria_phage	66.7	2.4e-05
AVV12614.1|1336024_1336498_+	hypothetical protein	NA	NA	NA	NA	NA
AVV12615.1|1336603_1336966_+	hypothetical protein	NA	NA	NA	NA	NA
AVV14231.1|1339700_1341764_+	internalin	NA	NA	NA	NA	NA
1337184:1337207	attR	TTTTATTCCGTTGTTTTTGTGGCA	NA	NA	NA	NA
AVV12616.1|1341886_1343245_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
AVV12617.1|1343287_1343881_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12618.1|1344017_1344425_-	VOC family protein	NA	NA	NA	NA	NA
AVV12619.1|1344589_1345189_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
AVV12620.1|1345220_1345481_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12621.1|1345604_1347017_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
AVV12622.1|1347041_1347305_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
AVV12623.1|1347472_1347949_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AVV12624.1|1347986_1348232_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12625.1|1348228_1349434_-	MFS transporter	NA	NA	NA	NA	NA
AVV12626.1|1349430_1349640_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12627.1|1349638_1350298_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AVV12628.1|1350337_1350532_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12629.1|1350598_1351447_-	YitT family protein	NA	NA	NA	NA	NA
AVV12630.1|1352065_1352779_+	trehalose operon repressor	NA	NA	NA	NA	NA
AVV12631.1|1352809_1354456_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AVV12632.1|1354474_1355959_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AVV12633.1|1356076_1356538_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AVV12634.1|1356576_1357041_-	hypothetical protein	NA	NA	NA	NA	NA
AVV12635.1|1357229_1358144_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVV12636.1|1358169_1359417_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	2.7e-106
AVV12637.1|1359400_1360231_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
AVV12638.1|1360377_1361517_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVV12639.1|1361596_1361992_-	XRE family transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
AVV12640.1|1362142_1362358_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVV12641.1|1362481_1363015_+	hypothetical protein	NA	NA	NA	NA	NA
AVV12642.1|1363030_1363696_+	hypothetical protein	NA	NA	NA	NA	NA
AVV12643.1|1363957_1364896_+	hypothetical protein	NA	NA	NA	NA	NA
AVV12644.1|1365010_1366294_+	trigger factor	NA	NA	NA	NA	NA
AVV12645.1|1366478_1367738_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 4
CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	1910178	1918464	3031937		Synechococcus_phage(33.33%)	8	NA	NA
AVV13137.1|1910178_1910745_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
AVV13138.1|1910741_1911791_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
AVV13139.1|1911809_1913237_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
AVV13140.1|1913221_1915441_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
AVV13141.1|1915433_1916117_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AVV13142.1|1916120_1916366_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AVV13143.1|1916377_1917091_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.7e-41
AVV13144.1|1917171_1918464_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	2642091	2649935	3031937		Streptococcus_phage(50.0%)	6	NA	NA
AVV13816.1|2642091_2643063_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
AVV13817.1|2643070_2644039_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
AVV13818.1|2644040_2644916_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
AVV13819.1|2645023_2646754_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	5.6e-174
AVV13820.1|2647872_2648856_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.0e-52
AVV13821.1|2648975_2649935_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
