The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020469	Halomonas sp. 'Soap Lake #6' chromosome, complete genome	4803686	978057	985109	4803686		Enterobacteria_phage(28.57%)	7	NA	NA
AVU12260.1|978057_979227_+	UDP-glucose 6-dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	54.7	2.7e-111
AVU09011.1|979316_980381_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.3	2.5e-100
AVU09012.1|980644_981010_+	GxxExxY protein	NA	G9E611	Micromonas_pusilla_virus	39.8	3.3e-12
AVU09013.1|981354_982251_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.1e-21
AVU09014.1|982610_983507_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	1.1e-104
AVU09015.1|983675_984224_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.2	6.3e-55
AVU09016.1|984227_985109_+	polysaccharide/polyol phosphate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	3.5e-07
>prophage 2
CP020469	Halomonas sp. 'Soap Lake #6' chromosome, complete genome	4803686	2632157	2662117	4803686	transposase	Pseudomonas_phage(25.0%)	38	NA	NA
AVU10381.1|2632157_2632862_-	c repressor	NA	A0A076FRF7	Pseudomonas_phage	54.2	6.8e-70
AVU10382.1|2632918_2633368_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10383.1|2633370_2633808_+	hypothetical protein	NA	A0A0A1IVF5	Pseudomonas_phage	66.2	7.0e-49
AVU10384.1|2633804_2635856_+|transposase	transposase	transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	50.7	2.3e-182
AVU10385.1|2635897_2636617_+	DNA transposition protein	NA	A0A2H4J809	uncultured_Caudovirales_phage	68.5	2.5e-88
AVU10386.1|2636620_2637271_+	hypothetical protein	NA	A0A0U5KPI5	unidentified_phage	29.7	9.8e-15
AVU10387.1|2637267_2637648_+	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	52.7	4.5e-28
AVU10388.1|2637644_2638277_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10389.1|2638273_2638690_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10390.1|2638692_2639325_+	sulfate transporter	NA	Q5ZR10	Pseudomonas_phage	62.1	1.7e-67
AVU10391.1|2639400_2639643_+	hypothetical protein	NA	A0A2P1A4B9	Alteromonadaceae_phage	57.7	5.4e-11
AVU10392.1|2639651_2640062_+	hypothetical protein	NA	A0A2P9JZH3	Alteromonadaceae_phage	59.0	9.5e-40
AVU10393.1|2640051_2640495_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10394.1|2640491_2640914_+	GemA protein	NA	H1ZZD1	Pseudomonas_virus	60.0	1.4e-33
AVU10395.1|2640900_2641329_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10396.1|2641315_2641972_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10397.1|2642009_2642324_+	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	44.3	2.8e-07
AVU10398.1|2642485_2642848_+	serine/threonine protein kinase	NA	A0A140XFU9	Salmonella_phage	59.5	3.1e-34
AVU10399.1|2642850_2643051_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10400.1|2643060_2643402_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10401.1|2643401_2643701_+	hypothetical protein	NA	A0A2P9JZI6	Alteromonadaceae_phage	79.8	9.0e-40
AVU10402.1|2643714_2644266_+	hypothetical protein	NA	A0A2P9JZI7	Alteromonadaceae_phage	58.9	5.9e-53
AVU12342.1|2644289_2645762_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	51.2	7.9e-129
AVU10403.1|2645755_2647366_+	hypothetical protein	NA	A0A0U5KSI0	unidentified_phage	43.2	1.1e-104
AVU10404.1|2647340_2648522_+	hypothetical protein	NA	A0A1B0T6H8	Thiobacimonas_phage	46.7	8.5e-57
AVU10405.1|2648634_2649075_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	25.7	2.8e-05
AVU10406.1|2649243_2650224_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10407.1|2650211_2650769_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10408.1|2650834_2651950_+	hypothetical protein	NA	J9SH47	Pseudomonas_phage	38.7	8.6e-43
AVU10409.1|2651986_2652415_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	49.3	3.7e-26
AVU10410.1|2652456_2653362_+	hypothetical protein	NA	M4SRT6	Rhodobacter_phage	42.1	1.0e-65
AVU10411.1|2653386_2653794_+	hypothetical protein	NA	A0A1B0T6F3	Thiobacimonas_phage	38.3	1.0e-09
AVU10412.1|2653803_2654073_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10413.1|2654072_2654474_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10414.1|2654491_2655421_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	36.6	1.1e-46
AVU10415.1|2655491_2655827_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10416.1|2655874_2656189_+	hypothetical protein	NA	NA	NA	NA	NA
AVU10417.1|2656207_2662117_+	hypothetical protein	NA	A0A2H4JC10	uncultured_Caudovirales_phage	32.2	1.3e-17
>prophage 3
CP020469	Halomonas sp. 'Soap Lake #6' chromosome, complete genome	4803686	2816544	2827519	4803686	tRNA	Klosneuvirus(33.33%)	9	NA	NA
AVU10551.1|2816544_2819157_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	9.9e-82
AVU10552.1|2819296_2819776_-	recombinase RecX	NA	NA	NA	NA	NA
AVU10553.1|2819817_2820882_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	1.3e-112
AVU10554.1|2820972_2821506_-	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	58.8	2.4e-35
AVU10555.1|2821667_2824241_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	1.2e-28
AVU10556.1|2824394_2824718_+	ferredoxin	NA	NA	NA	NA	NA
AVU10557.1|2824740_2825046_-	hypothetical protein	NA	NA	NA	NA	NA
AVU10558.1|2825296_2826586_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	59.5	2.8e-130
AVU12350.1|2826655_2827519_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.6	6.9e-48
>prophage 4
CP020469	Halomonas sp. 'Soap Lake #6' chromosome, complete genome	4803686	2897152	2907851	4803686	integrase,tRNA	uncultured_Mediterranean_phage(50.0%)	9	2890823:2890882	2902069:2902128
2890823:2890882	attL	AAATATGGTGCCGGTGGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
AVU10615.1|2897152_2898205_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	56.2	2.3e-106
AVU10616.1|2898185_2899634_+	hypothetical protein	NA	A7BJX1	Enterobacteria_phage	43.0	7.6e-84
AVU10617.1|2899702_2900995_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	35.0	1.0e-71
AVU10618.1|2900994_2902056_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	42.8	1.6e-75
AVU10619.1|2902273_2903305_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
2902069:2902128	attR	AAATATGGTGCCGGTGGCCAGACTCGAACTGGCACACCCGTAAAGGCGGCGGATTTTGAA	NA	NA	NA	NA
AVU10620.1|2903370_2904489_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.7	8.0e-89
AVU10621.1|2904559_2904886_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	39.1	2.5e-11
AVU10622.1|2905020_2906874_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	22.3	2.3e-08
AVU10623.1|2906924_2907851_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.5	9.6e-40
>prophage 5
CP020469	Halomonas sp. 'Soap Lake #6' chromosome, complete genome	4803686	4677110	4735531	4803686	terminase,portal,capsid,tRNA,plate,integrase,tail	uncultured_Caudovirales_phage(27.27%)	67	4676965:4677024	4715828:4715904
4676965:4677024	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGTCGGCACCACTAAAAGTGGTTATA	NA	NA	NA	NA
AVU12079.1|4677110_4678259_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	44.6	1.4e-80
AVU12080.1|4678255_4678465_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12081.1|4678461_4678752_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	46.5	4.8e-14
AVU12082.1|4678748_4678985_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12083.1|4678983_4679439_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12084.1|4679443_4679659_-	hypothetical protein	NA	Q9ZXI6	Pseudomonas_virus	41.9	2.3e-05
AVU12085.1|4679673_4681980_-	hypothetical protein	NA	F1BUS0	Erwinia_phage	35.3	1.0e-69
AVU12086.1|4681976_4682387_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12087.1|4682411_4682789_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12088.1|4682769_4683165_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12089.1|4683157_4683349_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12090.1|4683386_4683590_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12091.1|4683625_4683832_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12092.1|4683892_4684423_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12093.1|4684578_4685244_+	hypothetical protein	NA	A0A1C6ZDG7	Pseudomonas_phage	27.6	3.1e-16
AVU12451.1|4685312_4685876_+	hypothetical protein	NA	M1PSB6	Streptococcus_phage	41.8	5.9e-24
AVU12094.1|4685904_4687197_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12095.1|4687264_4687564_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12096.1|4687553_4687787_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12097.1|4688048_4688399_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12098.1|4688793_4690074_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12099.1|4690453_4690876_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12100.1|4690859_4691540_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12101.1|4691771_4692191_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	54.8	2.5e-35
AVU12452.1|4692229_4692412_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	64.4	1.6e-15
AVU12102.1|4692496_4693483_-	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	47.4	1.2e-80
AVU12103.1|4693479_4693923_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	59.1	6.6e-39
AVU12104.1|4693937_4697252_-|tail	phage tail tape measure protein	tail	D4HTW4	Vibrio_phage	30.7	6.3e-57
AVU12105.1|4697261_4697399_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	68.6	1.0e-06
AVU12106.1|4697440_4697842_-	hypothetical protein	NA	A4PE51	Ralstonia_virus	51.8	1.9e-16
AVU12107.1|4697904_4698414_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	48.0	7.4e-42
AVU12108.1|4698448_4699618_-|tail	phage tail protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	66.1	2.4e-152
AVU12109.1|4699774_4700581_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12110.1|4700611_4700800_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12111.1|4700815_4701619_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12112.1|4701633_4703775_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	46.8	7.2e-30
AVU12113.1|4703779_4704466_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	42.6	2.5e-32
AVU12114.1|4704458_4705352_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	52.1	2.9e-73
AVU12115.1|4705348_4705687_-	hypothetical protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	53.2	2.7e-24
AVU12116.1|4705686_4706256_-	hypothetical protein	NA	A0A077K9S0	Ralstonia_phage	50.4	1.6e-29
AVU12117.1|4706332_4706788_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	53.0	2.1e-35
AVU12118.1|4706784_4707270_-	hypothetical protein	NA	A0A2H4J906	uncultured_Caudovirales_phage	40.4	9.9e-20
AVU12119.1|4707381_4707804_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12120.1|4707800_4708286_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	60.5	1.6e-41
AVU12121.1|4708275_4708479_-	hypothetical protein	NA	A0A2H4J9Q9	uncultured_Caudovirales_phage	58.1	4.6e-11
AVU12122.1|4708487_4708703_-|tail	phage tail protein	tail	F1BUQ5	Erwinia_phage	47.0	1.6e-09
AVU12123.1|4708699_4709167_-	hypothetical protein	NA	A0A2H4JCS4	uncultured_Caudovirales_phage	38.8	2.6e-17
AVU12124.1|4709268_4709949_-	hypothetical protein	NA	E5FFI5	Burkholderia_phage	45.8	1.6e-44
AVU12125.1|4709958_4710975_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	60.5	4.5e-115
AVU12126.1|4711029_4711851_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	48.7	1.3e-56
AVU12453.1|4711996_4713787_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	59.6	2.0e-206
AVU12127.1|4713776_4714835_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	57.5	1.2e-107
AVU12128.1|4715143_4715329_+	hypothetical protein	NA	NA	NA	NA	NA
AVU12454.1|4716193_4717141_-	hypothetical protein	NA	NA	NA	NA	NA
4715828:4715904	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGTCGGCACCACTAAAAGTGGTTATAAAGCAAAGCGTTAGAGA	NA	NA	NA	NA
AVU12129.1|4717254_4717728_-	hypothetical protein	NA	NA	NA	NA	NA
AVU12130.1|4717900_4718869_+	ectoine hydroxylase	NA	NA	NA	NA	NA
AVU12131.1|4718991_4719657_+	isomerase/hydrolase	NA	NA	NA	NA	NA
AVU12132.1|4719892_4721809_-	arginine decarboxylase	NA	NA	NA	NA	NA
AVU12133.1|4721808_4722765_-	homoserine kinase	NA	NA	NA	NA	NA
AVU12134.1|4722939_4725729_+	DNA polymerase I	NA	A0A1B1IST8	uncultured_Mediterranean_phage	26.2	1.5e-43
AVU12135.1|4725828_4726854_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVU12455.1|4727092_4728184_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	9.0e-29
AVU12456.1|4728180_4729905_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVU12136.1|4730077_4731409_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AVU12137.1|4731405_4731909_-	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AVU12138.1|4731972_4733076_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVU12139.1|4733392_4735531_+|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
