The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	0	9238	5369387		Burkholderia_virus(100.0%)	1	NA	NA
AVT86526.1|7942_9238_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
>prophage 2
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	14536	19071	5369387	tRNA	Streptomyces_phage(25.0%)	5	NA	NA
AVT86531.1|14536_14962_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AVT86532.1|15165_16251_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVT86533.1|16308_16998_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AVT86534.1|17310_17694_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AVT86535.1|17739_19071_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
>prophage 3
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	24840	46907	5369387	tRNA	Bacillus_phage(25.0%)	21	NA	NA
AVT86542.1|24840_26640_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
AVT86543.1|26655_27630_+	signal peptidase I	NA	NA	NA	NA	NA
AVT86544.1|27879_28560_+	ribonuclease 3	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
AVT86545.1|28556_29462_+	GTPase Era	NA	NA	NA	NA	NA
AVT86546.1|29473_30211_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVT86547.1|30222_30954_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVT86548.1|30953_31334_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVT86549.1|31346_31607_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
AVT86550.1|31663_32512_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AVT86551.1|32725_33361_+	acid phosphatase AphA	NA	NA	NA	NA	NA
AVT86552.1|33390_33933_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	2.6e-05
AVT86553.1|33929_35546_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AVT86554.1|35720_39608_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	5.0e-130
AVT86555.1|39665_39911_-	hypothetical protein	NA	NA	NA	NA	NA
AVT86556.1|40197_41619_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	1.1e-13
AVT86557.1|41627_42335_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVT86558.1|42321_43659_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.0	1.0e-10
AVT86559.1|43724_44063_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AVT86560.1|44137_45328_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AVT86561.1|45368_45635_+	hypothetical protein	NA	NA	NA	NA	NA
AVT86562.1|45653_46907_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	1.9e-99
>prophage 4
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	62154	68475	5369387		Faustovirus(20.0%)	8	NA	NA
AVT86575.1|62154_63369_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.8	3.2e-35
AVT86576.1|63395_63782_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AVT86577.1|63799_64123_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AVT86578.1|64197_64713_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVT86579.1|64728_66579_+	molecular chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.4e-103
AVT86580.1|66580_66916_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVT86581.1|66917_67118_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVT86582.1|67188_68475_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	38.2	5.8e-35
>prophage 5
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	78987	79419	5369387		Powai_lake_megavirus(100.0%)	1	NA	NA
AVT86588.1|78987_79419_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 6
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	89739	96364	5369387		Bodo_saltans_virus(33.33%)	4	NA	NA
AVT86599.1|89739_91131_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
AVT86600.1|91289_92756_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AVT86601.1|92823_94401_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVT86602.1|94495_96364_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 7
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	100133	100325	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT86606.1|100133_100325_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
>prophage 8
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	106736	108412	5369387		Prochlorococcus_phage(100.0%)	2	NA	NA
AVT86610.1|106736_107378_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AVT86611.1|107374_108412_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	1.8e-71
>prophage 9
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	111951	114958	5369387	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
AVT86615.1|111951_113238_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AVT86616.1|113336_114038_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AVT86617.1|114034_114958_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 10
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	121603	122317	5369387		Cyanophage(100.0%)	1	NA	NA
AVT86625.1|121603_122317_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
>prophage 11
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	157220	160797	5369387		Paenibacillus_phage(50.0%)	5	NA	NA
AVT86658.1|157220_158093_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.2e-17
AVT86659.1|158304_158730_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVT86660.1|158716_159166_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVT86661.1|159227_159803_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVT86662.1|159897_160797_+	peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.8e-25
>prophage 12
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	164150	166275	5369387		Bacillus_virus(50.0%)	2	NA	NA
AVT86666.1|164150_165245_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	7.2e-26
AVT86667.1|165363_166275_+	cysteine synthase CysM	NA	A0A1W6JHY1	Lactococcus_phage	40.3	2.2e-52
>prophage 13
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	169884	179811	5369387		Hokovirus(25.0%)	9	NA	NA
AVT86673.1|169884_171612_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
AVT86674.1|171656_171914_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVT86675.1|172294_173266_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.3	3.3e-75
AVT86676.1|173442_174204_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVT91354.1|174437_175496_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVT86677.1|175565_177581_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	9.8e-146
AVT86678.1|177582_177801_+	hypothetical protein	NA	NA	NA	NA	NA
AVT86679.1|177797_178796_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVT86680.1|178884_179811_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	4.1e-06
>prophage 14
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	194301	196748	5369387		Clostridioides_phage(50.0%)	2	NA	NA
AVT91356.1|194301_195039_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
AVT86691.1|195050_196748_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	8.8e-47
>prophage 15
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	200018	204602	5369387		Pandoravirus(25.0%)	5	NA	NA
AVT86695.1|200018_200477_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
AVT86696.1|200609_201518_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
AVT86697.1|201527_202409_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
AVT86698.1|202777_203260_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVT86699.1|203672_204602_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
>prophage 16
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	213717	214803	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT86708.1|213717_214803_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
>prophage 17
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	223288	224425	5369387		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVT86716.1|223288_224425_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
>prophage 18
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	230865	232383	5369387		Mollivirus(100.0%)	1	NA	NA
AVT86724.1|230865_232383_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	7.7e-87
>prophage 19
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	236676	237450	5369387		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVT86730.1|236676_237450_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.9e-09
>prophage 20
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	249852	250452	5369387		Salmonella_phage(100.0%)	1	NA	NA
AVT86744.1|249852_250452_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 21
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	278481	279423	5369387	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVT86770.1|278481_279423_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.5e-67
>prophage 22
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	282538	283744	5369387		Oenococcus_phage(100.0%)	1	NA	NA
AVT86775.1|282538_283744_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	6.1e-26
>prophage 23
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	291589	303720	5369387		Pseudomonas_phage(33.33%)	9	NA	NA
AVT86782.1|291589_292660_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
AVT86783.1|292656_292962_-	oxidoreductase	NA	NA	NA	NA	NA
AVT86784.1|293123_293378_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
AVT86785.1|293377_294508_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
AVT86786.1|294609_296895_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
AVT86787.1|297007_297196_-	hypothetical protein	NA	NA	NA	NA	NA
AVT86788.1|297239_297968_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AVT86789.1|298114_300748_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	4.6e-95
AVT86790.1|300879_303720_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
>prophage 24
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	307860	311259	5369387		Enterobacteria_phage(50.0%)	3	NA	NA
AVT86793.1|307860_308964_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.4	2.8e-118
AVT86794.1|309068_310121_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVT86795.1|310194_311259_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	49.5	2.0e-17
>prophage 25
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	315179	316340	5369387		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVT86799.1|315179_316340_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.2	6.6e-78
>prophage 26
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	331020	335837	5369387	integrase	Vibrio_phage(100.0%)	5	320359:320379	332482:332502
320359:320379	attL	TTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
AVT86811.1|331020_332277_-|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.7	1.3e-103
AVT86812.1|332636_334397_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
332482:332502	attR	TTTGGTCGGCACGAGAGGATT	NA	NA	NA	NA
AVT86813.1|334415_334643_-	hypothetical protein	NA	NA	NA	NA	NA
AVT86814.1|334585_334831_-	hypothetical protein	NA	NA	NA	NA	NA
AVT86815.1|334829_335837_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	1.2e-83
>prophage 27
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	340071	346158	5369387		Vibrio_phage(33.33%)	5	NA	NA
AVT86821.1|340071_341829_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	6.4e-101
AVT86822.1|341976_342696_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVT86823.1|342692_343889_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.2	2.6e-21
AVT86824.1|344220_344565_+	hypothetical protein	NA	NA	NA	NA	NA
AVT86825.1|344568_346158_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	4.5e-21
>prophage 28
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	351913	356224	5369387		Clostridioides_phage(50.0%)	4	NA	NA
AVT86830.1|351913_352483_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.0	3.1e-12
AVT91360.1|352908_353616_-	hypothetical protein	NA	NA	NA	NA	NA
AVT86831.1|353659_354637_-	GTP-binding protein	NA	NA	NA	NA	NA
AVT86832.1|354757_356224_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.2	3.2e-45
>prophage 29
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	364056	364911	5369387		Catovirus(100.0%)	1	NA	NA
AVT86841.1|364056_364911_-	endonuclease	NA	A0A1V0SBL9	Catovirus	32.7	3.4e-23
>prophage 30
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	369311	373218	5369387		Acinetobacter_phage(50.0%)	3	NA	NA
AVT86845.1|369311_371285_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.8e-12
AVT86846.1|371355_372189_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVT86847.1|372549_373218_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	3.4e-55
>prophage 31
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	376982	378503	5369387		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVT86851.1|376982_378503_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	3.1e-11
>prophage 32
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	394525	395080	5369387		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVT86865.1|394525_395080_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.8	1.3e-20
>prophage 33
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	401613	402561	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT86869.1|401613_402561_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.2e-24
>prophage 34
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	406047	408666	5369387	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
AVT86873.1|406047_406518_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	74.4	6.6e-61
AVT86874.1|406632_408666_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	8.9e-54
>prophage 35
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	430778	435796	5369387		Bacillus_phage(50.0%)	4	NA	NA
AVT91365.1|430778_431672_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AVT86893.1|431918_433280_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AVT86894.1|433598_434321_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVT86895.1|434317_435796_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 36
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	452915	459995	5369387		Catovirus(25.0%)	5	NA	NA
AVT86906.1|452915_453557_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
AVT86907.1|453647_454229_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
AVT86908.1|454259_456107_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVT86909.1|456749_458333_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
AVT91366.1|459104_459995_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	5.6e-45
>prophage 37
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	477649	497507	5369387		Enterobacteria_phage(16.67%)	15	NA	NA
AVT86921.1|477649_479056_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AVT86922.1|479278_480343_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.2e-105
AVT86923.1|480369_481239_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AVT86924.1|481270_482161_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AVT86925.1|482175_482730_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AVT86926.1|482909_484076_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AVT86927.1|485020_486025_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
AVT91368.1|487070_487838_+	ABC transporter permease	NA	NA	NA	NA	NA
AVT86928.1|487837_488578_+	sugar ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	25.7	3.9e-07
AVT86929.1|488593_490489_+	glycosyl transferase	NA	NA	NA	NA	NA
AVT86930.1|490504_491659_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.5	8.5e-78
AVT86931.1|492560_493691_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVT86932.1|493786_494995_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
AVT86933.1|495064_496525_-	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	43.0	3.2e-106
AVT86934.1|496526_497507_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.8	5.2e-44
>prophage 38
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	504217	505117	5369387		Cellulophaga_phage(100.0%)	1	NA	NA
AVT91369.1|504217_505117_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.4e-11
>prophage 39
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	509623	514718	5369387		Streptococcus_phage(50.0%)	3	NA	NA
AVT86947.1|509623_511726_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.9	2.2e-63
AVT86948.1|511949_513374_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AVT86949.1|513548_514718_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	80.5	3.8e-182
>prophage 40
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	530239	531076	5369387		Mycobacterium_phage(100.0%)	1	NA	NA
AVT86968.1|530239_531076_+	alpha/beta hydrolase	NA	A0A2D1GKK1	Mycobacterium_phage	28.8	4.8e-14
>prophage 41
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	551479	559922	5369387		Burkholderia_phage(40.0%)	8	NA	NA
AVT86984.1|551479_552625_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
AVT86985.1|553163_553445_+	hypothetical protein	NA	NA	NA	NA	NA
AVT86986.1|553487_554195_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AVT86987.1|554238_555672_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.1e-101
AVT91373.1|555652_556147_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	51.4	2.6e-31
AVT86988.1|556121_557033_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVT86989.1|557216_558128_+	hypothetical protein	NA	NA	NA	NA	NA
AVT86990.1|558242_559922_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 42
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	566523	567276	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT86999.1|566523_567276_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
>prophage 43
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	583882	585397	5369387		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVT87019.1|583882_585397_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
>prophage 44
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	592334	608881	5369387	tRNA	Tupanvirus(25.0%)	18	NA	NA
AVT87026.1|592334_594068_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AVT87027.1|594303_594873_+	VOC family protein	NA	NA	NA	NA	NA
AVT87028.1|594949_595693_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVT87029.1|595774_596779_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVT87030.1|596775_597519_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AVT87031.1|597558_597954_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87032.1|598006_598825_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AVT87033.1|598821_599388_-	hydrolase	NA	NA	NA	NA	NA
AVT87034.1|599655_601443_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AVT87035.1|601444_601888_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AVT87036.1|601915_602656_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVT87037.1|602690_603212_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AVT87038.1|603291_603903_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVT87039.1|603911_604922_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AVT87040.1|604985_605771_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVT87041.1|605770_606523_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
AVT87042.1|606601_607546_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT87043.1|607561_608881_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
>prophage 45
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	612806	614282	5369387		Cyanophage(100.0%)	1	NA	NA
AVT87048.1|612806_614282_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
>prophage 46
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	621707	622676	5369387		Pseudoalteromonas_phage(50.0%)	2	NA	NA
AVT87055.1|621707_622367_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.2	4.9e-14
AVT87056.1|622445_622676_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
>prophage 47
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	626400	627054	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT87059.1|626400_627054_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	8.0e-57
>prophage 48
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	634561	636610	5369387		Moraxella_phage(100.0%)	1	NA	NA
AVT87067.1|634561_636610_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
>prophage 49
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	641846	642056	5369387		Morganella_phage(100.0%)	1	NA	NA
AVT87076.1|641846_642056_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 50
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	649496	651056	5369387		Moraxella_phage(100.0%)	1	NA	NA
AVT87083.1|649496_651056_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.1e-40
>prophage 51
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	654958	662327	5369387	tRNA	Pandoravirus(33.33%)	7	NA	NA
AVT87087.1|654958_656314_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	40.4	2.3e-42
AVT87088.1|656402_656588_+	YoaH family protein	NA	NA	NA	NA	NA
AVT87089.1|656588_656933_-	RidA family protein	NA	NA	NA	NA	NA
AVT87090.1|657064_658975_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.4	1.5e-90
AVT87091.1|659120_659816_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVT87092.1|659854_660436_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91379.1|660641_662327_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.7e-34
>prophage 52
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	677952	678564	5369387		Geobacillus_virus(100.0%)	1	NA	NA
AVT87108.1|677952_678564_+	murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 53
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	695739	698034	5369387		Tetraselmis_virus(100.0%)	1	NA	NA
AVT87124.1|695739_698034_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.4e-159
>prophage 54
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	701895	712641	5369387		Staphylococcus_phage(40.0%)	11	NA	NA
AVT87128.1|701895_702771_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
AVT87129.1|702767_703487_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
AVT87130.1|703492_704386_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT87131.1|704669_706313_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
AVT87132.1|706362_706839_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVT87133.1|706939_707866_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT91382.1|708169_709465_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
AVT87134.1|709479_710286_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT87135.1|710260_711160_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT87136.1|711269_711752_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
AVT87137.1|711942_712641_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	6.9e-06
>prophage 55
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	735015	737767	5369387		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVT87156.1|735015_736695_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
AVT87157.1|736819_737767_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
>prophage 56
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	740979	746693	5369387		Pseudomonas_phage(33.33%)	7	NA	NA
AVT87161.1|740979_742062_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
AVT87162.1|742061_742910_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVT87163.1|742909_743302_+	siroheme synthase	NA	NA	NA	NA	NA
AVT87164.1|743305_744118_+	hypothetical protein	NA	NA	NA	NA	NA
AVT87165.1|744157_745012_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	2.3e-48
AVT87166.1|745098_746199_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVT87167.1|746462_746693_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	48.0	5.4e-08
>prophage 57
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	752203	752992	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87173.1|752203_752992_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	2.6e-30
>prophage 58
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	769484	771020	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT87181.1|769484_771020_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	2.8e-20
>prophage 59
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	775032	781302	5369387		Synechococcus_phage(25.0%)	7	NA	NA
AVT87186.1|775032_775875_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	43.1	8.3e-14
AVT87187.1|775917_776388_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87188.1|776488_777391_+	patatin family protein	NA	NA	NA	NA	NA
AVT87189.1|777480_778494_+	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	29.4	1.1e-07
AVT87190.1|778691_779594_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.6	1.8e-59
AVT87191.1|779715_780123_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AVT87192.1|780684_781302_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.2e-54
>prophage 60
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	789561	792457	5369387		Planktothrix_phage(33.33%)	3	NA	NA
AVT87199.1|789561_790575_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.7	3.8e-13
AVT87200.1|790571_791576_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	2.6e-14
AVT87201.1|791629_792457_+	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	3.9e-08
>prophage 61
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	802115	809284	5369387	tRNA	Tupanvirus(25.0%)	7	NA	NA
AVT87213.1|802115_804044_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
AVT87214.1|804047_804590_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
AVT87215.1|804682_804880_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVT87216.1|804930_805287_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVT87217.1|805593_806577_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
AVT87218.1|806592_808980_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVT87219.1|808984_809284_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
>prophage 62
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	816350	824319	5369387		Brazilian_cedratvirus(25.0%)	8	NA	NA
AVT87227.1|816350_817100_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	6.4e-10
AVT87228.1|817181_817646_+	lipoprotein	NA	NA	NA	NA	NA
AVT87229.1|817759_819202_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.7	4.4e-55
AVT87230.1|819231_819459_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVT91384.1|819566_820613_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.4e-82
AVT91385.1|820767_821601_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVT87231.1|821745_821865_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87232.1|821940_824319_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	1.4e-172
>prophage 63
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	834298	835060	5369387		Indivirus(100.0%)	1	NA	NA
AVT87241.1|834298_835060_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-15
>prophage 64
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	851551	852772	5369387		environmental_halophage(100.0%)	1	NA	NA
AVT87257.1|851551_852772_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	9.9e-93
>prophage 65
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	862692	863442	5369387		Erysipelothrix_phage(100.0%)	1	NA	NA
AVT87269.1|862692_863442_-	ABC transporter ATP-binding protein	NA	A0A2I4R674	Erysipelothrix_phage	29.4	4.8e-05
>prophage 66
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	870879	872843	5369387		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVT87277.1|870879_871830_+	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.6e-34
AVT87278.1|871826_872843_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.7	1.5e-41
>prophage 67
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	883475	887757	5369387		Bacillus_virus(50.0%)	3	NA	NA
AVT87288.1|883475_884249_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-31
AVT87289.1|884357_886430_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVT87290.1|886935_887757_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	8.6e-16
>prophage 68
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	907278	908349	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87307.1|907278_908349_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	4.1e-26
>prophage 69
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	925595	926219	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT87322.1|925595_926219_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	4.7e-06
>prophage 70
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	950158	950989	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87348.1|950158_950989_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.4e-26
>prophage 71
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	960569	961334	5369387		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVT87358.1|960569_961334_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	36.6	2.6e-30
>prophage 72
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	964504	965203	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87362.1|964504_965203_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.5	3.2e-27
>prophage 73
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	992068	994017	5369387		Klosneuvirus(50.0%)	2	NA	NA
AVT87385.1|992068_993040_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.5	1.9e-09
AVT87386.1|993036_994017_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.5e-11
>prophage 74
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	999201	999972	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT87391.1|999201_999972_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.4	3.2e-12
>prophage 75
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1005448	1006333	5369387		Burkholderia_virus(100.0%)	1	NA	NA
AVT87399.1|1005448_1006333_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.3	4.3e-21
>prophage 76
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1010298	1018396	5369387		Enterococcus_phage(25.0%)	9	NA	NA
AVT87404.1|1010298_1010877_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.5	1.3e-18
AVT87405.1|1010869_1010953_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87406.1|1011017_1011254_-	acid-shock protein	NA	NA	NA	NA	NA
AVT87407.1|1011429_1012803_-	multidrug resistance protein MdtK	NA	NA	NA	NA	NA
AVT87408.1|1013032_1013668_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
AVT87409.1|1013704_1014853_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	1.2e-84
AVT87410.1|1015145_1016327_-	Bcr/CflA family multidrug efflux transporter	NA	NA	NA	NA	NA
AVT87411.1|1016439_1017444_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT87412.1|1017370_1018396_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.9	1.2e-30
>prophage 77
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1021667	1022540	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87417.1|1021667_1022540_-	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	39.5	1.7e-17
>prophage 78
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1026727	1028215	5369387		Indivirus(50.0%)	2	NA	NA
AVT87424.1|1026727_1027624_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	2.3e-06
AVT87425.1|1027693_1028215_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	58.0	1.1e-51
>prophage 79
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1032021	1033383	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87430.1|1032021_1033383_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.7	6.9e-18
>prophage 80
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1036719	1037994	5369387	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVT87435.1|1036719_1037994_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.1e-86
>prophage 81
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1049249	1050620	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT87447.1|1049249_1050620_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	35.1	2.1e-67
>prophage 82
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1056171	1058222	5369387		Escherichia_phage(50.0%)	3	NA	NA
AVT87455.1|1056171_1056699_+	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	46.8	5.9e-18
AVT87456.1|1056803_1057079_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AVT87457.1|1057103_1058222_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	1.8e-32
>prophage 83
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1065047	1067688	5369387		Moumouvirus(100.0%)	2	NA	NA
AVT87463.1|1065047_1066553_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	38.0	7.3e-29
AVT87464.1|1066599_1067688_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	24.4	6.9e-05
>prophage 84
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1078119	1080081	5369387	protease	Phage_TP(100.0%)	1	NA	NA
AVT87477.1|1078119_1080081_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.0	5.1e-22
>prophage 85
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1086994	1088008	5369387		Mycoplasma_phage(100.0%)	1	NA	NA
AVT87483.1|1086994_1088008_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.4	2.1e-24
>prophage 86
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1103699	1105790	5369387		Salmonella_phage(100.0%)	1	NA	NA
AVT91399.1|1103699_1105790_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	67.6	1.6e-138
>prophage 87
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1110370	1110922	5369387		Leuconostoc_phage(100.0%)	1	NA	NA
AVT87506.1|1110370_1110922_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	33.7	8.1e-10
>prophage 88
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1116860	1117640	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87513.1|1116860_1117640_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.6e-19
>prophage 89
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1127076	1127778	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT91400.1|1127076_1127778_+	ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.8e-31
>prophage 90
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1140832	1142332	5369387		Mycobacterium_phage(100.0%)	1	NA	NA
AVT87530.1|1140832_1142332_+	methyl viologen resistance protein SmvA	NA	A0A0M3UL24	Mycobacterium_phage	29.3	7.8e-31
>prophage 91
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1148811	1149585	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87538.1|1148811_1149585_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	3.8e-05
>prophage 92
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1160856	1162473	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT87551.1|1160856_1162473_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	5.6e-19
>prophage 93
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1166061	1170825	5369387		Tupanvirus(66.67%)	4	NA	NA
AVT87555.1|1166061_1167072_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.8	4.9e-29
AVT87556.1|1167324_1167924_+	pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	5.0e-21
AVT87557.1|1168119_1169073_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVT87558.1|1169109_1170825_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	24.0	1.2e-32
>prophage 94
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1176674	1179011	5369387		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
AVT91401.1|1176674_1177547_-	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	58.6	1.3e-83
AVT87565.1|1178244_1178430_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AVT87566.1|1178795_1179011_+	hypothetical protein	NA	H9NCK9	Mycobacterium_phage	48.0	9.4e-07
>prophage 95
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1183818	1184223	5369387		Stx_converting_phage(100.0%)	1	NA	NA
AVT87573.1|1183818_1184223_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	41.6	2.0e-10
>prophage 96
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1194240	1196853	5369387		Rathayibacter_phage(100.0%)	1	NA	NA
AVT87584.1|1194240_1196853_+	alpha-L-rhamnosidase	NA	A0A1P8VV88	Rathayibacter_phage	21.3	4.1e-11
>prophage 97
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1203014	1203695	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87592.1|1203014_1203695_+	magnesium transport protein MgtC	NA	G3MA03	Bacillus_virus	41.9	2.1e-15
>prophage 98
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1219091	1221172	5369387		Bacillus_phage(100.0%)	2	NA	NA
AVT87605.1|1219091_1219832_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	1.5e-30
AVT87606.1|1219828_1221172_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	1.0e-10
>prophage 99
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1226359	1230477	5369387		Klosneuvirus(50.0%)	4	NA	NA
AVT87609.1|1226359_1227745_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.0	7.4e-28
AVT87610.1|1228051_1228987_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AVT87611.1|1229011_1229752_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT87612.1|1229748_1230477_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	3.7e-18
>prophage 100
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1236471	1237728	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87619.1|1236471_1237728_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	4.0e-20
>prophage 101
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1263840	1264578	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT87646.1|1263840_1264578_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	3.0e-36
>prophage 102
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1280188	1281241	5369387		Enterobacteria_phage(100.0%)	1	NA	NA
AVT91406.1|1280188_1281241_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.6	1.2e-14
>prophage 103
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1289241	1291577	5369387	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
AVT87671.1|1289241_1289646_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AVT87672.1|1289642_1289990_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVT87673.1|1290038_1291577_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
>prophage 104
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1298376	1299159	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT87681.1|1298376_1299159_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.4e-15
>prophage 105
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1312567	1313086	5369387		Erysipelothrix_phage(100.0%)	1	NA	NA
AVT87693.1|1312567_1313086_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	38.2	4.4e-26
>prophage 106
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1333810	1335187	5369387		Streptomyces_phage(50.0%)	2	NA	NA
AVT87712.1|1333810_1334134_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	3.2e-14
AVT87713.1|1334161_1335187_-	alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.0	4.4e-25
>prophage 107
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1339242	1340799	5369387		Catovirus(100.0%)	1	NA	NA
AVT87719.1|1339242_1340799_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	24.4	1.5e-16
>prophage 108
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1348161	1349337	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT87726.1|1348161_1349337_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	6.1e-39
>prophage 109
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1375039	1376419	5369387		Enterobacteria_phage(100.0%)	1	NA	NA
AVT87753.1|1375039_1376419_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	6.9e-18
>prophage 110
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1386912	1387704	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT87765.1|1386912_1387704_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	30.0	7.2e-20
>prophage 111
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1400090	1401464	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT91408.1|1400090_1401464_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	2.9e-16
>prophage 112
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1406912	1407674	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT87787.1|1406912_1407674_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	36.2	2.7e-32
>prophage 113
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1412197	1413148	5369387		Catovirus(100.0%)	1	NA	NA
AVT87792.1|1412197_1413148_+	hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.7	7.3e-35
>prophage 114
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1418225	1418600	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT91410.1|1418225_1418600_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	2.3e-08
>prophage 115
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1421845	1423351	5369387		Staphylococcus_phage(50.0%)	2	NA	NA
AVT87802.1|1421845_1422544_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	3.6e-15
AVT87803.1|1422553_1423351_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	2.4e-10
>prophage 116
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1427502	1428606	5369387		uncultured_virus(100.0%)	1	NA	NA
AVT87807.1|1427502_1428606_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	3.1e-101
>prophage 117
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1432506	1443392	5369387		Escherichia_phage(87.5%)	9	NA	NA
AVT87811.1|1432506_1435614_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AVT87812.1|1435668_1436934_+	MFS transporter	NA	NA	NA	NA	NA
AVT87813.1|1436964_1438053_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AVT87814.1|1438139_1438400_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AVT87815.1|1438696_1439557_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AVT87816.1|1439577_1440339_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVT87817.1|1440599_1441502_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVT87818.1|1441513_1442779_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AVT87819.1|1442771_1443392_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 118
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1453692	1461666	5369387		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
AVT87831.1|1453692_1454367_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.6	4.8e-81
AVT91412.1|1454417_1455260_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVT87832.1|1455281_1455674_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AVT87833.1|1455751_1457797_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.7	3.5e-18
AVT87834.1|1457927_1458677_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AVT87835.1|1458769_1459456_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVT87836.1|1459506_1459938_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
AVT87837.1|1460202_1461666_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	2.3e-43
>prophage 119
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1466002	1470575	5369387		Escherichia_phage(100.0%)	4	NA	NA
AVT87843.1|1466002_1468438_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.0e-215
AVT87844.1|1468448_1469066_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AVT87845.1|1469067_1469925_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
AVT87846.1|1469966_1470575_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	6.4e-24
>prophage 120
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1487698	1488658	5369387		Salmonella_phage(100.0%)	1	NA	NA
AVT87862.1|1487698_1488658_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
>prophage 121
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1498101	1500879	5369387		Lactobacillus_phage(100.0%)	1	NA	NA
AVT87872.1|1498101_1500879_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	1.1e-65
>prophage 122
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1520225	1520741	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT87890.1|1520225_1520741_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 123
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1531984	1533286	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT87903.1|1531984_1533286_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	2.9e-18
>prophage 124
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1546085	1549613	5369387		Salmonella_phage(50.0%)	6	NA	NA
AVT87913.1|1546085_1546289_+	selenoprotein YdfZ	NA	J9Q802	Salmonella_phage	73.1	2.6e-22
AVT87914.1|1546358_1546877_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87915.1|1547074_1547428_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
AVT87916.1|1547531_1548740_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
AVT87917.1|1548736_1548970_+	SirA-like protein	NA	NA	NA	NA	NA
AVT87918.1|1549220_1549613_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	38.5	3.0e-19
>prophage 125
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1561792	1562998	5369387		Klosneuvirus(100.0%)	1	NA	NA
AVT87929.1|1561792_1562998_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	9.0e-22
>prophage 126
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1571684	1576322	5369387		Bacillus_phage(50.0%)	2	NA	NA
AVT87937.1|1571684_1572359_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	52.5	6.0e-31
AVT87938.1|1572419_1576322_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.2	5.0e-53
>prophage 127
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1602523	1603513	5369387		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVT87964.1|1602523_1603513_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.9	2.5e-70
>prophage 128
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1608631	1615747	5369387	tRNA	Escherichia_phage(40.0%)	8	NA	NA
AVT87969.1|1608631_1609756_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.8	3.8e-115
AVT87970.1|1609899_1610112_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AVT87971.1|1610193_1610628_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
AVT87972.1|1610861_1611797_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
AVT87973.1|1611842_1613216_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
AVT87974.1|1613230_1613425_-	hypothetical protein	NA	NA	NA	NA	NA
AVT87975.1|1613741_1614725_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVT91417.1|1615003_1615747_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.7e-15
>prophage 129
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1623358	1624372	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT87984.1|1623358_1624372_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.7e-29
>prophage 130
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1649942	1651041	5369387	transposase	Leptospira_phage(100.0%)	1	NA	NA
AVT88006.1|1649942_1651041_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.7e-47
>prophage 131
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1660561	1665728	5369387		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVT88014.1|1660561_1663081_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.3e-19
AVT88015.1|1663073_1665728_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	5.9e-98
>prophage 132
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1673715	1676226	5369387		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AVT88022.1|1673715_1675248_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
AVT88023.1|1675464_1676226_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	4.1e-20
>prophage 133
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1688730	1694506	5369387		Hokovirus(50.0%)	3	NA	NA
AVT88036.1|1688730_1691424_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-60
AVT88037.1|1691413_1693612_+	glycoside hydrolase family 2	NA	NA	NA	NA	NA
AVT88038.1|1693636_1694506_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
>prophage 134
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1725183	1726987	5369387		Planktothrix_phage(50.0%)	2	NA	NA
AVT88065.1|1725183_1726176_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AVT88066.1|1726177_1726987_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 135
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1731617	1733552	5369387		Bodo_saltans_virus(100.0%)	1	NA	NA
AVT88070.1|1731617_1733552_+	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
>prophage 136
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1739142	1739745	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT88079.1|1739142_1739745_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
>prophage 137
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1744585	1749951	5369387	protease	Tupanvirus(50.0%)	5	NA	NA
AVT88084.1|1744585_1747183_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	3.7e-89
AVT88085.1|1747589_1747841_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88086.1|1747888_1748935_-|protease	protease SohB	protease	NA	NA	NA	NA
AVT88087.1|1748979_1749195_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88088.1|1749189_1749951_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
>prophage 138
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1760087	1763045	5369387		Acinetobacter_phage(100.0%)	2	NA	NA
AVT88100.1|1760087_1761683_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.8e-47
AVT88101.1|1761686_1763045_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	3.3e-36
>prophage 139
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1775288	1775966	5369387		Cyanophage(100.0%)	1	NA	NA
AVT88112.1|1775288_1775966_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	33.8	3.3e-21
>prophage 140
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1783260	1784022	5369387		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVT88120.1|1783260_1784022_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	1.8e-15
>prophage 141
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1795257	1796085	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT88131.1|1795257_1796085_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	2.7e-70
>prophage 142
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1802768	1803989	5369387		Klosneuvirus(100.0%)	1	NA	NA
AVT88138.1|1802768_1803989_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.0e-26
>prophage 143
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1810046	1810679	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT88145.1|1810046_1810679_+	sulfate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	7.8e-09
>prophage 144
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1815981	1817928	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT88150.1|1815981_1817928_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	8.2e-41
>prophage 145
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1824421	1826486	5369387		Tupanvirus(50.0%)	2	NA	NA
AVT88157.1|1824421_1825063_+	nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.1	1.4e-18
AVT88158.1|1825232_1826486_+	chitinase	NA	D2J4H7	Artogeia_rapae_granulovirus	25.6	2.6e-24
>prophage 146
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1830169	1831024	5369387		Indivirus(100.0%)	1	NA	NA
AVT88164.1|1830169_1831024_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	26.0	4.7e-17
>prophage 147
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1834298	1892953	5369387	terminase,tRNA,portal,tail,plate,capsid,integrase	Enterobacteria_phage(45.0%)	68	1852508:1852529	1889215:1889236
AVT88167.1|1834298_1835582_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.7e-10
AVT88168.1|1835627_1836191_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88169.1|1836349_1836832_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	39.1	1.6e-17
AVT88170.1|1836953_1837265_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88171.1|1837522_1838404_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT88172.1|1838579_1839797_+	MFS transporter	NA	NA	NA	NA	NA
AVT88173.1|1839793_1840543_-	oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	4.3e-14
AVT88174.1|1840709_1841615_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT88175.1|1841621_1842887_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	79.4	2.9e-196
AVT88176.1|1842889_1843309_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	5.5e-35
AVT88177.1|1843387_1844872_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AVT88178.1|1845488_1845731_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	4.1e-27
AVT88179.1|1845901_1847041_-	glycosyl transferase	NA	NA	NA	NA	NA
AVT88180.1|1847284_1847785_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AVT88181.1|1847901_1848348_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AVT91426.1|1848331_1849123_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVT88182.1|1849224_1850409_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AVT88183.1|1850440_1851133_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88184.1|1851278_1851788_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AVT88185.1|1851774_1852131_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AVT88186.1|1852120_1852360_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
1852508:1852529	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVT88187.1|1852624_1852876_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AVT88188.1|1852919_1854059_-	hypothetical protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AVT88189.1|1855384_1855900_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AVT88190.1|1855945_1856263_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AVT91427.1|1856262_1856421_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AVT88191.1|1856407_1859383_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
AVT88192.1|1859398_1859890_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
AVT88193.1|1861645_1862743_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AVT88194.1|1862742_1862955_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88195.1|1862951_1865978_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AVT88196.1|1865967_1866891_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
AVT88197.1|1866892_1867243_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
AVT88198.1|1867239_1867827_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AVT88199.1|1867823_1868459_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AVT88200.1|1868455_1868923_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AVT91428.1|1869104_1869434_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AVT88201.1|1869445_1869991_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
AVT88202.1|1869987_1870272_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVT88203.1|1870262_1870463_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AVT88204.1|1870462_1870978_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
AVT88205.1|1871082_1871949_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
AVT88206.1|1871998_1873033_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AVT88207.1|1873043_1873883_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
AVT88208.1|1874039_1875767_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
AVT88209.1|1875760_1876822_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
AVT88210.1|1877298_1878051_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88211.1|1878143_1878368_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91429.1|1878972_1879980_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88212.1|1879972_1881919_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
AVT88213.1|1882176_1884324_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
AVT88214.1|1884361_1885297_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AVT91430.1|1885293_1885521_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AVT88215.1|1885529_1886096_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
AVT88216.1|1886092_1886317_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88217.1|1886394_1886658_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88218.1|1886673_1887051_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88219.1|1887066_1887285_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AVT88220.1|1887305_1887584_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AVT88221.1|1887704_1888004_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AVT88222.1|1888119_1889103_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AVT88223.1|1889367_1890381_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
1889215:1889236	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AVT88224.1|1890438_1890540_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91431.1|1890539_1890614_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88225.1|1890731_1890857_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88226.1|1890916_1891180_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVT88227.1|1891310_1891949_-	leucine efflux protein	NA	NA	NA	NA	NA
AVT88228.1|1892038_1892953_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 148
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1896241	1898026	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT88232.1|1896241_1898026_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
>prophage 149
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1912647	1912854	5369387		Phage_21(100.0%)	1	NA	NA
AVT88251.1|1912647_1912854_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.2e-20
>prophage 150
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1916228	1924241	5369387		Klebsiella_phage(33.33%)	6	NA	NA
AVT88255.1|1916228_1917494_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.2	1.3e-207
AVT88256.1|1917495_1917915_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
AVT88257.1|1917993_1919478_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AVT88258.1|1920485_1920908_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.1e-26
AVT88259.1|1920958_1921537_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.7	2.3e-92
AVT88260.1|1923485_1924241_+	hypothetical protein	NA	A0A159B7L2	Klebsiella_phage	91.6	7.7e-128
>prophage 151
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1928581	1975367	5369387	head,holin,terminase,portal,protease,tail,capsid,integrase	Enterobacterial_phage(12.77%)	60	1950737:1950752	1983073:1983088
AVT88261.1|1928581_1931659_-	kinase	NA	A0A286S259	Klebsiella_phage	61.4	0.0e+00
AVT88262.1|1931655_1932036_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	1.3e-56
AVT88263.1|1932048_1932525_-	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AVT88264.1|1932511_1932985_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
AVT88265.1|1933005_1936587_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	60.4	7.6e-250
AVT88266.1|1936649_1937171_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.8	3.8e-09
AVT88267.1|1937244_1937550_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	2.1e-28
AVT88268.1|1937552_1937957_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
AVT88269.1|1937987_1938692_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
AVT88270.1|1938748_1939096_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
AVT88271.1|1939092_1939542_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	82.6	5.1e-63
AVT88272.1|1939538_1939877_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	5.1e-39
AVT91432.1|1939889_1940222_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
AVT88273.1|1940227_1940482_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88274.1|1940527_1941748_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	3.7e-140
AVT88275.1|1941757_1942465_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.2e-68
AVT88276.1|1942440_1943760_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.9	7.6e-139
AVT88277.1|1943766_1945503_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.3e-138
AVT88278.1|1945456_1945921_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.8e-47
AVT88279.1|1946104_1946446_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	2.1e-48
AVT88280.1|1946455_1946692_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88281.1|1947350_1947596_-	hypothetical protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.5e-34
AVT88282.1|1947750_1947942_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91433.1|1948871_1949231_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88283.1|1950310_1950604_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	5.2e-32
AVT88284.1|1950689_1950872_+	hypothetical protein	NA	NA	NA	NA	NA
1950737:1950752	attL	CTGCATCACCGCCAGC	NA	NA	NA	NA
AVT88285.1|1951077_1951704_-	endolysin	NA	F1C591	Cronobacter_phage	76.8	9.9e-89
AVT88286.1|1951703_1951985_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
AVT88287.1|1951971_1952400_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	71.5	3.0e-44
AVT91434.1|1952611_1952827_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91435.1|1953132_1953900_-	hypothetical protein	NA	J7KHM1	Erwinia_phage	75.1	2.9e-106
AVT88288.1|1954235_1954523_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88289.1|1954567_1955620_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.3	1.2e-171
AVT88290.1|1955769_1955961_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	84.1	8.3e-23
AVT88291.1|1956170_1957001_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.5	2.4e-58
AVT91436.1|1957019_1958006_-	hypothetical protein	NA	Q8SBE5	Shigella_phage	48.6	1.8e-89
AVT88292.1|1958087_1958909_-	DNA-binding protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
AVT88293.1|1958998_1959397_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	3.6e-44
AVT88294.1|1959393_1959870_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	61.8	1.4e-15
AVT88295.1|1959866_1961717_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.3	9.5e-196
AVT88296.1|1961709_1963092_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.6	4.4e-105
AVT88297.1|1963079_1963538_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVT88298.1|1963534_1964446_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	79.0	9.1e-51
AVT88299.1|1964435_1964615_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
AVT88300.1|1964787_1965336_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.0	6.0e-66
AVT88301.1|1965416_1965884_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88302.1|1966117_1966348_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	51.6	2.7e-12
AVT88303.1|1966445_1967078_+	DNA-binding protein	NA	A0A1I9KG86	Aeromonas_phage	43.0	7.8e-33
AVT88304.1|1967349_1967865_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88305.1|1968681_1969053_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	79.5	7.0e-50
AVT88306.1|1969105_1969936_+	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	81.3	3.5e-126
AVT88307.1|1970073_1970601_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.7	1.8e-62
AVT88308.1|1970600_1970801_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88309.1|1970793_1971579_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	2.6e-62
AVT88310.1|1971706_1972051_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88311.1|1972116_1972335_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.6	3.5e-09
AVT88312.1|1972331_1972607_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	37.2	3.8e-08
AVT88313.1|1972635_1972872_+	excisionase	NA	NA	NA	NA	NA
AVT88314.1|1972861_1974004_+|integrase	integrase	integrase	Q77Z02	Phage_21	82.0	2.4e-173
AVT88315.1|1974116_1975367_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	92.6	1.1e-19
1983073:1983088	attR	GCTGGCGGTGATGCAG	NA	NA	NA	NA
>prophage 152
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1978595	1979966	5369387		Bodo_saltans_virus(100.0%)	1	NA	NA
AVT88319.1|1978595_1979966_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.6e-107
>prophage 153
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1986531	1987668	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT88326.1|1986531_1987668_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.0	2.6e-31
>prophage 154
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	1992101	1996941	5369387		Staphylococcus_phage(50.0%)	3	NA	NA
AVT88331.1|1992101_1993730_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	1.9e-27
AVT88332.1|1993967_1995971_-	transketolase	NA	NA	NA	NA	NA
AVT88333.1|1995990_1996941_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	38.3	3.5e-13
>prophage 155
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2004202	2007953	5369387		Vibrio_phage(50.0%)	4	NA	NA
AVT88340.1|2004202_2005033_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	5.3e-21
AVT88341.1|2005047_2005959_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVT88342.1|2006007_2007252_-	lipoprotein-releasing system transmembrane subunit LolE	NA	NA	NA	NA	NA
AVT88343.1|2007251_2007953_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.4	7.8e-34
>prophage 156
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2027677	2028319	5369387		Pseudomonas_phage(100.0%)	1	NA	NA
AVT88361.1|2027677_2028319_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	37.0	3.8e-27
>prophage 157
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2031598	2032780	5369387		Ralstonia_phage(50.0%)	2	NA	NA
AVT88364.1|2031598_2031835_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVT88365.1|2032045_2032780_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.0e-15
>prophage 158
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2051925	2052177	5369387		Salmonella_phage(100.0%)	1	NA	NA
AVT88381.1|2051925_2052177_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	50.0	3.0e-12
>prophage 159
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2055418	2056339	5369387		Morganella_phage(100.0%)	1	NA	NA
AVT88387.1|2055418_2056339_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	42.2	3.3e-56
>prophage 160
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2064689	2065217	5369387		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AVT88394.1|2064689_2065217_-	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	45.3	1.3e-28
>prophage 161
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2072943	2074002	5369387		Cronobacter_phage(100.0%)	1	NA	NA
AVT88403.1|2072943_2074002_-	phosphate starvation protein PhoH	NA	R4II13	Cronobacter_phage	77.6	8.6e-93
>prophage 162
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2090565	2094086	5369387		Enterobacteria_phage(100.0%)	4	NA	NA
AVT88417.1|2090565_2091060_+	FMN reductase	NA	Q9KX93	Enterobacteria_phage	75.0	6.9e-37
AVT88418.1|2091081_2092404_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.8	8.2e-202
AVT88419.1|2092810_2093749_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVT88420.1|2093912_2094086_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 163
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2114722	2121298	5369387		Hokovirus(50.0%)	4	NA	NA
AVT88441.1|2114722_2117224_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	1.1e-10
AVT88442.1|2117533_2118610_+	PTS fructose-like transporter subunit EIIC	NA	NA	NA	NA	NA
AVT88443.1|2118630_2118951_+	PTS fructose-like transporter subunit EIIB	NA	NA	NA	NA	NA
AVT88444.1|2119000_2121298_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
>prophage 164
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2124368	2126561	5369387		Bacillus_phage(50.0%)	3	NA	NA
AVT88449.1|2124368_2125289_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	9.0e-14
AVT88450.1|2125356_2125536_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88451.1|2125532_2126561_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	1.5e-12
>prophage 165
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2131559	2137078	5369387		Iris_mild_mosaic_virus(50.0%)	3	NA	NA
AVT88456.1|2131559_2133986_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	5.5e-10
AVT88457.1|2134496_2136149_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AVT88458.1|2136418_2137078_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
>prophage 166
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2142021	2144076	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT88467.1|2142021_2144076_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.0	1.8e-14
>prophage 167
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2148104	2149589	5369387		Pseudomonas_phage(100.0%)	1	NA	NA
AVT88472.1|2148104_2149589_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
>prophage 168
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2158678	2160586	5369387		Tupanvirus(100.0%)	1	NA	NA
AVT88483.1|2158678_2160586_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.6e-49
>prophage 169
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2169352	2174475	5369387		Bacillus_virus(33.33%)	3	NA	NA
AVT88492.1|2169352_2170126_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.7e-29
AVT88493.1|2170330_2172946_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.3e-20
AVT88494.1|2173272_2174475_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.5	5.1e-41
>prophage 170
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2180536	2183608	5369387	tRNA	Bandra_megavirus(50.0%)	2	NA	NA
AVT88499.1|2180536_2181937_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
AVT88500.1|2182528_2183608_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	53.0	1.9e-100
>prophage 171
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2200970	2205513	5369387		Bacillus_phage(100.0%)	3	NA	NA
AVT88515.1|2200970_2202719_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	3.5e-59
AVT88516.1|2202755_2205020_-	ComEC family protein	NA	NA	NA	NA	NA
AVT88517.1|2205225_2205513_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.2e-10
>prophage 172
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2209686	2210775	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT88521.1|2209686_2210775_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	1.0e-80
>prophage 173
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2214826	2244956	5369387	protease,tRNA	Tetraselmis_virus(13.33%)	23	NA	NA
AVT88524.1|2214826_2217109_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	6.5e-162
AVT88525.1|2217300_2218041_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.4e-20
AVT88526.1|2218203_2219352_-	MFS transporter	NA	NA	NA	NA	NA
AVT88527.1|2219468_2219615_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVT88528.1|2219626_2220490_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVT88529.1|2220491_2221109_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
AVT88530.1|2221119_2223558_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.2	2.8e-219
AVT88531.1|2223758_2225051_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AVT88532.1|2225141_2226485_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
AVT88533.1|2226493_2227105_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVT88534.1|2227227_2231481_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AVT88535.1|2231616_2232111_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVT88536.1|2232643_2233612_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AVT88537.1|2233726_2235493_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	3.0e-21
AVT88538.1|2235493_2237215_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
AVT88539.1|2237259_2237961_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVT88540.1|2238314_2238533_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVT88541.1|2238652_2240932_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AVT88542.1|2240962_2241280_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVT88543.1|2241605_2241827_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVT88544.1|2241781_2241964_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88545.1|2241903_2243844_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AVT88546.1|2243840_2244956_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 174
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2257767	2262117	5369387		Roseobacter_phage(50.0%)	5	NA	NA
AVT88555.1|2257767_2258598_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AVT88556.1|2258629_2259769_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AVT88557.1|2259821_2260001_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88558.1|2260646_2261162_+	lipoprotein	NA	NA	NA	NA	NA
AVT88559.1|2261388_2262117_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
>prophage 175
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2265261	2276849	5369387		Bacillus_phage(33.33%)	13	NA	NA
AVT88563.1|2265261_2266734_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AVT88564.1|2266730_2267447_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AVT88565.1|2267525_2268653_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AVT88566.1|2268694_2269183_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVT88567.1|2269240_2270086_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVT88568.1|2270082_2271036_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVT91451.1|2271046_2272180_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AVT88569.1|2272343_2273456_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVT88570.1|2273804_2274284_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVT88571.1|2274372_2275275_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AVT88572.1|2275389_2276112_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVT88573.1|2276095_2276383_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88574.1|2276585_2276849_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
>prophage 176
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2284321	2286321	5369387		Escherichia_phage(50.0%)	2	NA	NA
AVT88582.1|2284321_2285080_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.6	2.4e-12
AVT88583.1|2285118_2286321_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.6	8.5e-97
>prophage 177
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2298185	2300045	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT88593.1|2298185_2300045_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.2	6.3e-14
>prophage 178
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2304288	2306721	5369387		Bacteriophage(100.0%)	1	NA	NA
AVT88598.1|2304288_2306721_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	47.4	8.0e-09
>prophage 179
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2314703	2316296	5369387		Tupanvirus(100.0%)	1	NA	NA
AVT88603.1|2314703_2316296_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.0e-60
>prophage 180
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2319305	2320682	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT88607.1|2319305_2320682_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	23.6	2.5e-23
>prophage 181
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2324684	2329836	5369387		Escherichia_phage(33.33%)	6	NA	NA
AVT88612.1|2324684_2325197_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.7e-14
AVT88613.1|2325548_2326436_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVT88614.1|2326673_2327177_+	DNA starvation/stationary phase protection protein	NA	A0A222Z0F3	Streptomyces_phage	47.6	9.3e-05
AVT88615.1|2327585_2328332_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVT88616.1|2328457_2329117_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVT88617.1|2329113_2329836_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	3.3e-35
>prophage 182
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2333880	2341863	5369387		Erwinia_phage(20.0%)	8	NA	NA
AVT88621.1|2333880_2334171_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	47.9	1.4e-05
AVT88622.1|2334191_2334458_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	51.1	1.4e-15
AVT88623.1|2334743_2335004_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88624.1|2335113_2336082_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVT88625.1|2336111_2338268_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	8.8e-44
AVT88626.1|2338455_2339811_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	1.1e-47
AVT88627.1|2340025_2341018_-	transketolase	NA	NA	NA	NA	NA
AVT88628.1|2341017_2341863_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.3	3.1e-08
>prophage 183
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2347068	2348808	5369387		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVT88634.1|2347068_2348808_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	5.7e-17
>prophage 184
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2359447	2360353	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT88651.1|2359447_2360353_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.4	1.1e-27
>prophage 185
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2366850	2367573	5369387		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVT88659.1|2366850_2367573_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.9e-07
>prophage 186
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2371376	2376938	5369387		Klosneuvirus(50.0%)	4	NA	NA
AVT91456.1|2371376_2372666_+	adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.8e-18
AVT88665.1|2372736_2373213_+	kinase inhibitor	NA	NA	NA	NA	NA
AVT88666.1|2373930_2375313_-	amino acid permease	NA	NA	NA	NA	NA
AVT88667.1|2375411_2376938_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.0	4.9e-81
>prophage 187
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2383536	2391392	5369387		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
AVT88672.1|2383536_2386224_-	carbonate dehydratase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.3	2.9e-68
AVT88673.1|2386275_2386707_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	41.4	1.3e-23
AVT88674.1|2387240_2388326_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVT88675.1|2388326_2391392_+	AcrB/AcrD/AcrF family protein	NA	S5VL66	Leptospira_phage	20.6	5.1e-21
>prophage 188
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2394500	2395235	5369387		Enterobacteria_phage(100.0%)	1	NA	NA
AVT88681.1|2394500_2395235_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	1.4e-49
>prophage 189
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2400082	2406605	5369387		Planktothrix_phage(33.33%)	7	NA	NA
AVT91458.1|2400082_2401141_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-18
AVT88688.1|2401143_2401833_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVT88689.1|2401832_2402606_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT88690.1|2402748_2402898_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVT88691.1|2403050_2403839_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVT88692.1|2403906_2405379_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	24.1	2.0e-10
AVT88693.1|2405588_2406605_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	6.8e-79
>prophage 190
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2410966	2414477	5369387		Edwardsiella_phage(33.33%)	4	NA	NA
AVT88697.1|2410966_2412019_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.0	2.6e-81
AVT88698.1|2412333_2412699_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88699.1|2412816_2413761_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.4	3.4e-24
AVT88700.1|2413757_2414477_-	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	34.1	1.3e-23
>prophage 191
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2438803	2439595	5369387		Kaumoebavirus(100.0%)	1	NA	NA
AVT88720.1|2438803_2439595_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.2	2.1e-11
>prophage 192
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2445404	2452834	5369387		Acinetobacter_phage(33.33%)	6	NA	NA
AVT88728.1|2445404_2446883_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	29.3	4.9e-46
AVT88729.1|2446854_2448297_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	33.1	5.1e-56
AVT91462.1|2448480_2448687_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVT88730.1|2448996_2449086_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVT88731.1|2449085_2450765_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVT88732.1|2450785_2452834_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.5	6.0e-26
>prophage 193
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2459660	2460434	5369387		Mycobacterium_phage(100.0%)	1	NA	NA
AVT88739.1|2459660_2460434_+	alpha/beta hydrolase	NA	A0A286MQ79	Mycobacterium_phage	29.7	2.2e-05
>prophage 194
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2465122	2468924	5369387	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AVT88747.1|2465122_2466790_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	93.5	0.0e+00
AVT88748.1|2466968_2468924_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	6.4e-09
>prophage 195
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2473677	2475342	5369387		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVT88754.1|2473677_2475342_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.7	7.2e-86
>prophage 196
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2479382	2480429	5369387		Pseudomonas_phage(100.0%)	1	NA	NA
AVT88758.1|2479382_2480429_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.2e-47
>prophage 197
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2486433	2487159	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT88764.1|2486433_2487159_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	1.2e-29
>prophage 198
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2490423	2495554	5369387	tRNA	Moraxella_phage(50.0%)	3	NA	NA
AVT88767.1|2490423_2492217_+	filamentous hemagglutinin	NA	A0A0R6PJK4	Moraxella_phage	36.9	5.1e-29
AVT91464.1|2492262_2492745_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88768.1|2492971_2495554_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	8.0e-185
>prophage 199
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2502598	2505085	5369387		Synechococcus_phage(50.0%)	2	NA	NA
AVT88777.1|2502598_2503747_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.1e-08
AVT88778.1|2503885_2505085_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.0	6.5e-105
>prophage 200
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2509960	2510621	5369387		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVT88785.1|2509960_2510344_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	6.8e-24
AVT88786.1|2510411_2510621_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	1.2e-22
>prophage 201
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2514711	2516782	5369387		Morganella_phage(50.0%)	2	NA	NA
AVT88791.1|2514711_2515140_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	7.4e-19
AVT88792.1|2515216_2516782_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	4.9e-44
>prophage 202
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2519917	2533632	5369387	tRNA	Streptococcus_phage(20.0%)	12	NA	NA
AVT88796.1|2519917_2521141_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	4.1e-62
AVT88797.1|2521125_2521752_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	48.2	1.1e-52
AVT88798.1|2521752_2522913_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AVT88799.1|2523039_2523729_+	acireductone synthase	NA	NA	NA	NA	NA
AVT88800.1|2523725_2524268_+	1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase	NA	NA	NA	NA	NA
AVT88801.1|2524375_2526685_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.3	1.8e-82
AVT88802.1|2527093_2528074_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT88803.1|2528070_2529621_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.1e-16
AVT88804.1|2529617_2530607_+	ABC transporter permease	NA	NA	NA	NA	NA
AVT88805.1|2530603_2531608_+	ABC transporter permease	NA	NA	NA	NA	NA
AVT88806.1|2531619_2532561_+	sugar kinase	NA	NA	NA	NA	NA
AVT88807.1|2532603_2533632_-	dihydrofolate reductase	NA	A0A2R8FCS0	Cedratvirus	34.0	9.4e-28
>prophage 203
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2550743	2552246	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT88821.1|2550743_2552246_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	4.9e-17
>prophage 204
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2567855	2572596	5369387		Pithovirus(50.0%)	2	NA	NA
AVT88834.1|2567855_2568650_+	iron-enterobactin transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.1	1.0e-13
AVT88835.1|2568714_2572596_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	27.6	9.0e-55
>prophage 205
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2584765	2586310	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT88845.1|2584765_2586310_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.3	3.6e-15
>prophage 206
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2593012	2598925	5369387	holin	Vibrio_phage(50.0%)	4	NA	NA
AVT88852.1|2593012_2595046_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.7	5.8e-21
AVT91469.1|2595042_2595258_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88853.1|2595174_2595762_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT88854.1|2597260_2598925_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
>prophage 207
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2603482	2605010	5369387		Planktothrix_phage(100.0%)	2	NA	NA
AVT88859.1|2603482_2604319_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	9.1e-13
AVT88860.1|2604305_2605010_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.6	2.3e-25
>prophage 208
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2608196	2612876	5369387		Bacillus_virus(50.0%)	5	NA	NA
AVT88864.1|2608196_2608958_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	2.6e-19
AVT88865.1|2608950_2609616_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT88866.1|2609630_2610272_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVT88867.1|2610319_2611171_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT88868.1|2611412_2612876_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	4.8e-17
>prophage 209
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2621844	2624559	5369387		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVT88875.1|2621844_2624559_-	carbonate dehydratase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.0	1.0e-65
>prophage 210
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2651411	2653276	5369387		Escherichia_phage(33.33%)	3	NA	NA
AVT91472.1|2651411_2651771_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	90.7	1.2e-57
AVT88901.1|2651774_2652077_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.0	2.2e-17
AVT88902.1|2652160_2653276_-	class II histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	32.7	1.5e-39
>prophage 211
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2668607	2669405	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT88915.1|2668607_2669405_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.0e-14
>prophage 212
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2676027	2681829	5369387		Bacillus_phage(50.0%)	5	NA	NA
AVT88921.1|2676027_2677428_+	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	24.3	1.1e-15
AVT91474.1|2677457_2678462_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT88922.1|2678477_2679119_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88923.1|2679302_2680334_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT88924.1|2680344_2681829_-	D-xylose ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	20.0	4.9e-09
>prophage 213
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2690071	2693396	5369387	tRNA	Catovirus(50.0%)	2	NA	NA
AVT88933.1|2690071_2691589_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AVT88934.1|2691920_2693396_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
>prophage 214
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2699619	2700540	5369387		Morganella_phage(100.0%)	1	NA	NA
AVT88939.1|2699619_2700540_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
>prophage 215
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2706316	2708551	5369387	transposase	Escherichia_phage(33.33%)	4	NA	NA
AVT88946.1|2706316_2707297_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AVT88947.1|2707344_2707533_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88948.1|2707991_2708309_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	1.2e-21
AVT88949.1|2708311_2708551_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	2.8e-20
>prophage 216
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2712862	2758117	5369387	head,terminase,tRNA,integrase	Enterobacteria_phage(19.64%)	67	2707791:2707836	2755189:2755234
2707791:2707836	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVT88951.1|2712862_2713906_-	hypothetical protein	NA	A0A2R3UAP8	Myoviridae_environmental_samples	43.3	9.9e-17
AVT88952.1|2713907_2714495_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
AVT88953.1|2714487_2715720_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	6.7e-105
AVT88954.1|2715727_2716084_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88955.1|2716159_2716948_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88956.1|2716947_2717535_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.2	5.9e-27
AVT88957.1|2717524_2718394_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.0	6.1e-28
AVT88958.1|2718390_2718696_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
AVT88959.1|2718697_2719537_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	33.3	7.7e-28
AVT88960.1|2719540_2721499_-	transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	38.1	9.8e-42
AVT88961.1|2721703_2722180_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
AVT88962.1|2722241_2722772_-	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	94.9	6.4e-89
AVT88963.1|2722952_2723396_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88964.1|2723395_2724877_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	3.0e-59
AVT88965.1|2724880_2725432_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88966.1|2725413_2725782_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	9.5e-07
AVT88967.1|2725778_2726342_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	3.0e-20
AVT88968.1|2726344_2726788_-	DUF4054 domain-containing protein	NA	E2GLV0	Acinetobacter_phage	41.7	1.3e-13
AVT88969.1|2726787_2727114_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	4.8e-10
AVT88970.1|2727115_2728153_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
AVT88971.1|2728152_2728635_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.7e-32
AVT88972.1|2728636_2729803_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.1	9.9e-58
AVT88973.1|2729806_2730505_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	47.3	6.8e-54
AVT88974.1|2730557_2732078_-	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.0	1.3e-105
AVT88975.1|2732078_2733755_-|terminase	terminase	terminase	H9C191	Pectobacterium_phage	74.4	1.8e-249
AVT88976.1|2733756_2734242_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	78.9	6.3e-67
AVT88977.1|2734272_2734908_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
AVT88978.1|2735230_2735548_-	Rz1 lytic protein	NA	Q8SBD8	Shigella_phage	70.2	8.7e-33
AVT88979.1|2735752_2736256_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	1.3e-75
AVT88980.1|2736258_2736573_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
AVT88981.1|2736567_2736801_+	hypothetical protein	NA	NA	NA	NA	NA
AVT88982.1|2737204_2737894_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	4.2e-64
AVT88983.1|2737890_2738031_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88984.1|2738027_2738252_-	protein ninY	NA	Q76H69	Enterobacteria_phage	60.3	1.7e-22
AVT88985.1|2738248_2738830_-	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	4.9e-42
AVT88986.1|2738822_2738993_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	75.0	1.5e-15
AVT88987.1|2738992_2739448_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
AVT88988.1|2739707_2739947_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
AVT88989.1|2739939_2740245_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.0	1.4e-27
AVT88990.1|2740241_2740664_-	hypothetical protein	NA	V5UT79	Shigella_phage	41.3	6.8e-09
AVT88991.1|2740836_2741298_-	hypothetical protein	NA	NA	NA	NA	NA
AVT88992.1|2741294_2741789_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	58.5	1.1e-45
AVT88993.1|2741785_2742328_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	53.6	1.0e-28
AVT88994.1|2742324_2742618_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AVT88995.1|2742614_2743484_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.0e-96
AVT88996.1|2743468_2744323_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	1.7e-62
AVT88997.1|2744408_2744630_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AVT88998.1|2744670_2744898_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AVT91475.1|2745009_2745708_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	6.2e-108
AVT88999.1|2745853_2746258_+	hypothetical protein	NA	NA	NA	NA	NA
AVT89000.1|2746961_2747156_+	hypothetical protein	NA	NA	NA	NA	NA
AVT89001.1|2747243_2748245_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.4	4.2e-65
AVT89002.1|2748252_2748537_+	hypothetical protein	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AVT89003.1|2748552_2749398_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	1.5e-68
AVT89004.1|2749628_2750015_+	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.8	1.8e-16
AVT89005.1|2750007_2750694_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.1	1.3e-113
AVT89006.1|2750690_2750849_+	hypothetical protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	4.3e-09
AVT89007.1|2750845_2751373_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	6.4e-57
AVT89008.1|2751369_2752140_+	dcm methylase	NA	D5LH17	Escherichia_phage	52.4	9.4e-65
AVT91476.1|2752355_2752892_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.9	4.2e-72
AVT89009.1|2752888_2753110_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	51.4	1.4e-13
AVT91477.1|2753147_2753771_+	AP2 domain-containing protein	NA	A0A2I7R856	Vibrio_phage	48.6	3.9e-37
AVT89010.1|2754010_2755174_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	2.5e-202
AVT89011.1|2755243_2755567_-	hypothetical protein	NA	NA	NA	NA	NA
2755189:2755234	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AVT89012.1|2755605_2756472_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AVT89013.1|2756473_2756686_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVT89014.1|2756731_2758117_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 217
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2766661	2767348	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT91478.1|2766661_2767348_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
>prophage 218
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2770530	2775736	5369387		Bacillus_virus(50.0%)	5	NA	NA
AVT89027.1|2770530_2771208_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.7e-22
AVT89028.1|2771348_2772266_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVT89029.1|2772262_2772721_+	NfeD family protein	NA	NA	NA	NA	NA
AVT89030.1|2772717_2773128_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AVT91480.1|2773234_2775736_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	3.6e-113
>prophage 219
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2785854	2793665	5369387	transposase	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
AVT89038.1|2785854_2787729_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
AVT89039.1|2787840_2788446_-	recombination protein RecR	NA	NA	NA	NA	NA
AVT89040.1|2788445_2788778_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVT89041.1|2788835_2790743_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.7e-43
AVT89042.1|2790835_2791387_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
AVT89043.1|2791537_2791915_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AVT89044.1|2791984_2792512_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AVT89045.1|2792524_2792698_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AVT89046.1|2792765_2793665_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.6	9.3e-64
>prophage 220
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2799186	2808577	5369387		Leptospira_phage(33.33%)	10	NA	NA
AVT89050.1|2799186_2802333_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
AVT89051.1|2802818_2803193_+	Hha toxicity attenuator	NA	NA	NA	NA	NA
AVT89052.1|2803219_2803438_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT89053.1|2803596_2804163_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AVT89054.1|2804295_2804766_+	hypothetical protein	NA	NA	NA	NA	NA
AVT89055.1|2804740_2806192_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
AVT89056.1|2806292_2806991_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVT89057.1|2806987_2807128_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVT89058.1|2807127_2807391_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AVT89059.1|2807506_2808577_-	lac repressor	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
>prophage 221
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2817751	2818861	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT89067.1|2817751_2818861_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	32.7	5.4e-13
>prophage 222
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2829801	2833345	5369387		Bacillus_phage(100.0%)	2	NA	NA
AVT89078.1|2829801_2831580_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.0e-38
AVT89079.1|2831572_2833345_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.1e-47
>prophage 223
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2837772	2838474	5369387		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVT89084.1|2837772_2838474_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.1e-88
>prophage 224
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2841704	2846873	5369387	protease	Sodalis_phage(25.0%)	4	NA	NA
AVT89088.1|2841704_2841977_-	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
AVT89089.1|2842186_2844541_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	2.7e-224
AVT89090.1|2844724_2845999_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	7.3e-131
AVT89091.1|2846249_2846873_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	3.8e-64
>prophage 225
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2861179	2862877	5369387		Lactobacillus_phage(100.0%)	1	NA	NA
AVT89107.1|2861179_2862877_+	FAD-binding dehydrogenase	NA	A0A2P0ZL82	Lactobacillus_phage	25.5	3.2e-17
>prophage 226
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2875663	2880322	5369387		Klosneuvirus(33.33%)	6	NA	NA
AVT89120.1|2875663_2876638_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	21.2	1.6e-08
AVT89121.1|2876683_2877187_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AVT89122.1|2877179_2878151_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AVT89123.1|2878222_2878642_-	N utilization substance protein B	NA	NA	NA	NA	NA
AVT89124.1|2878661_2879132_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVT89125.1|2879218_2880322_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
>prophage 227
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2883921	2888260	5369387	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVT89131.1|2883921_2884893_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.1	3.6e-45
AVT89132.1|2884903_2886751_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVT89133.1|2886777_2887110_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	4.9e-10
AVT89134.1|2887132_2888260_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	6.1e-89
>prophage 228
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2905062	2913582	5369387		Bacillus_phage(60.0%)	6	NA	NA
AVT89150.1|2905062_2906358_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.0	2.2e-26
AVT89151.1|2906379_2907069_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	3.7e-36
AVT89152.1|2907251_2908457_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	35.5	1.8e-06
AVT89153.1|2908453_2911591_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.9	1.0e-08
AVT89154.1|2911664_2912579_-	fructokinase	NA	NA	NA	NA	NA
AVT89155.1|2912670_2913582_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	5.5e-104
>prophage 229
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2934670	2935438	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT89177.1|2934670_2935438_-	taurine transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	4.3e-25
>prophage 230
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2946439	2950161	5369387		Anomala_cuprea_entomopoxvirus(66.67%)	5	NA	NA
AVT89187.1|2946439_2947222_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	8.8e-10
AVT89188.1|2947214_2947910_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	1.1e-06
AVT89189.1|2948026_2948197_-	hypothetical protein	NA	NA	NA	NA	NA
AVT89190.1|2948531_2949341_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT89191.1|2949342_2950161_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.1e-34
>prophage 231
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2959234	2960077	5369387		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVT89198.1|2959234_2960077_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.2	2.4e-13
>prophage 232
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2966139	2977678	5369387		Enterobacteria_phage(33.33%)	8	NA	NA
AVT89207.1|2966139_2967192_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
AVT89208.1|2967481_2968585_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AVT89209.1|2968595_2969849_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
AVT89210.1|2970348_2970549_+	DNA-binding protein	NA	NA	NA	NA	NA
AVT91486.1|2970785_2971094_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	52.0	6.9e-19
AVT89211.1|2971090_2972860_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	2.2e-125
AVT89212.1|2973402_2974185_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
AVT89213.1|2974171_2977678_+	DEAD/DEAH box helicase	NA	M1H1D9	Paramecium_bursaria_Chlorella_virus	25.0	2.8e-15
>prophage 233
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2984053	2984428	5369387		Pectobacterium_phage(100.0%)	1	NA	NA
AVT89220.1|2984053_2984428_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	68.4	1.4e-29
>prophage 234
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	2998016	3001259	5369387		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVT89227.1|2998016_3001259_-	ATP-dependent helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	26.9	5.2e-32
>prophage 235
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3013673	3015071	5369387		Erysipelothrix_phage(100.0%)	1	NA	NA
AVT89235.1|3013673_3015071_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	2.8e-43
>prophage 236
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3019722	3020718	5369387		Catovirus(100.0%)	1	NA	NA
AVT89241.1|3019722_3020718_+	oxidoreductase	NA	A0A1V0SBV6	Catovirus	29.9	2.4e-28
>prophage 237
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3028250	3029534	5369387		Klosneuvirus(100.0%)	1	NA	NA
AVT89248.1|3028250_3029534_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	8.4e-34
>prophage 238
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3046693	3047275	5369387		Caulobacter_phage(100.0%)	1	NA	NA
AVT89267.1|3046693_3047275_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	29.8	2.2e-13
>prophage 239
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3052782	3056992	5369387		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVT89272.1|3052782_3053514_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.9	7.1e-38
AVT89273.1|3053578_3054046_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	56.6	8.0e-51
AVT89274.1|3054042_3054765_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVT89275.1|3054797_3055553_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVT89276.1|3055624_3056992_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	29.1	4.0e-10
>prophage 240
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3061057	3061861	5369387		Indivirus(100.0%)	1	NA	NA
AVT89280.1|3061057_3061861_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	9.2e-39
>prophage 241
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3068535	3069567	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT89282.1|3068535_3069567_+	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.4e-36
>prophage 242
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3082551	3086651	5369387		Saccharomonospora_phage(50.0%)	2	NA	NA
AVT89295.1|3082551_3086034_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	3.1e-208
AVT89296.1|3086051_3086651_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.6	1.6e-27
>prophage 243
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3095482	3096241	5369387		Flavobacterium_phage(100.0%)	1	NA	NA
AVT89305.1|3095482_3096241_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	6.1e-24
>prophage 244
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3107819	3109253	5369387	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVT89316.1|3107819_3109253_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	3.9e-24
>prophage 245
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3113208	3113553	5369387		Lake_Baikal_phage(100.0%)	1	NA	NA
AVT89321.1|3113208_3113553_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.2e-27
>prophage 246
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3119520	3120318	5369387		Planktothrix_phage(100.0%)	1	NA	NA
AVT89326.1|3119520_3120318_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	9.2e-15
>prophage 247
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3142452	3149223	5369387	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AVT89345.1|3142452_3144882_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	1.5e-39
AVT89346.1|3144954_3145491_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVT89347.1|3145490_3146207_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVT89348.1|3146369_3146825_+	RNA polymerase-binding transcription factor	NA	NA	NA	NA	NA
AVT89349.1|3146884_3147766_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVT89350.1|3147828_3149223_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.9	1.6e-25
>prophage 248
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3154627	3161274	5369387		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AVT89358.1|3154627_3155554_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	1.8e-22
AVT89359.1|3155738_3156401_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVT91502.1|3156460_3156997_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.8	3.9e-17
AVT89360.1|3157201_3159592_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVT89361.1|3159675_3161274_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	50.0	1.7e-15
>prophage 249
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3172848	3174273	5369387		Erysipelothrix_phage(100.0%)	1	NA	NA
AVT89371.1|3172848_3174273_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.1e-41
>prophage 250
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3185613	3186177	5369387		Sphingobium_phage(100.0%)	1	NA	NA
AVT89379.1|3185613_3186177_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.4	4.1e-09
>prophage 251
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3190444	3191488	5369387		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVT89384.1|3190444_3191488_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	3.1e-103
>prophage 252
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3217681	3219406	5369387		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVT89410.1|3217681_3219406_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.8	3.3e-33
>prophage 253
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3230805	3231561	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT89421.1|3230805_3231561_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	36.5	4.2e-25
>prophage 254
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3240261	3240963	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT89429.1|3240261_3240963_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.2	1.1e-22
>prophage 255
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3247259	3252711	5369387		Fish_lymphocystis_disease_virus(50.0%)	2	NA	NA
AVT89435.1|3247259_3249617_+	DNA polymerase II	NA	X5FTI3	Fish_lymphocystis_disease_virus	23.4	6.7e-13
AVT89436.1|3249804_3252711_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.9	4.9e-21
>prophage 256
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3265169	3266750	5369387		Pseudomonas_phage(50.0%)	2	NA	NA
AVT89448.1|3265169_3266018_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	48.4	3.4e-07
AVT89449.1|3266270_3266750_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.2e-28
>prophage 257
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3273091	3274240	5369387		Halovirus(100.0%)	1	NA	NA
AVT89454.1|3273091_3274240_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.1	4.1e-48
>prophage 258
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3280805	3290758	5369387	tRNA	Tupanvirus(25.0%)	7	NA	NA
AVT91506.1|3280805_3283622_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
AVT89463.1|3283665_3284604_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AVT89464.1|3284933_3285197_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVT89465.1|3285316_3286213_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
AVT89466.1|3286267_3287443_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.4	4.9e-89
AVT89467.1|3287620_3288754_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.5	1.2e-28
AVT89468.1|3288841_3290758_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
>prophage 259
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3295152	3296106	5369387		Cyanophage(100.0%)	1	NA	NA
AVT89473.1|3295152_3296106_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	1.3e-10
>prophage 260
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3313262	3318422	5369387		Bacillus_phage(33.33%)	3	NA	NA
AVT91510.1|3313262_3315200_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	2.7e-12
AVT89490.1|3315428_3317096_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.8	2.9e-42
AVT89491.1|3317189_3318422_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.3	1.3e-87
>prophage 261
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3324753	3326076	5369387		Geobacillus_virus(100.0%)	1	NA	NA
AVT89498.1|3324753_3326076_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.7	2.0e-78
>prophage 262
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3330811	3333532	5369387		Salmonella_phage(50.0%)	3	NA	NA
AVT89502.1|3330811_3330973_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	67.9	1.2e-11
AVT89503.1|3331102_3331723_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVT89504.1|3331942_3333532_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.9	5.3e-30
>prophage 263
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3346747	3348027	5369387		Salmonella_phage(50.0%)	2	NA	NA
AVT89518.1|3346747_3347287_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	62.8	2.4e-27
AVT89519.1|3347289_3348027_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	1.2e-64
>prophage 264
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3351186	3354354	5369387	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVT91514.1|3351186_3352125_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.7	2.6e-69
AVT89522.1|3352264_3353296_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AVT89523.1|3353292_3354354_-	glucosamine--fructose-6-phosphate aminotransferase	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.1	1.1e-07
>prophage 265
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3385119	3393027	5369387		Moraxella_phage(100.0%)	1	NA	NA
AVT89556.1|3385119_3393027_-	adhesin	NA	A0A0R6PJK4	Moraxella_phage	39.7	6.7e-49
>prophage 266
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3401332	3402259	5369387	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVT89563.1|3401332_3402259_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.9e-73
>prophage 267
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3417845	3427530	5369387	tRNA	Bacillus_virus(66.67%)	6	NA	NA
AVT89582.1|3417845_3419330_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.4	4.2e-13
AVT91518.1|3419380_3420367_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT89583.1|3420868_3421876_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVT89584.1|3421924_3423319_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.7	6.8e-13
AVT89585.1|3423721_3424789_+	hypothetical protein	NA	NA	NA	NA	NA
AVT89586.1|3424785_3427530_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	2.7e-21
>prophage 268
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3437255	3439362	5369387		Hokovirus(50.0%)	2	NA	NA
AVT89592.1|3437255_3438689_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.6	7.7e-12
AVT89593.1|3438678_3439362_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	7.9e-31
>prophage 269
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3442600	3447558	5369387		Leptospira_phage(33.33%)	4	NA	NA
AVT89597.1|3442600_3445750_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	7.0e-58
AVT89598.1|3445822_3446170_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
AVT89599.1|3446179_3446713_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	59.6	8.2e-52
AVT89600.1|3446829_3447558_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	47.4	1.4e-46
>prophage 270
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3478078	3479680	5369387		Bordetella_phage(50.0%)	3	NA	NA
AVT89628.1|3478078_3478522_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	32.8	1.1e-12
AVT89629.1|3478601_3478850_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVT89630.1|3478855_3479680_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.2	1.2e-41
>prophage 271
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3483725	3483959	5369387		Vibrio_phage(100.0%)	1	NA	NA
AVT89634.1|3483725_3483959_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.7	2.4e-08
>prophage 272
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3489204	3491925	5369387	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
AVT91521.1|3489204_3489381_-	hypothetical protein	NA	Q76S41	Shigella_phage	63.5	3.9e-11
AVT89637.1|3489589_3489994_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AVT89638.1|3489990_3490338_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVT89639.1|3490386_3491925_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
>prophage 273
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3515939	3517211	5369387	integrase	Enterobacteria_phage(100.0%)	1	3503177:3503190	3527409:3527422
3503177:3503190	attL	GACGATCTGCTGGA	NA	NA	NA	NA
AVT89652.1|3515939_3517211_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.3	6.3e-82
AVT89652.1|3515939_3517211_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	39.3	6.3e-82
3527409:3527422	attR	GACGATCTGCTGGA	NA	NA	NA	NA
>prophage 274
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3520335	3525161	5369387		Tupanvirus(50.0%)	5	NA	NA
AVT89655.1|3520335_3521355_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
AVT91524.1|3521497_3522370_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AVT89656.1|3522359_3523247_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AVT89657.1|3523257_3524082_+	phosphodiesterase	NA	NA	NA	NA	NA
AVT89658.1|3524087_3525161_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
>prophage 275
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3540207	3549257	5369387	tRNA	Klebsiella_phage(33.33%)	7	NA	NA
AVT89671.1|3540207_3541710_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.7e-84
AVT89672.1|3541758_3542841_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVT89673.1|3542840_3543938_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVT89674.1|3543927_3544047_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVT89675.1|3544327_3545839_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
AVT89676.1|3545958_3546402_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVT89677.1|3546401_3549257_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	6.0e-141
>prophage 276
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3553404	3559463	5369387		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AVT89684.1|3553404_3554340_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.3e-52
AVT89685.1|3554353_3554815_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVT89686.1|3554967_3555354_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AVT89687.1|3555427_3558136_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.5	4.1e-46
AVT91525.1|3558281_3558479_-	hypothetical protein	NA	NA	NA	NA	NA
AVT89688.1|3558515_3559463_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.6	3.3e-11
>prophage 277
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3567220	3570352	5369387		Vibrio_phage(33.33%)	3	NA	NA
AVT89694.1|3567220_3569359_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.2	5.3e-267
AVT89695.1|3569599_3570064_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	59.5	3.8e-53
AVT89696.1|3570067_3570352_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.6	1.4e-26
>prophage 278
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3586102	3592681	5369387		Klosneuvirus(33.33%)	6	NA	NA
AVT89714.1|3586102_3587101_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	1.3e-69
AVT89715.1|3587143_3588142_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AVT89716.1|3588128_3589154_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT89717.1|3589164_3590667_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
AVT89718.1|3590790_3591747_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT89719.1|3592150_3592681_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	2.7e-55
>prophage 279
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3602669	3603650	5369387	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVT89726.1|3602669_3603650_-|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 280
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3612302	3613127	5369387		Bordetella_phage(100.0%)	1	NA	NA
AVT89735.1|3612302_3613127_+	AraC family transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	42.0	1.5e-07
>prophage 281
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3632722	3637066	5369387		Lactococcus_phage(50.0%)	3	NA	NA
AVT89760.1|3632722_3635155_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.7	1.4e-66
AVT89761.1|3635191_3635617_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT89762.1|3635767_3637066_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
>prophage 282
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3642997	3646220	5369387		Wolbachia_phage(50.0%)	2	NA	NA
AVT89769.1|3642997_3644857_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.8	2.2e-59
AVT89770.1|3644867_3646220_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	3.1e-18
>prophage 283
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3651062	3651608	5369387		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVT89776.1|3651062_3651608_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	42.1	1.2e-29
>prophage 284
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3658962	3664156	5369387		Tupanvirus(33.33%)	6	NA	NA
AVT89782.1|3658962_3659940_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.7	2.8e-29
AVT89783.1|3660215_3662006_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.2	3.8e-16
AVT89784.1|3661998_3662733_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
AVT89785.1|3662743_3663139_+	fumarate reductase subunit C	NA	NA	NA	NA	NA
AVT89786.1|3663149_3663509_+	fumarate reductase subunit D	NA	NA	NA	NA	NA
AVT89787.1|3663622_3664156_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	49.3	2.5e-40
>prophage 285
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3674882	3680529	5369387		Bacillus_phage(33.33%)	5	NA	NA
AVT89800.1|3674882_3677006_+	colicin V synthesis protein	NA	W8CYL7	Bacillus_phage	26.1	4.9e-31
AVT89801.1|3677019_3677883_+	hypothetical protein	NA	NA	NA	NA	NA
AVT89802.1|3677937_3678291_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AVT89803.1|3678551_3680198_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	9.0e-190
AVT89804.1|3680235_3680529_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	42.3	3.5e-12
>prophage 286
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3700599	3704114	5369387		Escherichia_phage(50.0%)	5	NA	NA
AVT89818.1|3700599_3701283_+	hypothetical protein	NA	W8EBD0	Pseudomonas_phage	42.2	5.1e-30
AVT89819.1|3701428_3702346_+	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.8e-07
AVT89820.1|3702345_3702651_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
AVT89821.1|3702776_3703148_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	52.8	2.8e-22
AVT89822.1|3703157_3704114_-	recombinase	NA	A0A222YXF2	Escherichia_phage	78.0	1.3e-143
>prophage 287
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3708478	3709981	5369387		Burkholderia_virus(100.0%)	1	NA	NA
AVT89827.1|3708478_3709981_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
>prophage 288
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3715342	3716889	5369387		Bacillus_virus(50.0%)	2	NA	NA
AVT89835.1|3715342_3716101_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	26.7	6.7e-15
AVT89836.1|3716208_3716889_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.0	5.1e-06
>prophage 289
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3722269	3723790	5369387		Pithovirus(100.0%)	1	NA	NA
AVT89842.1|3722269_3723790_+	sugar ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	22.9	6.7e-06
>prophage 290
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3729731	3731879	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT89849.1|3729731_3731879_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.3	2.0e-32
>prophage 291
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3734905	3736864	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT89853.1|3734905_3736864_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.3	3.0e-91
>prophage 292
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3749150	3750500	5369387		Moraxella_phage(100.0%)	1	NA	NA
AVT89865.1|3749150_3750500_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 293
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3758029	3759061	5369387		Mycoplasma_phage(100.0%)	1	NA	NA
AVT91535.1|3758029_3759061_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.5	1.6e-19
>prophage 294
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3771041	3776348	5369387		Vibrio_phage(33.33%)	3	NA	NA
AVT89885.1|3771041_3772622_+	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
AVT89886.1|3772746_3773271_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
AVT89887.1|3773522_3776348_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
>prophage 295
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3779529	3782056	5369387		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
AVT89892.1|3779529_3780609_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	2.4e-26
AVT89893.1|3780640_3782056_-	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.8	5.7e-201
>prophage 296
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3788051	3788660	5369387		Lactococcus_phage(100.0%)	1	NA	NA
AVT89901.1|3788051_3788660_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	40.7	4.6e-14
>prophage 297
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3795726	3796836	5369387		Mycoplasma_phage(100.0%)	1	NA	NA
AVT89908.1|3795726_3796836_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	3.6e-17
>prophage 298
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3814738	3818422	5369387		Dickeya_phage(100.0%)	1	NA	NA
AVT89925.1|3814738_3818422_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 299
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3831968	3833558	5369387		Prochlorococcus_phage(100.0%)	1	NA	NA
AVT89933.1|3831968_3833558_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.0	4.0e-70
>prophage 300
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3838979	3840743	5369387		Bacillus_phage(50.0%)	3	NA	NA
AVT89939.1|3838979_3839252_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
AVT89940.1|3839438_3840029_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVT89941.1|3840071_3840743_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	27.6	2.6e-18
>prophage 301
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3849231	3861612	5369387		Bacillus_phage(33.33%)	6	NA	NA
AVT91538.1|3849231_3850701_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.1	2.1e-12
AVT89952.1|3850873_3851179_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AVT89953.1|3851182_3851500_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AVT89954.1|3851542_3852883_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AVT89955.1|3853283_3857507_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.5	9.1e-69
AVT89956.1|3857583_3861612_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	28.6	2.3e-21
>prophage 302
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3865839	3868960	5369387		Tupanvirus(50.0%)	2	NA	NA
AVT89965.1|3865839_3867024_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
AVT89966.1|3868009_3868960_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	2.7e-29
>prophage 303
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3878764	3879379	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT89972.1|3878764_3879379_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.5	9.6e-20
>prophage 304
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3888096	3891440	5369387		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVT89981.1|3888096_3888876_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.7	7.4e-25
AVT89982.1|3888878_3889415_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVT89983.1|3889418_3889670_-	Sec-independent protein translocase protein TatA	NA	NA	NA	NA	NA
AVT89984.1|3889799_3891440_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	2.2e-39
>prophage 305
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3903441	3906916	5369387	transposase	Sodalis_phage(50.0%)	3	NA	NA
AVT89996.1|3903441_3904362_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.8	3.7e-68
AVT89997.1|3904407_3905028_-	threonine export protein RhtC	NA	NA	NA	NA	NA
AVT89998.1|3905089_3906916_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
>prophage 306
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3910752	3914597	5369387		Bacillus_phage(50.0%)	3	NA	NA
AVT90004.1|3910752_3912915_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
AVT90005.1|3912978_3913695_-	flavin mononucleotide phosphatase	NA	NA	NA	NA	NA
AVT90006.1|3913694_3914597_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.4	5.9e-18
>prophage 307
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3930964	3937106	5369387		uncultured_marine_virus(20.0%)	6	NA	NA
AVT90021.1|3930964_3932095_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AVT90022.1|3932100_3932775_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVT90023.1|3932752_3933634_-	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	67.4	4.6e-108
AVT90024.1|3933652_3934720_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	2.4e-98
AVT90025.1|3934716_3935979_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	25.9	2.9e-23
AVT90026.1|3935975_3937106_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	33.2	9.7e-26
>prophage 308
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3941156	3943093	5369387		Indivirus(50.0%)	2	NA	NA
AVT90031.1|3941156_3941486_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	39.6	2.5e-14
AVT90032.1|3941827_3943093_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.3	1.8e-41
>prophage 309
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3947584	3949606	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT90038.1|3947584_3949606_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	1.4e-112
>prophage 310
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3957708	3959355	5369387		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVT90047.1|3957708_3959355_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	3.1e-65
>prophage 311
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3969428	3971267	5369387		Acinetobacter_phage(100.0%)	1	NA	NA
AVT90053.1|3969428_3971267_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.2	2.3e-08
>prophage 312
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	3985898	3986561	5369387		Cyanophage(100.0%)	1	NA	NA
AVT90066.1|3985898_3986561_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	33.5	7.9e-28
>prophage 313
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4003955	4005290	5369387	protease	Erwinia_phage(100.0%)	1	NA	NA
AVT90082.1|4003955_4005290_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	29.5	2.1e-43
>prophage 314
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4009792	4013296	5369387		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
AVT90087.1|4009792_4010491_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
AVT90088.1|4010487_4011861_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
AVT90089.1|4011928_4012603_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVT90090.1|4012675_4013296_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
>prophage 315
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4021635	4023147	5369387		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVT90099.1|4021635_4023147_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.4	2.3e-14
>prophage 316
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4040898	4041816	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT90119.1|4040898_4041816_+	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	29.2	1.3e-17
>prophage 317
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4048638	4051106	5369387		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVT90126.1|4048638_4049688_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.0e-08
AVT91542.1|4049696_4051106_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
>prophage 318
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4054994	4057787	5369387		uncultured_virus(100.0%)	1	NA	NA
AVT90132.1|4054994_4057787_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.5	4.9e-71
>prophage 319
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4072096	4077975	5369387		Enterobacteria_phage(33.33%)	5	NA	NA
AVT90143.1|4072096_4072987_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	3.3e-05
AVT90144.1|4073014_4073980_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVT90145.1|4073985_4075491_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.4	1.5e-18
AVT90146.1|4075501_4075921_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVT90147.1|4076106_4077975_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	8.4e-67
>prophage 320
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4081140	4082133	5369387		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVT90150.1|4081140_4082133_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	4.6e-48
>prophage 321
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4094484	4102044	5369387		Chrysochromulina_ericina_virus(25.0%)	6	NA	NA
AVT90164.1|4094484_4095855_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.6	2.8e-35
AVT90165.1|4096038_4097868_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	41.4	1.9e-124
AVT90166.1|4098204_4099245_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	3.4e-49
AVT90167.1|4099373_4100333_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVT90168.1|4100332_4101223_+	phosphate ABC transporter, permease protein PstA	NA	NA	NA	NA	NA
AVT90169.1|4101270_4102044_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	2.0e-14
>prophage 322
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4107817	4109155	5369387		Moraxella_phage(100.0%)	1	NA	NA
AVT90175.1|4107817_4109155_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.6	1.1e-63
>prophage 323
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4116647	4124177	5369387		Staphylococcus_phage(33.33%)	7	NA	NA
AVT90183.1|4116647_4116905_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	1.6e-16
AVT90184.1|4116868_4117228_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVT90185.1|4117243_4117384_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVT90186.1|4118005_4119409_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVT90187.1|4119413_4120514_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.2	1.8e-53
AVT90188.1|4120660_4121734_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVT90189.1|4121762_4124177_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.3	8.2e-115
>prophage 324
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4129944	4131093	5369387		Oenococcus_phage(100.0%)	1	NA	NA
AVT90196.1|4129944_4131093_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.7	4.7e-52
>prophage 325
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4134534	4136454	5369387		Cyanophage(33.33%)	3	NA	NA
AVT90200.1|4134534_4134948_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AVT90201.1|4135064_4135493_+	heat shock chaperone IbpB	NA	A0A2H4N7P1	Lake_Baikal_phage	41.1	2.6e-16
AVT90202.1|4135629_4136454_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.4	8.2e-91
>prophage 326
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4147464	4152904	5369387		Salmonella_phage(50.0%)	6	NA	NA
AVT90213.1|4147464_4148649_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	25.2	1.1e-11
AVT90214.1|4148824_4149658_-	EamA family transporter	NA	NA	NA	NA	NA
AVT90215.1|4149726_4150173_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVT90216.1|4150263_4150353_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVT90217.1|4151015_4151111_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVT90218.1|4151215_4152904_+	acetolactate synthase, large subunit, biosynthetic type	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.0	2.9e-58
>prophage 327
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4165079	4166192	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT90233.1|4165079_4166192_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.5	1.5e-26
>prophage 328
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4184446	4185610	5369387		Salmonella_phage(100.0%)	1	NA	NA
AVT90251.1|4184446_4185610_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.9	7.6e-26
>prophage 329
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4202742	4203792	5369387		Tupanvirus(100.0%)	1	NA	NA
AVT90269.1|4202742_4203792_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	43.9	3.4e-73
>prophage 330
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4217192	4218584	5369387		environmental_Halophage(100.0%)	1	NA	NA
AVT90280.1|4217192_4218584_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.2	1.4e-66
>prophage 331
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4221718	4222570	5369387		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVT90283.1|4221718_4222570_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.2	2.2e-14
>prophage 332
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4233551	4241841	5369387		Bordetella_phage(25.0%)	6	NA	NA
AVT90295.1|4233551_4235672_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVT90296.1|4235690_4235966_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVT90297.1|4236020_4236644_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.7e-19
AVT90298.1|4236902_4238579_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.8	3.9e-23
AVT90299.1|4238584_4239202_-	hypothetical protein	NA	NA	NA	NA	NA
AVT90300.1|4240782_4241841_-	XRE family transcriptional regulator	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.5	6.3e-19
>prophage 333
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4246883	4247801	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT90305.1|4246883_4247801_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	2.1e-23
>prophage 334
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4252440	4257183	5369387		Xanthomonas_phage(25.0%)	7	NA	NA
AVT91549.1|4252440_4252896_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	4.7e-48
AVT91550.1|4252876_4254091_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.7	1.1e-43
AVT90310.1|4254263_4254929_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVT90311.1|4255145_4255382_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVT90312.1|4255402_4255570_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVT90313.1|4255705_4256515_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.1	2.9e-24
AVT90314.1|4256703_4257183_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.3	2.8e-27
>prophage 335
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4269951	4279101	5369387		Prochlorococcus_phage(20.0%)	9	NA	NA
AVT90325.1|4269951_4270884_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	2.2e-36
AVT90326.1|4271097_4272291_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.5	1.7e-36
AVT90327.1|4272303_4273329_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	3.6e-19
AVT90328.1|4273497_4274286_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVT90329.1|4274291_4275239_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVT90330.1|4275242_4276514_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	3.5e-08
AVT90331.1|4276523_4278068_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVT90332.1|4278313_4278745_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVT90333.1|4278849_4279101_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	52.1	9.9e-16
>prophage 336
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4293751	4295593	5369387	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVT90348.1|4293751_4295593_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.7	1.2e-12
>prophage 337
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4303567	4305109	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT90356.1|4303567_4305109_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	2.5e-16
>prophage 338
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4310577	4311573	5369387		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVT90362.1|4310577_4311573_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	2.1e-08
>prophage 339
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4315949	4317880	5369387		Hokovirus(50.0%)	2	NA	NA
AVT90368.1|4315949_4317569_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	24.8	2.6e-16
AVT90369.1|4317667_4317880_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 340
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4321283	4322255	5369387		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVT90374.1|4321283_4322255_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.9	2.9e-18
>prophage 341
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4327414	4330154	5369387		Escherichia_phage(50.0%)	2	NA	NA
AVT90380.1|4327414_4329745_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	3.4e-65
AVT90381.1|4329713_4330154_-	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	33.6	1.3e-15
>prophage 342
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4341212	4347186	5369387		Planktothrix_phage(33.33%)	6	NA	NA
AVT90390.1|4341212_4342196_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.3e-15
AVT90391.1|4342192_4343206_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	7.4e-17
AVT90392.1|4343224_4343404_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90393.1|4343721_4344261_+	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AVT90394.1|4344251_4345055_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AVT90395.1|4345074_4347186_+	cellulose synthase catalytic subunit (UDP-forming)	NA	M1I277	Paramecium_bursaria_Chlorella_virus	34.2	4.6e-37
>prophage 343
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4390916	4392959	5369387		Indivirus(100.0%)	1	NA	NA
AVT90422.1|4390916_4392959_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.8	3.8e-44
>prophage 344
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4401498	4402290	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT90431.1|4401498_4402290_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	28.7	5.9e-14
>prophage 345
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4408392	4412499	5369387		Tupanvirus(66.67%)	3	NA	NA
AVT90438.1|4408392_4409532_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	26.8	2.1e-28
AVT90439.1|4409533_4410517_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.3	9.6e-38
AVT90440.1|4410513_4412499_+	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	25.7	5.7e-21
>prophage 346
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4418798	4423158	5369387		Dickeya_phage(50.0%)	4	NA	NA
AVT90447.1|4418798_4419464_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	55.8	2.1e-57
AVT90448.1|4419670_4419916_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	86.1	4.7e-10
AVT90449.1|4420242_4422453_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.8e-113
AVT90450.1|4422531_4423158_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	59.3	6.1e-30
>prophage 347
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4426242	4432043	5369387		Staphylococcus_phage(25.0%)	5	NA	NA
AVT90455.1|4426242_4426911_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	5.0e-14
AVT90456.1|4426903_4427959_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVT90457.1|4428228_4429083_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AVT90458.1|4429135_4430659_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.2	1.4e-14
AVT90459.1|4430777_4432043_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.5e-24
>prophage 348
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4440816	4443049	5369387		Anomala_cuprea_entomopoxvirus(66.67%)	4	NA	NA
AVT90468.1|4440816_4441584_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	5.8e-14
AVT90469.1|4441585_4442299_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	1.7e-12
AVT90470.1|4442462_4442684_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AVT90471.1|4442680_4443049_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	3.5e-09
>prophage 349
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4446475	4448283	5369387		Planktothrix_phage(50.0%)	2	NA	NA
AVT90475.1|4446475_4447546_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
AVT90476.1|4447542_4448283_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	7.0e-09
>prophage 350
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4466025	4468473	5369387		Dickeya_phage(100.0%)	1	NA	NA
AVT90491.1|4466025_4468473_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	2.7e-33
>prophage 351
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4471534	4472293	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT90495.1|4471534_4472293_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	2.3e-23
>prophage 352
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4475638	4478029	5369387		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVT90498.1|4475638_4478029_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.1e-13
>prophage 353
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4490855	4494627	5369387		Bacillus_phage(66.67%)	3	NA	NA
AVT90510.1|4490855_4491575_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVT90511.1|4491571_4492927_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.7	1.6e-11
AVT90512.1|4493004_4494627_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.1	1.1e-139
>prophage 354
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4509450	4510278	5369387		Vibrio_phage(100.0%)	1	NA	NA
AVT90526.1|4509450_4510278_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.0	6.1e-70
>prophage 355
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4521678	4531322	5369387		Acinetobacter_phage(25.0%)	11	NA	NA
AVT90538.1|4521678_4522242_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	58.4	8.1e-58
AVT90539.1|4522332_4523553_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVT90540.1|4523542_4525621_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	84.8	4.1e-62
AVT90541.1|4525672_4526305_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVT91560.1|4526463_4526652_-	hypothetical protein	NA	NA	NA	NA	NA
AVT90542.1|4526611_4527016_+	OsmC family protein	NA	NA	NA	NA	NA
AVT90543.1|4527070_4527940_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVT90544.1|4527976_4528195_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	37.3	4.0e-05
AVT90545.1|4528191_4529214_-	hydrolase	NA	NA	NA	NA	NA
AVT90546.1|4529154_4529355_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90547.1|4529417_4531322_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.9	8.5e-75
>prophage 356
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4539149	4542518	5369387		Streptococcus_phage(50.0%)	2	NA	NA
AVT90560.1|4539149_4541264_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	1.8e-57
AVT90561.1|4541333_4542518_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	5.2e-14
>prophage 357
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4562421	4563893	5369387	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVT90598.1|4562421_4563369_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AVT90599.1|4563383_4563893_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
>prophage 358
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4591419	4592463	5369387		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVT90624.1|4591419_4592463_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 359
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4610513	4611782	5369387		Oenococcus_phage(100.0%)	1	NA	NA
AVT90642.1|4610513_4611782_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.7	8.0e-61
>prophage 360
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4618782	4620150	5369387	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVT90650.1|4618782_4620150_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
>prophage 361
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4624095	4624590	5369387	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AVT90656.1|4624095_4624590_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 362
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4632035	4632968	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT90660.1|4632035_4632968_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
>prophage 363
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4636912	4649843	5369387		Hokovirus(16.67%)	16	NA	NA
AVT90664.1|4636912_4639252_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	9.3e-39
AVT90665.1|4639485_4640139_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVT90666.1|4640135_4640861_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVT90667.1|4640924_4641197_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVT90668.1|4641193_4642048_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVT90669.1|4642093_4642582_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVT90670.1|4642652_4642940_-	hypothetical protein	NA	NA	NA	NA	NA
AVT90671.1|4642962_4644396_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVT90672.1|4644443_4645169_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
AVT90673.1|4645175_4645721_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVT90674.1|4645689_4646265_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVT90675.1|4646261_4646828_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	5.3e-57
AVT91564.1|4646842_4647829_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	3.0e-39
AVT90676.1|4647843_4648821_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVT90677.1|4648835_4649039_-	hypothetical protein	NA	NA	NA	NA	NA
AVT90678.1|4649030_4649843_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	1.6e-17
>prophage 364
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4653892	4655334	5369387		Vibrio_phage(50.0%)	2	NA	NA
AVT90685.1|4653892_4654165_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.5	3.1e-15
AVT90686.1|4654362_4655334_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.0	1.0e-07
>prophage 365
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4661932	4664809	5369387	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVT90695.1|4661932_4663867_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	4.1e-117
AVT90696.1|4663960_4664809_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	30.7	6.0e-20
>prophage 366
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4669073	4675692	5369387		Dickeya_phage(50.0%)	4	NA	NA
AVT90702.1|4669073_4670417_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AVT90703.1|4671009_4671462_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVT90704.1|4671489_4672977_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AVT90705.1|4673001_4675692_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	5.1e-25
>prophage 367
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4681106	4683038	5369387		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVT90713.1|4681106_4683038_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	2.1e-52
>prophage 368
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4688731	4696607	5369387	protease	Invertebrate_iridovirus(25.0%)	10	NA	NA
AVT91565.1|4688731_4689016_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
AVT90720.1|4689071_4689515_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90721.1|4689476_4690013_-|protease	protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.6e-10
AVT90722.1|4690141_4690789_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90723.1|4690864_4691905_+	permease	NA	NA	NA	NA	NA
AVT90724.1|4692026_4692602_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVT90725.1|4692611_4693202_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AVT90726.1|4693227_4693614_-	YraN family protein	NA	NA	NA	NA	NA
AVT90727.1|4693571_4695680_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVT90728.1|4695743_4696607_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.5	2.1e-49
>prophage 369
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4701881	4703027	5369387		Streptococcus_phage(100.0%)	1	NA	NA
AVT90733.1|4701881_4703027_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.6	2.6e-50
>prophage 370
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4720163	4721135	5369387		Escherichia_phage(100.0%)	1	NA	NA
AVT90753.1|4720163_4721135_-	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	32.4	1.5e-35
>prophage 371
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4730698	4732186	5369387		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVT90762.1|4730698_4732186_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	F2Y302	Organic_Lake_phycodnavirus	27.3	1.1e-08
>prophage 372
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4736457	4737837	5369387		Klosneuvirus(100.0%)	1	NA	NA
AVT90768.1|4736457_4737837_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-31
>prophage 373
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4755916	4761916	5369387		Acanthocystis_turfacea_Chlorella_virus(50.0%)	5	NA	NA
AVT90786.1|4755916_4756720_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	1.2e-14
AVT90787.1|4756772_4757078_-	acid-resistance protein	NA	NA	NA	NA	NA
AVT90788.1|4757104_4757680_-	acid-resistance protein	NA	NA	NA	NA	NA
AVT90789.1|4757950_4758583_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90790.1|4758673_4761916_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.6	4.3e-34
>prophage 374
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4778712	4780029	5369387	integrase	Klebsiella_phage(100.0%)	1	4771516:4771529	4781240:4781253
4771516:4771529	attL	GTTCTTTTTTATTC	NA	NA	NA	NA
AVT90803.1|4778712_4780029_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.5	1.3e-34
AVT90803.1|4778712_4780029_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.5	1.3e-34
4781240:4781253	attR	GAATAAAAAAGAAC	NA	NA	NA	NA
>prophage 375
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4791094	4793904	5369387		Staphylococcus_phage(100.0%)	2	NA	NA
AVT90811.1|4791094_4792297_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	28.5	7.1e-27
AVT90812.1|4792296_4793904_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.8	8.9e-158
>prophage 376
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4803574	4804402	5369387		Yersinia_phage(100.0%)	1	NA	NA
AVT90820.1|4803574_4804402_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	3.6e-46
>prophage 377
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4808970	4809429	5369387		Bordetella_phage(100.0%)	1	NA	NA
AVT90824.1|4808970_4809429_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.5	4.1e-15
>prophage 378
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4812706	4818090	5369387	tRNA	Vibrio_phage(33.33%)	5	NA	NA
AVT90831.1|4812706_4814548_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVT90832.1|4814766_4816512_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
AVT90833.1|4816623_4816839_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVT90834.1|4816837_4817068_+	hypothetical protein	NA	NA	NA	NA	NA
AVT90835.1|4817076_4818090_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 379
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4827383	4828625	5369387	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AVT90848.1|4827383_4828625_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
>prophage 380
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4833736	4840617	5369387		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
AVT90851.1|4833736_4835170_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	1.5e-39
AVT90852.1|4835388_4835586_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AVT90853.1|4835621_4835894_-	hypothetical protein	NA	NA	NA	NA	NA
AVT90854.1|4836271_4836925_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
AVT90855.1|4836986_4837757_-	zinc transporter ZupT	NA	NA	NA	NA	NA
AVT90856.1|4837943_4838735_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AVT90857.1|4838779_4839940_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.2	1.1e-88
AVT90858.1|4839945_4840617_-	hypothetical protein	NA	A0A173GEW8	Erwinia_phage	48.8	4.4e-42
>prophage 381
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4844959	4846855	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT90864.1|4844959_4846855_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.7	5.9e-92
>prophage 382
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4850166	4860069	5369387		Stx_converting_phage(25.0%)	8	NA	NA
AVT90869.1|4850166_4850562_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	42.5	9.8e-18
AVT90870.1|4850639_4851509_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVT90871.1|4851630_4853889_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.1	1.8e-84
AVT90872.1|4854080_4854818_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVT90873.1|4854901_4856314_+	cell division protein FtsP	NA	NA	NA	NA	NA
AVT90874.1|4856437_4858621_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.0e-103
AVT90875.1|4858678_4859206_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVT90876.1|4859241_4860069_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	3.4e-60
>prophage 383
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4879776	4881147	5369387		Lactococcus_phage(100.0%)	1	NA	NA
AVT91576.1|4879776_4881147_-	cystathionine beta-synthase	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
>prophage 384
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4889486	4891568	5369387		unidentified_phage(100.0%)	1	NA	NA
AVT90903.1|4889486_4891568_+	RNA-directed DNA polymerase	NA	H7BW53	unidentified_phage	33.1	2.0e-08
>prophage 385
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4898766	4899849	5369387		Geobacillus_virus(100.0%)	1	NA	NA
AVT90909.1|4898766_4899849_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	9.9e-12
>prophage 386
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4904511	4905321	5369387		Bacillus_virus(100.0%)	1	NA	NA
AVT90916.1|4904511_4905321_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	6.9e-18
>prophage 387
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4918191	4919346	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT90932.1|4918191_4919346_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.4e-128
>prophage 388
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4935336	4936569	5369387		Catovirus(100.0%)	1	NA	NA
AVT90948.1|4935336_4936569_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	1.4e-102
>prophage 389
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4944512	4947386	5369387		Prochlorococcus_phage(100.0%)	1	NA	NA
AVT90957.1|4944512_4947386_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.5	2.2e-263
>prophage 390
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4951962	4953396	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT90963.1|4951962_4953396_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.7e-33
>prophage 391
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4958092	4964175	5369387	tRNA	Brevibacillus_phage(25.0%)	5	NA	NA
AVT90971.1|4958092_4958989_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	7.9e-31
AVT90972.1|4959011_4959725_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVT90973.1|4959730_4961464_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.2	8.3e-61
AVT90974.1|4961549_4962647_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AVT90975.1|4962657_4964175_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.2	1.5e-85
>prophage 392
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4969043	4969757	5369387		Clostridium_phage(100.0%)	1	NA	NA
AVT90981.1|4969043_4969757_+	hypothetical protein	NA	I3PV79	Clostridium_phage	35.8	1.7e-12
>prophage 393
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4973724	4974744	5369387		Klosneuvirus(100.0%)	1	NA	NA
AVT90985.1|4973724_4974744_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.8	3.8e-05
>prophage 394
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4978242	4982374	5369387		uncultured_Caudovirales_phage(75.0%)	4	NA	NA
AVT90992.1|4978242_4978572_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.0	2.9e-23
AVT90993.1|4978623_4979916_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.0	5.1e-164
AVT90994.1|4979925_4980348_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.5e-45
AVT90995.1|4980820_4982374_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	9.5e-157
>prophage 395
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	4996849	4998528	5369387	integrase	Escherichia_phage(100.0%)	2	4990860:4990874	5000649:5000663
4990860:4990874	attL	TTCAGCGTGGTGCCG	NA	NA	NA	NA
AVT91008.1|4996849_4997458_-	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	51.0	1.5e-49
AVT91009.1|4997922_4998528_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.4	6.1e-51
5000649:5000663	attR	TTCAGCGTGGTGCCG	NA	NA	NA	NA
>prophage 396
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5019123	5022594	5369387		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
AVT91029.1|5019123_5019885_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.0e-18
AVT91030.1|5020180_5021602_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.3	1.1e-23
AVT91031.1|5021598_5022594_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.2	2.2e-13
>prophage 397
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5028357	5029485	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT91035.1|5028357_5029485_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	4.7e-12
>prophage 398
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5035198	5036209	5369387		Enterobacteria_phage(100.0%)	1	NA	NA
AVT91041.1|5035198_5036209_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	2.1e-27
>prophage 399
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5042187	5054105	5369387		Staphylococcus_phage(25.0%)	11	NA	NA
AVT91049.1|5042187_5044347_+	bifunctional 2-acylglycerophosphoethanolamine acyltransferase/acyl-ACP synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	6.4e-18
AVT91050.1|5044339_5045533_+	MFS transporter	NA	NA	NA	NA	NA
AVT91051.1|5045635_5046676_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
AVT91052.1|5046896_5047115_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AVT91053.1|5047238_5047952_-	hypothetical protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	4.5e-45
AVT91054.1|5048015_5048711_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVT91055.1|5048727_5048940_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91056.1|5049393_5049924_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVT91057.1|5049936_5052183_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	23.3	5.6e-09
AVT91058.1|5052428_5053304_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVT91059.1|5053310_5054105_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.8	2.4e-119
>prophage 400
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5059618	5071298	5369387		Hokovirus(25.0%)	6	NA	NA
AVT91065.1|5059618_5062504_+	pitrilysin	NA	A0A1V0SH69	Hokovirus	21.9	8.2e-45
AVT91066.1|5062500_5066037_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.1	2.2e-07
AVT91067.1|5066033_5067878_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.6	1.2e-20
AVT91068.1|5067935_5068256_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91069.1|5068485_5069817_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVT91070.1|5070044_5071298_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.5e-14
>prophage 401
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5103949	5104774	5369387		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVT91110.1|5103949_5104774_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	2.5e-07
>prophage 402
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5116516	5116777	5369387		Burkholderia_virus(100.0%)	1	NA	NA
AVT91120.1|5116516_5116777_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	31.8	1.6e-05
>prophage 403
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5119924	5122315	5369387		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVT91123.1|5119924_5122315_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.4	6.0e-17
>prophage 404
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5129426	5131927	5369387	tRNA	Pandoravirus(50.0%)	3	NA	NA
AVT91129.1|5129426_5130248_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	31.7	1.6e-14
AVT91130.1|5130290_5130722_-	cysteine desulfurase, sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVT91131.1|5130721_5131927_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	8.9e-70
>prophage 405
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5143471	5144227	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT91142.1|5143471_5144227_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.6	1.7e-10
>prophage 406
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5150631	5151654	5369387		Bacillus_phage(100.0%)	1	NA	NA
AVT91147.1|5150631_5151654_+	methionine ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.0	1.0e-13
>prophage 407
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5161909	5162755	5369387		Vibrio_phage(100.0%)	1	NA	NA
AVT91157.1|5161909_5162755_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.9e-42
>prophage 408
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5170169	5175635	5369387		Streptococcus_phage(33.33%)	3	NA	NA
AVT91165.1|5170169_5171309_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.9	3.4e-47
AVT91166.1|5171466_5174217_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	28.9	6.4e-47
AVT91167.1|5174330_5175635_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.9e-34
>prophage 409
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5179177	5184514	5369387		Only_Syngen_Nebraska_virus(33.33%)	4	NA	NA
AVT91170.1|5179177_5180815_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	2.3e-153
AVT91171.1|5180896_5182195_+	enolase	NA	W6LP63	Streptococcus_phage	57.5	7.5e-131
AVT91172.1|5182258_5183368_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AVT91173.1|5183842_5184514_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	32.1	4.3e-13
>prophage 410
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5193280	5195313	5369387		Hokovirus(50.0%)	2	NA	NA
AVT91180.1|5193280_5194708_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.1	1.1e-34
AVT91181.1|5194707_5195313_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.6	6.1e-27
>prophage 411
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5198382	5204801	5369387		uncultured_Mediterranean_phage(40.0%)	7	NA	NA
AVT91187.1|5198382_5199144_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.7e-58
AVT91188.1|5199137_5199764_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	6.3e-35
AVT91189.1|5199889_5201026_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	3.8e-06
AVT91190.1|5201183_5202176_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.6e-32
AVT91191.1|5202228_5202606_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVT91192.1|5202602_5203805_-	MFS transporter	NA	NA	NA	NA	NA
AVT91193.1|5203913_5204801_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.3	1.9e-05
>prophage 412
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5208268	5214587	5369387	transposase	Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
AVT91199.1|5208268_5210830_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	1.3e-30
AVT91200.1|5211121_5212153_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AVT91201.1|5212253_5212601_-	DUF1493 domain-containing protein	NA	NA	NA	NA	NA
AVT91202.1|5212585_5213035_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91203.1|5213046_5213529_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVT91204.1|5213807_5214587_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.4	9.3e-12
>prophage 413
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5226330	5227152	5369387		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVT91215.1|5226330_5227152_-	manganese/iron transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.1e-14
>prophage 414
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5237517	5238918	5369387		Pandoravirus(100.0%)	1	NA	NA
AVT91226.1|5237517_5238918_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.3	4.0e-45
>prophage 415
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5265859	5266825	5369387		Tetraselmis_virus(100.0%)	1	NA	NA
AVT91253.1|5265859_5266825_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.6e-37
>prophage 416
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5272763	5280968	5369387	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
AVT91262.1|5272763_5273441_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	29.3	3.0e-06
AVT91263.1|5273437_5274301_+	metal ABC transporter permease	NA	NA	NA	NA	NA
AVT91586.1|5274308_5275187_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT91264.1|5275326_5275824_+	hypothetical protein	NA	B5TK85	Pseudomonas_phage	50.3	1.4e-29
AVT91265.1|5275914_5276973_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
AVT91266.1|5277040_5277541_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVT91267.1|5277791_5280419_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
AVT91268.1|5280490_5280673_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91269.1|5280782_5280968_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 417
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5295686	5300985	5369387		Bacillus_virus(25.0%)	5	NA	NA
AVT91284.1|5295686_5296889_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
AVT91285.1|5297245_5298208_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
AVT91286.1|5298218_5300360_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
AVT91287.1|5300332_5300743_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AVT91288.1|5300739_5300985_-	NrdH-redoxin	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
>prophage 418
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5306166	5307069	5369387		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVT91295.1|5306166_5307069_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
>prophage 419
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5329227	5330748	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT91314.1|5329227_5330748_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.7e-17
>prophage 420
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5344908	5345391	5369387		Staphylococcus_phage(100.0%)	1	NA	NA
AVT91326.1|5344908_5345391_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
>prophage 421
CP024874	Klebsiella pneumoniae strain NH25 chromosome, complete genome	5369387	5360738	5361809	5369387		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVT91345.1|5360738_5361809_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
>prophage 1
CP024875	Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence	227692	254	65059	227692	protease,transposase	Stx2-converting_phage(31.58%)	53	NA	NA
AVT91594.1|254_3050_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	1.2e-128
AVT91595.1|3049_3241_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91596.1|3478_3727_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVT91597.1|3738_4227_+	diguanylate cyclase	NA	NA	NA	NA	NA
AVT91598.1|4213_5176_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVT91770.1|6003_6318_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.1	1.8e-51
AVT91599.1|6314_6662_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVT91600.1|8835_9804_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AVT91771.1|12641_13085_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91601.1|13081_13552_+	RES domain-containing protein	NA	NA	NA	NA	NA
AVT91602.1|13638_14634_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.9e-171
AVT91603.1|14635_15604_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
AVT91604.1|15792_16053_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91605.1|16357_17326_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	94.7	1.1e-176
AVT91606.1|17664_18876_-	creatininase	NA	NA	NA	NA	NA
AVT91607.1|18962_19916_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
AVT91608.1|20072_20921_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT91609.1|20944_21616_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVT91610.1|21612_22275_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVT91611.1|22279_23098_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
AVT91612.1|23094_24060_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVT91613.1|24128_25109_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
AVT91614.1|25872_27411_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.8	4.1e-277
AVT91615.1|27459_27807_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
AVT91616.1|27803_28181_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
AVT91617.1|28936_29248_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVT91618.1|29244_29664_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT91619.1|29733_30147_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	46.3	1.1e-19
AVT91620.1|30192_31116_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	1.4e-176
AVT91621.1|31264_31531_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91622.1|32704_34072_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AVT91623.1|34174_34936_+	histidine utilization repressor	NA	NA	NA	NA	NA
AVT91624.1|34932_35490_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91625.1|35523_37056_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
AVT91626.1|37066_37942_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT91627.1|37972_38653_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT91628.1|38655_39300_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT91629.1|39296_40394_-	glycine/betaine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
AVT91630.1|40901_42578_+	urocanate hydratase	NA	NA	NA	NA	NA
AVT91631.1|42631_44026_+	cytosine permease	NA	NA	NA	NA	NA
AVT91632.1|44037_45246_+	imidazolonepropionase	NA	NA	NA	NA	NA
AVT91633.1|45238_46048_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AVT91634.1|46788_47196_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
AVT91772.1|48291_49101_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91635.1|50389_50683_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91636.1|50995_51424_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91637.1|51460_52429_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AVT91638.1|53476_54280_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91639.1|56446_57883_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.3	7.2e-10
AVT91640.1|57981_58770_+	acetyltransferase	NA	NA	NA	NA	NA
AVT91641.1|60577_60775_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91642.1|62994_63627_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91643.1|63655_65059_-|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
>prophage 2
CP024875	Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence	227692	81430	219448	227692	integrase,transposase	Escherichia_phage(21.28%)	118	185065:185124	188216:189037
AVT91650.1|81430_82399_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
AVT91651.1|82416_82842_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AVT91652.1|82838_83069_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AVT91653.1|83100_83283_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91654.1|83321_85898_-	EstP	NA	NA	NA	NA	NA
AVT91655.1|85900_88108_-	restriction endonuclease	NA	NA	NA	NA	NA
AVT91656.1|88838_89621_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
AVT91657.1|89617_90640_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
AVT91658.1|92525_92705_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
AVT91775.1|92966_93227_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91659.1|96398_96803_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
AVT91660.1|97532_98615_+	lac repressor	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
AVT91661.1|98736_101796_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.9	0.0e+00
AVT91662.1|101847_103101_+	MFS transporter	NA	NA	NA	NA	NA
AVT91663.1|103157_103328_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
AVT91664.1|104492_104819_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91665.1|104899_105796_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVT91666.1|105960_107037_-	dihydroorotase	NA	NA	NA	NA	NA
AVT91667.1|107033_108290_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
AVT91668.1|108326_109268_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
AVT91669.1|109260_110109_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
AVT91670.1|110473_111730_+	MFS transporter	NA	NA	NA	NA	NA
AVT91671.1|111942_113208_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91672.1|113576_114557_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AVT91673.1|114756_115725_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	1.5e-181
AVT91674.1|115768_116050_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91675.1|116146_116407_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AVT91676.1|116463_118527_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AVT91677.1|118609_119029_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AVT91678.1|119389_120394_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVT91679.1|120740_121019_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVT91680.1|121112_121325_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91681.1|121558_121786_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91682.1|122236_122689_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91683.1|123946_124831_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
AVT91684.1|126217_126922_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91685.1|127337_127871_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AVT91686.1|128598_128931_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AVT91687.1|128927_129650_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.6	4.3e-96
AVT91688.1|129707_130136_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
AVT91689.1|130185_131469_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
AVT91690.1|131564_131918_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
AVT91691.1|132400_133879_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
AVT91692.1|133897_134725_+	universal stress protein	NA	NA	NA	NA	NA
AVT91693.1|136014_136470_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVT91694.1|136541_136892_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AVT91695.1|136907_137189_+	mercuric transport protein periplasmic component	NA	NA	NA	NA	NA
AVT91696.1|137216_137624_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AVT91697.1|137662_139345_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	7.4e-38
AVT91698.1|139491_140196_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91699.1|140685_141795_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AVT91700.1|141889_143074_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVT91701.1|143169_143826_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT91702.1|143837_144542_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91703.1|144748_145408_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.1	4.2e-130
AVT91776.1|145608_145986_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVT91704.1|146233_146938_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91705.1|147281_147425_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT91706.1|149076_150087_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
AVT91707.1|150116_150398_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91708.1|150612_150861_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91709.1|150816_151983_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
AVT91710.1|151982_152954_+	plasmid-partitioning protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AVT91711.1|154542_154725_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AVT91712.1|154921_155362_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
AVT91713.1|155358_155709_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	3.4e-38
AVT91714.1|155739_157332_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	1.4e-174
AVT91715.1|157425_157881_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91716.1|157940_158444_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91717.1|158479_160048_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91718.1|160098_161313_-	ABC transporter permease	NA	NA	NA	NA	NA
AVT91719.1|161302_162028_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
AVT91720.1|162027_163995_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AVT91721.1|163991_165011_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91722.1|165004_167719_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91723.1|167718_170787_-	virulence factor SrfB	NA	NA	NA	NA	NA
AVT91724.1|170804_172253_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91777.1|172302_173415_-	tellurite resistance domain protein	NA	NA	NA	NA	NA
AVT91725.1|173496_173979_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91726.1|174058_174796_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91727.1|176159_177128_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
AVT91728.1|178391_178835_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91729.1|178844_179252_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91730.1|179294_180254_+	DNA replication protein	NA	NA	NA	NA	NA
AVT91731.1|180250_181009_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91732.1|181005_181329_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91733.1|181480_181798_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91734.1|181863_183000_-	recombinase	NA	NA	NA	NA	NA
AVT91735.1|183085_184570_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
185065:185124	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AVT91736.1|185128_185833_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91737.1|185866_186100_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT91738.1|186068_187082_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVT91739.1|187252_187711_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.6	8.5e-13
AVT91740.1|187894_188233_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVT91741.1|188279_188984_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91742.1|189278_189815_-	plasmid transfer protein	NA	NA	NA	NA	NA
188216:189037	attR	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCC	NA	NA	NA	NA
AVT91743.1|191053_192070_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVT91744.1|193648_194746_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
AVT91745.1|195320_196289_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
AVT91778.1|196719_197628_+	HNH endonuclease	NA	NA	NA	NA	NA
AVT91746.1|198015_198366_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
AVT91747.1|198509_198941_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVT91748.1|199191_200667_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AVT91749.1|200659_201340_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
AVT91750.1|201529_202915_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91751.1|202943_203297_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVT91752.1|203410_204703_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVT91753.1|204713_207860_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
AVT91754.1|207946_208387_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91755.1|208514_210956_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.9	4.9e-83
AVT91756.1|210996_211194_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVT91757.1|211227_211965_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AVT91758.1|212253_212703_-	copper resistance protein	NA	NA	NA	NA	NA
AVT91759.1|214753_215650_+	copper resistance protein B	NA	NA	NA	NA	NA
AVT91760.1|215689_216070_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AVT91761.1|216074_217004_+	copper resistance protein CopD	NA	NA	NA	NA	NA
AVT91762.1|217058_217739_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVT91763.1|218479_219448_-|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
>prophage 1
CP024876	Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence	129299	0	58530	129299	integrase,transposase	Escherichia_phage(25.0%)	64	63:77	52931:52945
63:77	attL	GACTCGCAGCATTTC	NA	NA	NA	NA
AVT91781.1|166_514_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVT91782.1|630_1476_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AVT91783.1|1656_2130_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AVT91784.1|2262_2715_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AVT91928.1|2811_3366_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVT91785.1|3657_4671_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVT91786.1|4609_4924_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT91787.1|5145_5850_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91788.1|6226_6469_+	relaxase	NA	NA	NA	NA	NA
AVT91789.1|6500_7178_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT91790.1|7256_8456_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AVT91791.1|8487_9372_-	EamA family transporter	NA	NA	NA	NA	NA
AVT91929.1|9509_9902_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVT91792.1|11809_14602_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.7	0.0e+00
AVT91793.1|14618_14951_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVT91794.1|14997_15873_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVT91795.1|16062_16182_+	ABC transporter	NA	NA	NA	NA	NA
AVT91796.1|16220_17201_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AVT91797.1|17665_18259_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVT91798.1|18330_19056_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
AVT91799.1|24396_26709_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AVT91930.1|26835_27219_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91800.1|27716_28448_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AVT91801.1|29168_32018_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AVT91802.1|32017_33385_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AVT91803.1|33374_33818_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AVT91804.1|33863_34421_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AVT91805.1|34392_34632_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
AVT91806.1|34642_35395_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AVT91807.1|35415_35742_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91808.1|35754_36003_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91809.1|35980_36235_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AVT91810.1|36266_38222_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AVT91811.1|38280_38919_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AVT91812.1|38931_39921_-	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AVT91813.1|39917_40307_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91814.1|40348_40975_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AVT91815.1|40974_41364_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AVT91816.1|41363_44003_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AVT91817.1|44074_44467_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91818.1|44848_45253_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91819.1|45319_45631_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91820.1|45631_45850_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91821.1|45955_46366_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91822.1|46497_47082_-	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AVT91823.1|47195_48620_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AVT91824.1|48619_49360_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AVT91825.1|49346_49913_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AVT91826.1|49932_50238_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AVT91827.1|50251_50620_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AVT91828.1|50688_50889_-	TraY domain-containing protein	NA	NA	NA	NA	NA
AVT91829.1|50974_51676_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91830.1|51905_52298_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AVT91831.1|52729_53215_+	lytic transglycosylase	NA	NA	NA	NA	NA
52931:52945	attR	GACTCGCAGCATTTC	NA	NA	NA	NA
AVT91832.1|53247_53577_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91833.1|53609_54431_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AVT91931.1|54527_54746_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91834.1|55238_56447_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	2.8e-47
AVT91835.1|56582_56996_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT91836.1|56996_57275_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AVT91837.1|57264_57585_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AVT91838.1|57665_57890_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91839.1|57900_58113_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91840.1|58173_58530_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 2
CP024876	Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence	129299	63355	67715	129299		Emiliania_huxleyi_virus(33.33%)	6	NA	NA
AVT91849.1|63355_65413_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
AVT91850.1|65482_65731_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AVT91851.1|65779_66322_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.2	4.2e-51
AVT91852.1|66425_66644_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91853.1|66936_67257_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91854.1|67151_67715_-	SAM-dependent methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 3
CP024876	Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence	129299	70753	120968	129299	integrase,transposase	Escherichia_phage(30.43%)	64	86673:86686	94661:94674
AVT91860.1|70753_71008_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
AVT91861.1|71195_71387_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91862.1|71429_71936_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
AVT91863.1|71978_72407_-	antirestriction protein	NA	NA	NA	NA	NA
AVT91864.1|73087_73855_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91865.1|73908_74328_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AVT91866.1|74337_74559_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91867.1|74558_75260_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AVT91868.1|75546_77085_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
AVT91869.1|77133_77481_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AVT91870.1|77477_77882_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
AVT91871.1|78158_78389_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91872.1|78452_79124_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AVT91873.1|79126_80098_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AVT91874.1|80346_81831_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
AVT91875.1|81830_82082_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91876.1|82240_82672_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AVT91877.1|82671_83943_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
AVT91878.1|84354_85230_+	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AVT91933.1|85902_86529_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AVT91879.1|86648_86828_+	Par-like protein	NA	NA	NA	NA	NA
86673:86686	attL	AACTTAAAAGACAT	NA	NA	NA	NA
AVT91880.1|87259_88054_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AVT91881.1|88251_89268_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91882.1|89278_89593_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91934.1|89619_89979_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91883.1|90183_90489_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVT91884.1|90490_90709_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVT91885.1|90760_90955_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91935.1|90878_91217_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91886.1|91339_91537_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91887.1|91526_91817_-	korC	NA	NA	NA	NA	NA
AVT91888.1|91813_92941_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
AVT91889.1|92974_94567_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91890.1|94773_95553_-	hypothetical protein	NA	NA	NA	NA	NA
94661:94674	attR	AACTTAAAAGACAT	NA	NA	NA	NA
AVT91891.1|95565_96066_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91892.1|96340_96604_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91893.1|96600_97167_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91894.1|97197_97692_+	DNA-binding protein	NA	NA	NA	NA	NA
AVT91895.1|97735_98104_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91896.1|98137_98341_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVT91897.1|98389_98647_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91898.1|98722_98977_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91899.1|99112_99889_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AVT91900.1|100129_100453_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91901.1|100631_100865_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	51.3	1.7e-17
AVT91902.1|102711_105609_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AVT91903.1|105703_106309_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVT91936.1|106905_107118_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91937.1|107239_107428_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91904.1|107733_108591_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVT91938.1|108583_108661_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVT91939.1|108892_109144_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT91905.1|109279_109789_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
AVT91906.1|111042_111747_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91907.1|111808_112516_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91908.1|112502_113354_+	replication protein	NA	NA	NA	NA	NA
AVT91909.1|113661_114477_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AVT91910.1|114537_115341_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVT91911.1|115340_116177_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVT91912.1|116237_116942_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91913.1|117092_117908_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AVT91914.1|118097_118802_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT91915.1|119034_119895_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVT91916.1|120263_120968_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
CP024876	Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence	129299	124306	125071	129299	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVT91921.1|124306_125071_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
CP024877	Klebsiella pneumoniae strain NH25 plasmid pNH25.3, complete sequence	109720	0	29430	109720	tail,capsid,terminase	Salmonella_phage(100.0%)	36	NA	NA
AVT91941.1|480_1092_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
AVT91942.1|1079_1877_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AVT91943.1|1869_2568_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AVT91944.1|2654_2990_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
AVT91945.1|3033_7578_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	67.5	0.0e+00
AVT91946.1|7585_7819_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AVT91947.1|7935_8253_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	92.4	2.4e-46
AVT91948.1|8314_9061_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AVT91949.1|9128_9521_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	1.2e-47
AVT91950.1|9522_9996_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AVT91951.1|9986_10331_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
AVT91952.1|10428_11262_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	1.6e-131
AVT91953.1|11261_11696_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AVT91954.1|11743_12172_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
AVT91955.1|12250_13129_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AVT91956.1|13155_14055_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AVT91957.1|14077_15667_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	2.3e-275
AVT91958.1|15684_16941_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AVT91959.1|16943_17585_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AVT91960.1|17760_18027_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AVT91961.1|18036_18927_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
AVT91962.1|18923_19475_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91963.1|19464_20106_-	ABC transporter	NA	J9Q807	Salmonella_phage	96.2	2.6e-108
AVT91964.1|20102_20771_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
AVT91965.1|20770_21451_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
AVT91966.1|21534_23094_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
AVT91967.1|23096_23375_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
AVT91968.1|23439_23976_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91969.1|24746_25103_+	hypothetical protein	NA	NA	NA	NA	NA
AVT91970.1|25152_25683_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	2.5e-56
AVT91971.1|25999_26650_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AVT91972.1|26700_26904_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AVT91973.1|27496_27979_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	7.2e-71
AVT91974.1|28183_28465_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	6.9e-42
AVT91975.1|28591_28999_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91976.1|29118_29430_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	8.8e-30
>prophage 2
CP024877	Klebsiella pneumoniae strain NH25 plasmid pNH25.3, complete sequence	109720	34373	80522	109720	integrase	Salmonella_phage(84.09%)	54	63174:63195	80186:80207
AVT92050.1|34373_34637_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	8.2e-29
AVT92051.1|34787_35489_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	71.4	9.4e-80
AVT91980.1|35577_37263_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	90.6	2.2e-311
AVT91981.1|37391_37970_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.0	1.5e-54
AVT91982.1|38097_38253_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AVT91983.1|38252_38678_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	7.5e-56
AVT91984.1|38780_38969_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AVT91985.1|38965_39244_-	hypothetical protein	NA	NA	NA	NA	NA
AVT91986.1|39675_40263_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
AVT91987.1|40835_41069_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
AVT91988.1|41266_41860_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
AVT91989.1|42044_42878_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	57.1	1.0e-64
AVT91990.1|43003_43561_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
AVT91991.1|43570_43990_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
AVT91992.1|44053_44698_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	77.1	5.2e-93
AVT91993.1|44697_45174_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	2.4e-71
AVT91994.1|45170_45584_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
AVT91995.1|45585_46689_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
AVT91996.1|46882_47758_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
AVT91997.1|47834_48977_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AVT91998.1|49107_51411_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
AVT91999.1|51486_52056_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.4e-94
AVT92000.1|52065_52812_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	1.6e-77
AVT92001.1|52801_54718_-	exonuclease	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
AVT92002.1|54714_54948_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AVT92003.1|54947_56033_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
AVT92004.1|56424_57303_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92005.1|57385_57634_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92006.1|57709_58354_-	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	5.8e-100
AVT92007.1|58450_58663_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92008.1|58674_59772_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.2e-73
AVT92009.1|60202_60415_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	78.6	4.7e-27
AVT92010.1|60414_60750_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
AVT92011.1|60746_60926_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92012.1|62310_63384_-	recombinase	NA	J9Q736	Salmonella_phage	95.7	1.3e-192
63174:63195	attL	CGGCCGTCGCCAGGAAGGTTTT	NA	NA	NA	NA
AVT92013.1|63386_63653_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AVT92014.1|63652_64597_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	4.9e-172
AVT92015.1|64657_65665_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	4.6e-144
AVT92016.1|65784_66216_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
AVT92017.1|66371_66671_-	lipoprotein	NA	NA	NA	NA	NA
AVT92052.1|66682_67063_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	64.3	1.0e-43
AVT92018.1|67302_67746_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.7	8.9e-60
AVT92019.1|67742_71261_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.0	0.0e+00
AVT92020.1|71235_71439_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AVT92021.1|71441_72674_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.6	1.6e-212
AVT92022.1|72770_75056_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.9	8.8e-244
AVT92023.1|75657_76038_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT92024.1|76032_77133_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AVT92025.1|77482_77842_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92026.1|77906_78317_-	toxin YafO	NA	NA	NA	NA	NA
AVT92027.1|78326_78944_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92028.1|79038_79284_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
AVT92029.1|79280_79667_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.2	1.9e-45
AVT92030.1|79676_80522_-	phosphate starvation protein PhoH	NA	W8D063	Erwinia_phage	66.1	4.9e-91
80186:80207	attR	CGGCCGTCGCCAGGAAGGTTTT	NA	NA	NA	NA
>prophage 3
CP024877	Klebsiella pneumoniae strain NH25 plasmid pNH25.3, complete sequence	109720	84164	97927	109720		Salmonella_phage(93.75%)	18	NA	NA
AVT92032.1|84164_84380_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
AVT92033.1|84363_84486_-	hypothetical protein	NA	J9Q729	Salmonella_phage	76.5	4.8e-08
AVT92034.1|84482_85805_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	86.1	1.8e-228
AVT92035.1|85804_86272_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.1	1.3e-48
AVT92036.1|86351_87140_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	9.0e-71
AVT92037.1|87432_88599_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92038.1|88638_89757_-	DNA primase	NA	J9Q720	Salmonella_phage	91.0	4.1e-202
AVT92039.1|89909_91250_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
AVT92040.1|91314_92040_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	9.6e-128
AVT92041.1|92284_93070_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.8	1.8e-07
AVT92042.1|93115_93478_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AVT92043.1|93477_94143_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AVT92044.1|94383_94905_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92045.1|94959_95157_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	65.6	6.4e-18
AVT92046.1|95107_95359_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	4.5e-24
AVT92047.1|95361_96054_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	88.3	3.9e-118
AVT92048.1|96067_96391_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AVT92049.1|96481_97927_-	endosialidase chaperone	NA	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
>prophage 1
CP024878	Klebsiella pneumoniae strain NH25 plasmid pNH25.4, complete sequence	73339	12882	46168	73339	protease,transposase	Enterobacteria_phage(30.77%)	34	NA	NA
AVT92133.1|12882_15768_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
AVT92066.1|15842_16547_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT92067.1|16492_16690_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92068.1|16793_18881_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
AVT92069.1|18893_19844_-	conjugal transfer protein TrbB	NA	NA	NA	NA	NA
AVT92070.1|19854_21117_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
AVT92071.1|21161_21557_-	lytic transglycosylase	NA	NA	NA	NA	NA
AVT92072.1|22124_22778_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVT92073.1|22996_23461_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AVT92074.1|23553_23988_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	55.6	3.2e-30
AVT92075.1|23936_25241_+	DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	49.9	2.5e-110
AVT92076.1|25363_25573_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92077.1|25575_25794_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92078.1|25838_26522_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92079.1|26518_26791_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVT92080.1|26808_28083_-	RelB antitoxin	NA	NA	NA	NA	NA
AVT92081.1|28609_28966_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92082.1|28943_29528_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92083.1|29524_30244_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92084.1|30405_30951_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92085.1|31168_32029_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVT92086.1|32211_32769_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AVT92087.1|32932_35938_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AVT92088.1|37899_38661_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVT92089.1|38681_39542_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVT92090.1|39505_39688_-	hypothetical protein	NA	NA	NA	NA	NA
AVT92091.1|39678_40383_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVT92092.1|40388_43250_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.5	1.3e-183
AVT92093.1|43407_43869_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92094.1|43865_44114_+	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
AVT92095.1|44106_44694_+	restriction endonuclease	NA	NA	NA	NA	NA
AVT92096.1|44690_45176_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92097.1|45172_45421_+	hypothetical protein	NA	NA	NA	NA	NA
AVT92098.1|45439_46168_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	51.6	9.3e-22
