The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	228	52717	4774500	plate,integrase,lysis,tRNA,capsid,terminase,portal,protease,holin,head,tail	Escherichia_phage(38.64%)	56	19864:19879	43019:43034
AVT74063.1|228_756_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.0	1.8e-43
AVT69430.1|755_1349_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
AVT69431.1|1320_1764_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
AVT69432.1|2920_3532_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.1e-116
AVT69433.1|3524_4433_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
AVT69434.1|4437_4785_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
AVT69435.1|4781_5417_-|plate	baseplate assembly protein	plate	A0A0F7LBP2	Escherichia_phage	97.6	1.6e-110
AVT69436.1|5483_5936_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AVT69437.1|5928_6396_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
AVT69438.1|6358_6532_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
AVT69439.1|6503_6929_-	protein lysB	NA	Q858W0	Yersinia_virus	95.7	1.2e-64
AVT69440.1|6916_7342_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	3.6e-58
AVT69441.1|7356_7854_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AVT69442.1|7853_8135_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AVT69443.1|8138_8342_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AVT69444.1|8341_8851_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AVT69445.1|8950_9694_-|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	99.6	2.1e-125
AVT69446.1|9697_10771_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
AVT69447.1|10829_11684_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.6	1.6e-134
AVT69448.1|11857_13630_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
AVT69449.1|13629_14664_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	6.0e-200
AVT69450.1|14856_15858_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69451.1|16327_17872_+	hypothetical protein	NA	Q2P9X0	Enterobacteria_phage	99.0	1.4e-288
AVT73871.1|18037_18256_-	hypothetical protein	NA	Q2P9X1	Enterobacteria_phage	98.6	6.4e-35
AVT69452.1|18359_20636_-	replication protein A	NA	A0A0F7LBQ2	Escherichia_phage	97.6	0.0e+00
19864:19879	attL	ACATCACGAATGGCGT	NA	NA	NA	NA
AVT69453.1|20625_20901_-	hypothetical protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
AVT69454.1|20897_21122_-	hypothetical protein	NA	Q858T6	Yersinia_virus	97.3	1.1e-34
AVT69455.1|21121_21424_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	94.0	5.5e-45
AVT69456.1|21423_21648_-	hypothetical protein	NA	S4TP68	Salmonella_phage	97.3	2.0e-31
AVT69457.1|21711_22212_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AVT69458.1|22208_22406_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AVT69459.1|22389_22746_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AVT69460.1|22850_23162_+	transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
AVT69461.1|23255_24251_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AVT69462.1|24282_25080_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AVT69463.1|25161_25752_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69464.1|25851_26760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT69465.1|26760_28191_-	transporter	NA	NA	NA	NA	NA
AVT69466.1|28400_29549_-	MFS transporter	NA	NA	NA	NA	NA
AVT69467.1|29862_30489_+	hydrolase	NA	NA	NA	NA	NA
AVT69468.1|30523_31387_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVT69469.1|31388_32006_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AVT69470.1|32016_34461_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AVT69471.1|34699_35992_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVT69472.1|36082_37426_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVT69473.1|37436_38048_-	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVT69474.1|38202_42231_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVT69475.1|42365_42860_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVT69476.1|43404_44370_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
43019:43034	attR	ACATCACGAATGGCGT	NA	NA	NA	NA
AVT69477.1|44492_46259_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AVT69478.1|46259_47981_+	amino acid ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	9.9e-22
AVT69479.1|48022_48727_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVT69480.1|49011_49230_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVT69481.1|49829_50033_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69482.1|50089_52366_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
AVT69483.1|52396_52717_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 2
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	366033	420769	4774500	integrase,lysis,capsid,protease,transposase,tail	Enterobacteria_phage(54.55%)	62	400849:400895	420783:420829
AVT69783.1|366033_367146_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVT69784.1|367222_367375_-	protein HokE	NA	NA	NA	NA	NA
AVT69785.1|367472_368324_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	8.7e-112
AVT69786.1|368320_368842_-	DNA-binding protein	NA	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	2.7e-92
AVT69787.1|369109_370228_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVT69788.1|370293_370542_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69789.1|370606_370975_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69790.1|371068_371722_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
AVT69791.1|371829_373077_+	miniconductance mechanosensitive channel YbdG	NA	NA	NA	NA	NA
AVT69792.1|373144_374521_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
AVT69793.1|374622_377766_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	21.9	2.2e-59
AVT69794.1|377777_379001_-	cation efflux system protein CusB	NA	NA	NA	NA	NA
AVT69795.1|379016_379349_-	copper-binding protein	NA	NA	NA	NA	NA
AVT69796.1|379506_380880_-	cation efflux system protein CusC	NA	NA	NA	NA	NA
AVT69797.1|380834_380990_-	copper transporter	NA	NA	NA	NA	NA
AVT69798.1|381036_381720_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AVT69799.1|381709_383158_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
AVT69800.1|383894_385796_+	type VI secretion system Vgr family protein	NA	A0A077K8Q4	Ralstonia_phage	26.3	2.1e-28
AVT69801.1|385823_386285_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69802.1|386304_390822_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.5	3.2e-19
AVT69803.1|390854_391115_+	hypothetical protein	NA	NA	NA	NA	NA
AVT73877.1|391240_391402_+	rhs core protein	NA	NA	NA	NA	NA
AVT69804.1|391692_391890_+	hypothetical protein	NA	NA	NA	NA	NA
AVT73878.1|391835_392168_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69805.1|392366_393503_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVT69806.1|395997_398970_+	phage receptor	NA	NA	NA	NA	NA
AVT69807.1|398970_399861_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69808.1|399774_399987_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69809.1|400043_400805_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
400849:400895	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AVT69810.1|401100_401292_-	hypothetical protein	NA	NA	NA	NA	NA
AVT69811.1|401317_402271_+|protease	protease 7	protease	NA	NA	NA	NA
AVT69812.1|402520_403270_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT69813.1|404144_404801_+	methyltransferase	NA	NA	NA	NA	NA
AVT69814.1|404745_404883_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AVT69815.1|404855_405440_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
AVT69816.1|406059_406644_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.1	1.3e-87
AVT69817.1|407032_407266_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AVT69818.1|407323_407734_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVT69819.1|408412_408901_-	hypothetical protein	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
AVT69820.1|409106_409565_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	6.2e-72
AVT69821.1|409561_410059_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	9.3e-90
AVT69822.1|410058_410274_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AVT69823.1|410847_411945_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	76.3	2.2e-155
AVT69824.1|412134_412518_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AVT69825.1|412603_412744_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	67.4	7.2e-08
AVT69826.1|412740_413103_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
AVT69827.1|413474_414107_+	LexA family transcriptional repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AVT69828.1|414103_414508_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
AVT73879.1|414861_415185_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
AVT69829.1|415181_416063_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69830.1|416251_416620_+	hypothetical protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
AVT69831.1|416699_416990_+	protein kil	NA	M1FN78	Enterobacteria_phage	100.0	1.4e-42
AVT69832.1|417043_417340_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AVT69833.1|417345_418131_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AVT73880.1|418161_418308_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	93.8	2.1e-18
AVT69834.1|418280_418472_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
AVT69835.1|418468_418552_+	hypothetical protein	NA	NA	NA	NA	NA
AVT69836.1|418548_418764_+	cell division protein ZapA	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
AVT69837.1|418862_419081_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AVT69838.1|419128_419407_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AVT69839.1|419378_419750_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AVT69840.1|419605_420769_+|integrase	integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
420783:420829	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 3
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	654741	739039	4774500	plate,integrase,capsid,portal,terminase,transposase,holin,head,tail	Enterobacteria_phage(34.48%)	102	733298:733347	747559:747608
AVT70063.1|654741_656775_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AVT73889.1|656771_656987_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70064.1|656903_657491_+	transcriptional regulator	NA	NA	NA	NA	NA
AVT70065.1|657504_658977_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVT70066.1|658990_660661_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AVT70067.1|660873_661542_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70068.1|661513_661711_+	universal stress protein	NA	NA	NA	NA	NA
AVT70069.1|661617_661830_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70070.1|661784_662480_-	lactate utilization protein C	NA	NA	NA	NA	NA
AVT70071.1|662472_663900_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AVT70072.1|663910_664630_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70073.1|665156_666011_-	transcriptional regulator	NA	NA	NA	NA	NA
AVT70074.1|666236_667562_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-113
AVT70075.1|667670_667907_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70076.1|667918_668512_+	protein RclC	NA	NA	NA	NA	NA
AVT70077.1|669101_669953_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVT70078.1|670092_674349_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AVT70079.1|675464_675566_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70080.1|675929_676193_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AVT70081.1|676192_676333_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AVT70082.1|676367_676595_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70083.1|676656_676836_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70084.1|677370_677961_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVT70085.1|678035_678623_+	fimbrial protein	NA	NA	NA	NA	NA
AVT70086.1|678680_679349_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70087.1|681889_683533_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70088.1|683501_684212_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70089.1|684524_684854_+	ferredoxin	NA	NA	NA	NA	NA
AVT70090.1|684848_685028_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70091.1|685827_685953_+	transporter	NA	NA	NA	NA	NA
AVT70092.1|686132_686822_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AVT70093.1|686818_687775_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
AVT70094.1|687771_689970_+	xanthine dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AVT70095.1|689979_690936_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70096.1|690914_691325_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70097.1|691943_694145_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70098.1|694793_695336_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	67.1	6.6e-57
AVT73890.1|695350_695953_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	88.8	1.1e-95
AVT70099.1|695924_696368_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	63.1	5.1e-47
AVT70100.1|696367_696991_-	hypothetical protein	NA	U5P0I1	Shigella_phage	69.6	2.9e-64
AVT70101.1|696994_697579_-	hypothetical protein	NA	O22003	Shigella_phage	99.5	2.4e-113
AVT70102.1|697569_698628_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	99.1	9.5e-201
AVT70103.1|698614_699043_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	8.9e-81
AVT70104.1|699039_699588_-|plate	baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
AVT70105.1|699587_700667_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
AVT70106.1|700663_702034_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.2	2.1e-253
AVT70107.1|702052_703888_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.7e-306
AVT70108.1|703880_704063_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70109.1|704029_704299_-	hypothetical protein	NA	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AVT70110.1|704298_704655_-|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
AVT70111.1|704654_706151_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.0	2.0e-276
AVT70112.1|706134_706305_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
AVT70113.1|706313_706874_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
AVT70114.1|706870_707377_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
AVT70115.1|707351_707762_-|head,tail	phage head-tail adapter protein	head,tail	M1FJ87	Enterobacteria_phage	94.1	1.4e-70
AVT70116.1|707758_708082_-	hypothetical protein	NA	U5P072	Shigella_phage	98.1	3.3e-56
AVT70117.1|708084_708285_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
AVT70118.1|708334_709540_-|capsid	capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
AVT70119.1|709554_710205_-	primosome assembly protein PriA	NA	U5P4H2	Shigella_phage	100.0	2.5e-119
AVT70120.1|710182_711424_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AVT70121.1|711423_711606_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
AVT70122.1|711617_713351_-|terminase	terminase	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
AVT70123.1|713347_713842_-|terminase	terminase	terminase	U5P067	Shigella_phage	99.4	3.9e-88
AVT70124.1|713967_714318_-	endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	8.9e-63
AVT73891.1|714438_715836_-	hypothetical protein	NA	A0A2L1IV18	Escherichia_phage	47.8	1.9e-87
AVT70125.1|717282_717675_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	85.4	1.6e-52
AVT70126.1|717658_718135_-	lysozyme	NA	U5P0A9	Shigella_phage	96.8	1.7e-85
AVT70127.1|718121_718439_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AVT70128.1|718748_719438_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	46.8	1.4e-56
AVT70129.1|719434_719575_-	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.7e-09
AVT70130.1|719571_719934_-	hypothetical protein	NA	K7PM48	Enterobacteria_phage	94.9	9.5e-60
AVT70131.1|719930_720221_-	hypothetical protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
AVT70132.1|720213_720384_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AVT70133.1|720383_720839_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
AVT70134.1|720835_720937_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70135.1|721113_722532_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70136.1|722583_722808_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70137.1|722902_723190_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	96.8	1.5e-44
AVT70138.1|723186_723888_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	6.0e-127
AVT73892.1|723884_724814_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.4	8.0e-111
AVT70139.1|724900_725440_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AVT70140.1|725470_725698_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
AVT70141.1|725808_726501_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	85.8	3.9e-110
AVT70142.1|726603_727020_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70143.1|728598_728805_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	83.8	2.1e-27
AVT70144.1|728880_729177_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
AVT70145.1|729182_729968_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.1e-148
AVT70146.1|729964_730645_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.6	6.0e-132
AVT70147.1|730641_730824_+	cruciferin	NA	A0A0N7CHV0	Escherichia_phage	95.0	2.6e-26
AVT70148.1|730796_730988_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AVT70149.1|730984_731068_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70150.1|731064_731280_+	cell division protein ZapA	NA	A0A1I9LJM7	Stx_converting_phage	97.2	1.9e-31
AVT70151.1|731378_731597_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AVT70152.1|731644_731923_+	hypothetical protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AVT70153.1|731894_732245_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	96.6	8.6e-58
733298:733347	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
AVT70154.1|733435_734509_+|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	38.0	1.9e-47
AVT70155.1|734526_735924_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70156.1|735928_736117_+	hypothetical protein	NA	NA	NA	NA	NA
AVT70157.1|736153_736366_-	hypothetical protein	NA	NA	NA	NA	NA
AVT70158.1|736435_737830_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
AVT70159.1|738017_738674_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AVT70160.1|738739_739039_+|transposase	transposase	transposase	NA	NA	NA	NA
747559:747608	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
>prophage 4
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	1818970	1834602	4774500	integrase,transposase	Escherichia_phage(33.33%)	15	1815520:1815536	1834909:1834925
1815520:1815536	attL	AGATCACAGGAGTCGAA	NA	NA	NA	NA
AVT71124.1|1818970_1819951_+|transposase	IS5/IS1182 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.5e-184
AVT73933.1|1819988_1820123_-	ABC transporter	NA	NA	NA	NA	NA
AVT73934.1|1820609_1820993_+	hypothetical protein	NA	NA	NA	NA	NA
AVT71125.1|1820989_1821415_+	hypothetical protein	NA	NA	NA	NA	NA
AVT71126.1|1822926_1824078_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.6e-42
AVT71127.1|1824034_1824391_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	92.5	2.6e-33
AVT71128.1|1824417_1824564_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVT71129.1|1824853_1825054_-	alkaline phosphatase	NA	NA	NA	NA	NA
AVT71130.1|1825423_1828921_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
AVT71131.1|1828948_1829203_+	hypothetical protein	NA	NA	NA	NA	NA
AVT71132.1|1829549_1830416_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
AVT71133.1|1830412_1830712_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT71134.1|1831590_1831821_-	hypothetical protein	NA	NA	NA	NA	NA
AVT71135.1|1831963_1833007_-	hypothetical protein	NA	NA	NA	NA	NA
AVT71136.1|1833417_1834602_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	69.9	2.6e-162
1834909:1834925	attR	AGATCACAGGAGTCGAA	NA	NA	NA	NA
>prophage 5
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	2812978	2820118	4774500		Escherichia_phage(83.33%)	6	NA	NA
AVT72056.1|2812978_2813617_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AVT72057.1|2813613_2814876_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
AVT72058.1|2814872_2815781_-	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AVT72059.1|2815976_2816744_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AVT72060.1|2816794_2817451_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
AVT72061.1|2817556_2820118_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.0e-30
>prophage 6
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	2899839	2909407	4774500	integrase,capsid	Enterobacteria_phage(83.33%)	12	2899406:2899423	2909422:2909439
2899406:2899423	attL	AAACGTGTACCAATTATG	NA	NA	NA	NA
AVT72133.1|2899839_2902173_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.5	0.0e+00
AVT72134.1|2902187_2902508_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72135.1|2902504_2902732_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72136.1|2902728_2903277_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.8	1.2e-29
AVT72137.1|2903273_2903540_-	hypothetical protein	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVT72138.1|2903859_2904048_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72139.1|2904077_2904821_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AVT72140.1|2904824_2905064_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	61.7	1.7e-20
AVT72141.1|2905079_2905646_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.9e-60
AVT72142.1|2906026_2906872_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72143.1|2906873_2908211_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72144.1|2908213_2909407_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.8	2.8e-108
2909422:2909439	attR	CATAATTGGTACACGTTT	NA	NA	NA	NA
>prophage 7
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3011327	3074877	4774500	protease,integrase,tRNA,transposase	Escherichia_phage(33.33%)	60	3016411:3016430	3085573:3085592
AVT72240.1|3011327_3012167_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	52.2	5.2e-77
AVT72241.1|3012163_3012685_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	33.1	2.2e-17
AVT72242.1|3012768_3013614_-	sulfurtransferase	NA	NA	NA	NA	NA
AVT72243.1|3013820_3018782_+	hypothetical protein	NA	NA	NA	NA	NA
3016411:3016430	attL	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
AVT72244.1|3018782_3021095_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AVT72245.1|3021243_3021675_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
AVT72246.1|3021824_3022979_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AVT72247.1|3023263_3024277_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AVT72248.1|3024303_3025422_+	4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin)	NA	NA	NA	NA	NA
AVT72249.1|3025532_3026807_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AVT72250.1|3026824_3027445_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72251.1|3027455_3028634_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AVT73976.1|3028751_3030224_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AVT72252.1|3030292_3030508_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72253.1|3030504_3031875_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
AVT72254.1|3032036_3033503_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AVT72255.1|3033571_3035149_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVT72256.1|3035457_3036666_+|integrase	integrase	integrase	G9L697	Escherichia_phage	53.9	2.5e-120
AVT72257.1|3036951_3037182_+	DNA-binding protein	NA	NA	NA	NA	NA
AVT72258.1|3037185_3038082_+	replication protein A	NA	NA	NA	NA	NA
AVT72259.1|3038068_3038821_+	ABC transporter ATPase	NA	NA	NA	NA	NA
AVT72260.1|3039311_3039632_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72261.1|3039634_3041254_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
AVT72262.1|3041256_3041442_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72263.1|3041444_3042239_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
AVT72264.1|3042508_3042733_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72265.1|3042735_3042945_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72266.1|3043036_3043279_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72267.1|3043623_3044004_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AVT72268.1|3044000_3045953_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AVT72269.1|3046085_3047093_+	hypothetical protein	NA	NA	NA	NA	NA
AVT73977.1|3047656_3048103_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72270.1|3048166_3048355_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72271.1|3048351_3049050_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72272.1|3049206_3051315_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72273.1|3052036_3052867_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.3e-51
AVT72274.1|3054204_3054645_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVT72275.1|3054575_3055775_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AVT72276.1|3055853_3056531_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVT72277.1|3056562_3056805_-|transposase	transposase	transposase	NA	NA	NA	NA
AVT72278.1|3056727_3056892_+	hypothetical protein	NA	NA	NA	NA	NA
AVT72279.1|3057191_3058028_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVT72280.1|3058027_3058831_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AVT72281.1|3058891_3059707_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AVT72282.1|3060106_3060646_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AVT72283.1|3060661_3061180_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AVT72284.1|3061282_3061429_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AVT72285.1|3061490_3061682_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVT72286.1|3061699_3061852_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
AVT72287.1|3062033_3064277_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AVT72288.1|3064315_3065857_-	exopolyphosphatase	NA	NA	NA	NA	NA
AVT72289.1|3065861_3067928_-	polyphosphate kinase	NA	NA	NA	NA	NA
AVT72290.1|3068098_3068737_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AVT72291.1|3068736_3069774_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AVT72292.1|3069792_3069978_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72293.1|3070098_3070725_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVT72294.1|3070810_3072100_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
AVT72295.1|3072149_3072896_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AVT72296.1|3073033_3073393_-	oxidoreductase	NA	NA	NA	NA	NA
AVT72297.1|3073413_3074877_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
3085573:3085592	attR	AAACACCAGCAAAAATGCGT	NA	NA	NA	NA
>prophage 8
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3199749	3216640	4774500	integrase	Enterobacteria_phage(60.0%)	25	3199661:3199676	3215557:3215572
3199661:3199676	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
AVT72408.1|3199749_3199950_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AVT72409.1|3200361_3200715_-	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	90.4	3.0e-34
AVT72410.1|3200711_3201095_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	73.3	1.6e-41
AVT72411.1|3201091_3201607_-	hypothetical protein	NA	V5URG6	Shigella_phage	100.0	3.2e-101
AVT73982.1|3201608_3202055_-	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	98.2	1.3e-55
AVT72412.1|3202060_3202225_-	hypothetical protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
AVT72413.1|3202235_3202532_-	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	89.8	4.3e-42
AVT72414.1|3202555_3202939_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	99.2	6.5e-67
AVT72415.1|3202938_3203544_-	recombinase	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
AVT72416.1|3203645_3203804_-	hypothetical protein	NA	Q716E5	Shigella_phage	100.0	2.4e-23
AVT72417.1|3203800_3203953_-	protein kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AVT72418.1|3203937_3204177_-	hypothetical protein	NA	K7P848	Enterobacteria_phage	96.7	6.5e-25
AVT72419.1|3204257_3204446_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
AVT72420.1|3204442_3204742_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	96.9	2.1e-49
AVT72421.1|3204794_3205244_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.2	6.2e-69
AVT72422.1|3205302_3205503_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	2.7e-32
AVT73983.1|3205798_3206224_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	98.6	3.1e-78
AVT72423.1|3206648_3207773_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	97.8	3.0e-213
AVT73984.1|3208063_3208621_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	1.0e-68
AVT72424.1|3208620_3209076_+	hypothetical protein	NA	A5VW67	Enterobacteria_phage	99.3	6.7e-87
AVT72425.1|3211478_3212810_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.9	2.1e-64
AVT72426.1|3212806_3213727_-	glycosyltransferase	NA	M1FQW5	Enterobacteria_phage	90.2	3.8e-161
AVT72427.1|3213723_3214086_-	translocase	NA	U5P0S6	Shigella_phage	91.7	4.1e-55
AVT72428.1|3214238_3215396_-|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
AVT72429.1|3215707_3216640_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3215557:3215572	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 9
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3460421	3469863	4774500		Enterobacteria_phage(85.71%)	10	NA	NA
AVT72651.1|3460421_3461348_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AVT72652.1|3461352_3462084_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
AVT72653.1|3462064_3462172_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72654.1|3462231_3462963_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
AVT72655.1|3463184_3464870_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AVT72656.1|3464866_3465586_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVT72657.1|3465632_3466103_+	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
AVT72658.1|3466143_3466605_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AVT72659.1|3466729_3468730_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
AVT72660.1|3468726_3469863_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 10
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3560918	3567229	4774500		Enterobacteria_phage(50.0%)	7	NA	NA
AVT72736.1|3560918_3562313_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
AVT72737.1|3562487_3563381_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AVT72738.1|3563417_3563681_-	hypothetical protein	NA	NA	NA	NA	NA
AVT72739.1|3563752_3564838_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AVT72740.1|3564837_3565737_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AVT72741.1|3565794_3566673_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.4	1.3e-105
AVT72742.1|3566677_3567229_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	6.8e-49
>prophage 11
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	4289998	4329339	4774500	integrase,lysis,tRNA,transposase,terminase,holin	Escherichia_phage(44.12%)	51	4291918:4291932	4323989:4324003
AVT73402.1|4289998_4291132_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
AVT73403.1|4291272_4291707_+	universal stress protein F	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
4291918:4291932	attL	ATACAACCTGAACAA	NA	NA	NA	NA
AVT73404.1|4292666_4292900_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AVT73405.1|4293216_4293807_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AVT74026.1|4293904_4294555_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	69.9	8.2e-54
AVT73406.1|4294580_4295675_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.0e-113
AVT73407.1|4295678_4295888_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73408.1|4295865_4296798_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	2.4e-83
AVT73409.1|4297236_4297536_+|transposase	transposase	transposase	NA	NA	NA	NA
AVT73410.1|4297532_4298399_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
AVT73411.1|4298426_4298840_-	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	53.5	7.8e-34
AVT73412.1|4298757_4299039_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73413.1|4298977_4300435_-	potassium transporter TrkG	NA	NA	NA	NA	NA
AVT73414.1|4300631_4300817_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AVT73415.1|4301033_4301531_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
AVT73416.1|4301530_4301746_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AVT74027.1|4301997_4302372_-	tolA family protein	NA	NA	NA	NA	NA
AVT73417.1|4302543_4302972_-	protein TolA	NA	NA	NA	NA	NA
AVT73418.1|4303382_4303595_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73419.1|4304015_4304558_-	antiterminator	NA	A0A0U2S606	Escherichia_phage	75.1	8.3e-76
AVT73420.1|4304554_4304845_-	hypothetical protein	NA	A0A0U2KD41	Escherichia_phage	86.5	5.3e-45
AVT73421.1|4304844_4305444_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.5e-105
AVT73422.1|4305908_4306121_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	67.7	1.3e-13
AVT73423.1|4306784_4307984_+	MFS transporter	NA	NA	NA	NA	NA
AVT73424.1|4307995_4308688_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AVT73425.1|4308684_4309566_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVT73426.1|4309696_4310974_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73427.1|4311037_4313041_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AVT73428.1|4313375_4313798_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AVT73429.1|4313838_4314909_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AVT73430.1|4314980_4315406_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AVT73431.1|4315389_4315671_-	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AVT73432.1|4315771_4316191_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AVT73433.1|4316445_4316580_+	hypothetical protein	NA	NA	NA	NA	NA
AVT73434.1|4316590_4316746_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AVT73435.1|4316742_4317231_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
AVT73436.1|4317265_4317457_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73437.1|4317672_4317894_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
AVT74028.1|4317893_4318064_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AVT73438.1|4318138_4318414_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AVT73439.1|4318515_4321116_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
AVT73440.1|4321108_4321918_+	recombination and repair protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	1.2e-105
AVT73441.1|4321974_4322169_+	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AVT73442.1|4322161_4322350_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
AVT73443.1|4322449_4322665_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AVT73444.1|4322666_4323902_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	97.8	2.8e-236
AVT73445.1|4323953_4324889_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
4323989:4324003	attR	ATACAACCTGAACAA	NA	NA	NA	NA
AVT73446.1|4325017_4326391_-	ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVT73447.1|4326420_4326594_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73448.1|4326868_4327852_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVT74029.1|4328106_4329339_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 12
CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	4727177	4774444	4774500	protease,tail,tRNA	Escherichia_phage(45.0%)	42	NA	NA
AVT73832.1|4727177_4728578_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVT73833.1|4729179_4730268_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.5	2.8e-99
AVT74060.1|4730283_4730454_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73834.1|4730452_4731643_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVT73835.1|4731864_4732512_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVT74061.1|4732538_4733087_-	hypothetical protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AVT73836.1|4733267_4735115_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AVT73837.1|4735375_4739836_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AVT73838.1|4739835_4740540_-	condensin subunit E	NA	NA	NA	NA	NA
AVT73839.1|4740520_4741843_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVT73840.1|4741839_4742625_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVT73841.1|4742760_4743540_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVT73842.1|4743516_4744410_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73843.1|4744563_4745310_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVT73844.1|4745306_4745489_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73845.1|4745540_4746773_-	hypothetical protein	NA	NA	NA	NA	NA
AVT73846.1|4746809_4747796_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVT73847.1|4747792_4749541_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AVT73848.1|4749577_4751842_-	ComEC family protein	NA	NA	NA	NA	NA
AVT73849.1|4752049_4752334_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AVT73850.1|4752493_4754167_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVT73851.1|4754277_4754961_-	cytidylate kinase	NA	NA	NA	NA	NA
AVT73852.1|4755133_4755898_-|protease	metalloprotease	protease	NA	NA	NA	NA
AVT73853.1|4756066_4757350_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVT73854.1|4757420_4758509_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AVT73855.1|4758707_4759400_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AVT73856.1|4759529_4761290_+	ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
AVT73857.1|4761695_4762553_+	formate transporter FocA	NA	NA	NA	NA	NA
AVT73858.1|4762607_4764890_+	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AVT73859.1|4765208_4765427_-	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
AVT73860.1|4765508_4766672_-	hypothetical protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
AVT73861.1|4766671_4767151_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.1	7.3e-84
AVT73862.1|4767165_4769613_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.2	0.0e+00
AVT74062.1|4769605_4769725_-|tail	phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AVT73863.1|4769757_4770033_-	hypothetical protein	NA	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AVT73864.1|4770090_4770609_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AVT73865.1|4770621_4771812_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
AVT73866.1|4771871_4772465_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	98.0	1.6e-104
AVT73867.1|4772495_4773065_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.7	2.1e-45
AVT73868.1|4773064_4773658_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
AVT73869.1|4773629_4774073_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
AVT73870.1|4774072_4774444_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	49.4	4.7e-14
