The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	0	18840	4740838	protease	Iris_mild_mosaic_virus(100.0%)	13	NA	NA
AVS50321.1|788_1544_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AVS50322.1|1587_2493_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AVS50323.1|2536_4252_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AVS50324.1|4248_5583_-	MFS transporter	NA	NA	NA	NA	NA
AVS50325.1|5922_7032_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
AVS54721.1|7132_8686_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS50326.1|8695_9241_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50327.1|9287_10796_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AVS54722.1|10994_11321_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AVS50328.1|11396_12227_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AVS50329.1|12320_13079_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
AVS50330.1|13147_15853_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS50331.1|16446_18840_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 2
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	24900	25815	4740838	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS50337.1|24900_25815_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 3
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	32427	36190	4740838		Bacillus_phage(66.67%)	3	NA	NA
AVS50344.1|32427_33147_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVS50345.1|33143_34496_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AVS50346.1|34570_36190_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
>prophage 4
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	53230	54067	4740838		Vibrio_phage(100.0%)	1	NA	NA
AVS50361.1|53230_54067_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 5
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	71672	75669	4740838		Acinetobacter_phage(50.0%)	3	NA	NA
AVS50374.1|71672_72236_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
AVS50375.1|72321_73539_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVS50376.1|73581_75669_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
>prophage 6
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	80255	82163	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS50384.1|80255_82163_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	6.5e-75
>prophage 7
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	88124	93695	4740838		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AVS50393.1|88124_88511_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.0e-20
AVS50394.1|88510_88867_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AVS50395.1|88874_89162_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVS50396.1|89287_89662_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVS50397.1|89757_90228_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVS50398.1|90324_92439_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AVS50399.1|92510_93695_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 8
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	113587	117907	4740838	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
AVS50438.1|113587_114535_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	6.5e-07
AVS50439.1|114550_115060_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AVS50440.1|115191_116316_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVS50441.1|116287_116761_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50442.1|116787_117330_+	DNA topoisomerase	NA	NA	NA	NA	NA
AVS50443.1|117334_117907_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
>prophage 9
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	125551	126806	4740838	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
AVS50447.1|125551_126806_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 10
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	133359	136717	4740838		Bacillus_virus(50.0%)	3	NA	NA
AVS50452.1|133359_135435_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.0e-22
AVS50453.1|135585_135750_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AVS50454.1|135832_136717_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
>prophage 11
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	148802	149846	4740838		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS50467.1|148802_149846_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 12
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	164407	166801	4740838	transposase	Salmonella_phage(100.0%)	2	NA	NA
AVS50480.1|164407_165670_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS50481.1|165925_166801_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 13
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	171356	172625	4740838		Oenococcus_phage(100.0%)	1	NA	NA
AVS50488.1|171356_172625_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.0	2.6e-59
>prophage 14
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	179624	180992	4740838	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS50496.1|179624_180992_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 15
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	185861	189896	4740838	protease	Pseudomonas_phage(50.0%)	4	NA	NA
AVS50504.1|185861_186362_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
AVS50505.1|186470_187262_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVS50506.1|187396_188290_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVS50507.1|188405_189896_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
>prophage 16
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	194686	195790	4740838		Salmonella_phage(100.0%)	1	NA	NA
AVS50513.1|194686_195790_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 17
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	202556	217462	4740838		Staphylococcus_phage(28.57%)	17	NA	NA
AVS50516.1|202556_203486_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
AVS50517.1|203579_205916_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	2.7e-38
AVS50518.1|206142_206796_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVS50519.1|206792_207521_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVS50520.1|207595_208228_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50521.1|208476_208749_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVS50522.1|208745_209600_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVS50523.1|209645_210137_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVS50524.1|210254_210542_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVS50525.1|210564_211998_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVS50526.1|212045_212771_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AVS50527.1|212777_213332_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVS50528.1|213300_213876_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVS50529.1|213872_214439_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	2.7e-53
AVS50530.1|214459_215446_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AVS50531.1|215459_216437_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVS50532.1|216649_217462_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
>prophage 18
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	221571	223062	4740838		Vibrio_phage(50.0%)	2	NA	NA
AVS50538.1|221571_221859_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
AVS50539.1|222090_223062_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.3	1.0e-07
>prophage 19
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	229784	232672	4740838	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVS50548.1|229784_231719_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
AVS50549.1|231823_232672_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.8e-21
>prophage 20
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	236137	242794	4740838		Dickeya_phage(50.0%)	4	NA	NA
AVS50553.1|236137_237481_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	3.1e-63
AVS50554.1|238096_238561_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVS50555.1|238588_240091_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVS50556.1|240115_242794_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 21
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	248278	250219	4740838		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS50561.1|248278_250219_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.9e-52
>prophage 22
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	257355	264004	4740838		Invertebrate_iridovirus(25.0%)	9	NA	NA
AVS50571.1|257355_257673_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	6.5e-12
AVS50572.1|257710_258154_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50573.1|258133_258652_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AVS50574.1|258782_259418_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50575.1|259484_260060_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVS50576.1|260069_260660_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AVS50577.1|260681_261077_-	YraN family protein	NA	NA	NA	NA	NA
AVS50578.1|261034_263077_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVS50579.1|263140_264004_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.5e-50
>prophage 23
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	274691	275837	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS50590.1|274691_275837_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	3.5e-47
>prophage 24
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	282198	284493	4740838		Tetraselmis_virus(100.0%)	1	NA	NA
AVS50596.1|282198_284493_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	7.4e-158
>prophage 25
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	297689	298658	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS50613.1|297689_298658_-	hypothetical protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 26
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	304849	321712	4740838	tRNA	Klosneuvirus(14.29%)	16	NA	NA
AVS50619.1|304849_306229_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
AVS50620.1|306188_306371_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50621.1|306658_308179_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
AVS50622.1|308566_310132_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
AVS50623.1|310128_310776_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVS50624.1|311007_311775_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AVS50625.1|312055_312562_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVS50626.1|312685_314668_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AVS50627.1|314682_316428_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AVS50628.1|316663_316879_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVS50629.1|317106_318120_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
AVS50630.1|318023_318362_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50631.1|318369_318981_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVS50632.1|319087_319447_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVS50633.1|319544_320366_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVS50634.1|320470_321712_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
>prophage 27
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	326940	328374	4740838		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS50638.1|326940_328374_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 28
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	332425	333079	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS50642.1|332425_333079_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 29
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	338835	340676	4740838		Ralstonia_phage(50.0%)	2	NA	NA
AVS50649.1|338835_339999_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
AVS50650.1|340004_340676_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
>prophage 30
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	345076	346969	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS50656.1|345076_346969_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 31
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	350284	353984	4740838		Stx_converting_phage(50.0%)	3	NA	NA
AVS50661.1|350284_350677_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
AVS50662.1|350748_351615_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS50663.1|351725_353984_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	36.0	1.0e-87
>prophage 32
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	359821	365526	4740838		Pseudomonas_phage(33.33%)	5	NA	NA
AVS50669.1|359821_361993_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
AVS50670.1|362195_362390_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50671.1|362547_363003_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AVS50672.1|363047_364502_-	anion permease	NA	NA	NA	NA	NA
AVS50673.1|364698_365526_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 33
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	371467	376607	4740838		Diadromus_pulchellus_ascovirus(50.0%)	6	NA	NA
AVS50681.1|371467_372352_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
AVS50682.1|372475_372880_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVS50683.1|372866_373277_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50684.1|373368_373884_+	RNA helicase	NA	NA	NA	NA	NA
AVS50685.1|374162_374657_+	TIGR00645 family protein	NA	NA	NA	NA	NA
AVS50686.1|374963_376607_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
>prophage 34
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	392035	393508	4740838		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS50703.1|392035_393508_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	7.9e-44
>prophage 35
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	396907	397786	4740838		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS50706.1|396907_397786_+	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	27.9	6.0e-07
>prophage 36
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	419692	420775	4740838		Geobacillus_virus(100.0%)	1	NA	NA
AVS50725.1|419692_420775_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 37
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	438085	439240	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS50746.1|438085_439240_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 38
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	445068	446541	4740838		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS50751.1|445068_446541_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.2e-47
>prophage 39
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	454557	455214	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS50759.1|454557_455214_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	2.5e-10
>prophage 40
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	466403	467636	4740838		Catovirus(100.0%)	1	NA	NA
AVS50774.1|466403_467636_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 41
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	475904	481608	4740838		Prochlorococcus_phage(50.0%)	4	NA	NA
AVS50783.1|475904_478778_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.1	1.8e-262
AVS50784.1|479003_479150_+	immunoglobulin	NA	NA	NA	NA	NA
AVS50785.1|479233_480127_+	transporter	NA	NA	NA	NA	NA
AVS50786.1|480174_481608_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
>prophage 42
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	485593	496131	4740838	tRNA	Brevibacillus_phage(16.67%)	11	NA	NA
AVS50795.1|485593_486490_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
AVS50796.1|486513_487227_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVS50797.1|487232_488966_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	6.2e-64
AVS50798.1|489070_490168_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVS50799.1|490178_491696_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AVS50800.1|491771_492317_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVS50801.1|492367_492556_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50802.1|492581_493340_+	endopeptidase	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AVS50803.1|493624_494431_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AVS54739.1|495363_495549_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50804.1|495594_496131_+	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
>prophage 43
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	510838	513372	4740838		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVS50821.1|510838_511600_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	7.7e-19
AVS50822.1|511953_513372_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	3.5e-25
>prophage 44
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	524202	531157	4740838		Moraxella_phage(33.33%)	6	NA	NA
AVS50832.1|524202_524916_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
AVS50833.1|525097_525793_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVS50834.1|526475_527006_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVS50835.1|527018_529265_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AVS50836.1|529480_530356_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVS50837.1|530362_531157_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
>prophage 45
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	536639	553218	4740838	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AVS50844.1|536639_539528_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.5e-62
AVS50845.1|539520_543066_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
AVS50846.1|543062_544898_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	1.9e-18
AVS50847.1|545000_546332_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVS50848.1|546564_547818_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
AVS50849.1|548317_549415_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVS50850.1|549524_550331_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
AVS54740.1|550382_551270_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AVS50851.1|551569_552013_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVS50852.1|552012_553218_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	2.5e-72
>prophage 46
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	564761	565577	4740838		Bacillus_phage(100.0%)	1	NA	NA
AVS50864.1|564761_565577_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 47
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	570444	571293	4740838		Vibrio_phage(100.0%)	1	NA	NA
AVS50868.1|570444_571293_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	5.5e-42
>prophage 48
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	578711	584007	4740838		Streptococcus_phage(33.33%)	3	NA	NA
AVS50877.1|578711_579854_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
AVS50878.1|579897_582654_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
AVS50879.1|582711_584007_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.3	1.3e-37
>prophage 49
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	597428	601254	4740838		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
AVS50893.1|597428_599066_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
AVS50894.1|599148_600447_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
AVS50895.1|600582_601254_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 50
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	622547	624579	4740838		Hokovirus(50.0%)	2	NA	NA
AVS50913.1|622547_623987_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.5	2.7e-33
AVS50914.1|623973_624579_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
>prophage 51
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	627689	638116	4740838		Escherichia_phage(50.0%)	12	NA	NA
AVS50920.1|627689_628451_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
AVS50921.1|628444_629071_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AVS50922.1|629246_630380_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AVS50923.1|630442_631435_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVS50924.1|631479_631716_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50925.1|631726_633154_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AVS50926.1|633153_633747_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AVS50927.1|633917_634322_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS50928.1|634340_635105_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
AVS50929.1|635301_636225_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	2.8e-116
AVS50930.1|636218_637481_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.0e-132
AVS50931.1|637477_638116_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
>prophage 52
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	644082	648156	4740838		Catovirus(50.0%)	3	NA	NA
AVS50938.1|644082_646650_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
AVS50939.1|646807_647329_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVS50940.1|647499_648156_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	47.4	1.1e-50
>prophage 53
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	653665	655354	4740838		Vibrio_phage(100.0%)	1	NA	NA
AVS50947.1|653665_655354_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 54
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	688854	689676	4740838		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS50984.1|688854_689676_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 55
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	713592	714558	4740838		Tetraselmis_virus(100.0%)	1	NA	NA
AVS51009.1|713592_714558_-	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	3.0e-36
>prophage 56
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	720465	727831	4740838	tRNA	Pseudomonas_phage(20.0%)	8	NA	NA
AVS54745.1|720465_720963_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
AVS51018.1|721047_722109_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AVS51019.1|722225_722726_+	regulatory protein RecX	NA	NA	NA	NA	NA
AVS51020.1|722722_722929_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51021.1|722961_725592_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
AVS51022.1|725826_726012_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVS51023.1|726024_726300_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51024.1|727264_727831_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
>prophage 57
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	739667	744722	4740838		Bacillus_virus(25.0%)	4	NA	NA
AVS51035.1|739667_740870_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
AVS51036.1|741224_742184_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
AVS51037.1|742194_744339_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.7	8.4e-196
AVS51038.1|744311_744722_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
>prophage 58
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	751220	755224	4740838		Clostridium_phage(50.0%)	4	NA	NA
AVS51051.1|751220_751670_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
AVS51052.1|751691_752369_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AVS51053.1|752410_753811_-	GABA permease	NA	NA	NA	NA	NA
AVS51054.1|753940_755224_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	7.9e-32
>prophage 59
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	775595	781707	4740838		Bacillus_phage(50.0%)	4	NA	NA
AVS51072.1|775595_779249_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
AVS51073.1|779329_780445_-	glycosyl transferase	NA	NA	NA	NA	NA
AVS51074.1|780549_780732_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51075.1|781134_781707_+	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
>prophage 60
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	786328	788509	4740838		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS51078.1|786328_788509_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 61
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	802068	802551	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS54748.1|802068_802551_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 62
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	813008	875615	4740838	tail,head,terminase,integrase,holin,tRNA,capsid,portal	Cronobacter_phage(55.26%)	62	820987:821002	849603:849618
AVS51092.1|813008_813776_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVS51093.1|813816_814164_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVS51094.1|814321_815542_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AVS51095.1|815534_816053_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVS51096.1|816492_817563_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AVS51097.1|817572_818694_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVS51098.1|818751_819660_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AVS51099.1|819620_820781_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AVS54751.1|820880_820928_-	hypothetical protein	NA	NA	NA	NA	NA
820987:821002	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AVS51100.1|821091_822111_-|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
AVS51101.1|822150_822450_-	transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
AVS51102.1|822558_822897_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51103.1|822922_823255_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51104.1|823264_823834_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
AVS51105.1|823836_824055_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51106.1|824093_826751_+	bifunctional DNA primase/helicase	NA	A0A077K8T2	Ralstonia_phage	47.4	6.0e-244
AVS51107.1|826778_827102_-	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
AVS51108.1|827101_828121_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.1	1.1e-134
AVS51109.1|828117_829902_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.7	1.0e-247
AVS51110.1|829959_830949_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	49.2	4.3e-46
AVS51111.1|830983_832012_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	1.7e-133
AVS51112.1|832023_832722_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	2.7e-63
AVS51113.1|832820_833273_+|head	head completion protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
AVS51114.1|833269_833755_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	49.4	6.2e-38
AVS51115.1|833748_834453_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	60.3	1.4e-70
AVS51116.1|834449_835577_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.2	1.6e-174
AVS51117.1|835573_836029_+	DUF2597 domain-containing protein	NA	F1BUL4	Cronobacter_phage	71.5	1.7e-58
AVS51118.1|836041_836338_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
AVS51119.1|836334_836676_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
AVS51120.1|836675_837008_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	4.4e-35
AVS51121.1|836934_837168_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
AVS51122.1|837145_837412_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.4e-20
AVS51123.1|837599_839567_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	1.1e-271
AVS51124.1|839563_839893_+	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
AVS51125.1|839889_841074_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	5.1e-179
AVS51126.1|841060_841654_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
AVS51127.1|841663_843898_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	71.2	5.0e-167
AVS51128.1|843910_844465_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	95.6	5.7e-96
AVS51129.1|844454_845180_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	1.9e-67
AVS51130.1|845151_845697_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	70.9	1.0e-57
AVS51131.1|845696_847400_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	7.1e-222
AVS51132.1|848504_849116_+	iron-sulfur cluster assembly scaffold protein SufA	NA	NA	NA	NA	NA
AVS51133.1|849127_849508_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AVS51134.1|849647_849986_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
849603:849618	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
AVS51135.1|850257_850995_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVS51136.1|851126_852107_+	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AVS51137.1|852103_852835_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVS51138.1|852964_855538_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
AVS51139.1|861415_861871_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	6.6e-34
AVS51140.1|861974_863276_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
AVS51141.1|863272_863596_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51142.1|863640_864996_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AVS51143.1|865110_867771_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVS51144.1|867824_868505_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVS51145.1|868577_868997_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AVS51146.1|869200_870238_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVS51147.1|870353_871043_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AVS51148.1|871361_871745_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AVS51149.1|871806_872394_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVS54752.1|872496_873396_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS51150.1|873413_874748_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AVS51151.1|874877_875615_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 63
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	880587	888433	4740838		Streptococcus_phage(25.0%)	9	NA	NA
AVS51159.1|880587_882387_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AVS51160.1|882403_883378_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVS51161.1|883651_884332_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AVS51162.1|884328_885234_+	GTPase Era	NA	NA	NA	NA	NA
AVS51163.1|885245_885974_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVS51164.1|885985_886717_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVS51165.1|886716_887097_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVS51166.1|887208_887469_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AVS51167.1|887506_888433_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
>prophage 64
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	897017	907009	4740838		Bacillus_phage(50.0%)	6	NA	NA
AVS51177.1|897017_900905_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.1e-128
AVS51178.1|901599_902985_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.5e-15
AVS51179.1|902986_903751_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVS51180.1|903747_905085_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AVS51181.1|905161_905500_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVS51182.1|905548_907009_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
>prophage 65
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	914224	915478	4740838		Aeromonas_phage(100.0%)	1	NA	NA
AVS51187.1|914224_915478_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 66
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	922897	933042	4740838	tRNA	Heterosigma_akashiwo_virus(16.67%)	13	NA	NA
AVS51194.1|922897_923776_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	25.0	2.7e-15
AVS51195.1|923920_924724_-	inositol monophosphatase	NA	NA	NA	NA	NA
AVS51196.1|924842_925574_+|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVS51197.1|925733_926228_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AVS51198.1|926408_927623_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
AVS51199.1|927650_928037_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AVS51200.1|928065_928389_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AVS51201.1|928584_929100_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVS51202.1|929112_930963_+	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	38.8	1.8e-101
AVS51203.1|930964_931300_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVS51204.1|931311_931512_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVS51205.1|931498_931702_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51206.1|931758_933042_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 67
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	943841	949090	4740838		Escherichia_phage(66.67%)	5	NA	NA
AVS51214.1|943841_946247_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.4	2.5e-140
AVS51215.1|946243_946873_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	55.9	1.2e-62
AVS51216.1|946865_947675_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVS51217.1|947674_948538_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVS51218.1|948658_949090_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
>prophage 68
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	975406	984664	4740838		Escherichia_phage(33.33%)	3	NA	NA
AVS51231.1|975406_981526_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.0	3.8e-23
AVS51232.1|981687_983037_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.3e-40
AVS51233.1|983197_984664_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	2.0e-87
>prophage 69
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	987859	988051	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS51236.1|987859_988051_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 70
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	994513	1003104	4740838	protease	Prochlorococcus_phage(20.0%)	10	NA	NA
AVS51241.1|994513_995152_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	9.6e-31
AVS54756.1|995151_996189_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.5	3.8e-69
AVS51242.1|996224_996404_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51243.1|996601_997228_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS51244.1|997315_998605_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	6.6e-63
AVS51245.1|998675_999401_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AVS51246.1|999427_999787_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
AVS51247.1|999826_1001290_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AVS51248.1|1001497_1002565_+	AI-2E family transporter	NA	NA	NA	NA	NA
AVS51249.1|1002750_1003104_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	1.3e-13
>prophage 71
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1006442	1007156	4740838		Synechococcus_phage(100.0%)	1	NA	NA
AVS51254.1|1006442_1007156_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 72
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1025779	1026730	4740838		Cyanophage(100.0%)	1	NA	NA
AVS51268.1|1025779_1026730_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.3	4.8e-10
>prophage 73
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1047345	1056897	4740838		Paenibacillus_phage(20.0%)	11	NA	NA
AVS51291.1|1047345_1048215_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
AVS51292.1|1048316_1048853_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVS51293.1|1048839_1049289_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVS51294.1|1049350_1049926_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVS51295.1|1050020_1050920_+	iron-dependent peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AVS51296.1|1051157_1051949_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AVS51297.1|1052106_1053123_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS51298.1|1053122_1053956_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVS51299.1|1053955_1054831_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AVS51300.1|1054820_1055918_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	7.0e-29
AVS51301.1|1055985_1056897_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
>prophage 74
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1062222	1072072	4740838		Hokovirus(25.0%)	9	NA	NA
AVS51309.1|1062222_1063950_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
AVS51310.1|1063998_1064256_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVS51311.1|1064639_1065611_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
AVS51312.1|1065774_1066536_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVS51313.1|1066767_1067754_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVS51314.1|1067825_1069841_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.9	5.2e-147
AVS51315.1|1069842_1070061_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51316.1|1070057_1071056_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVS51317.1|1071145_1072072_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
>prophage 75
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1093466	1094387	4740838		Morganella_phage(100.0%)	1	NA	NA
AVS51337.1|1093466_1094387_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 76
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1103161	1104103	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS51345.1|1103161_1104103_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
>prophage 77
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1113283	1114369	4740838		Pandoravirus(100.0%)	1	NA	NA
AVS51354.1|1113283_1114369_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 78
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1121622	1122408	4740838		Campylobacter_virus(50.0%)	2	NA	NA
AVS51363.1|1121622_1121991_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
AVS51364.1|1122159_1122408_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	8.0e-18
>prophage 79
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1125414	1126551	4740838		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS51368.1|1125414_1126551_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 80
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1133053	1134571	4740838		Mollivirus(100.0%)	1	NA	NA
AVS51376.1|1133053_1134571_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 81
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1146008	1146782	4740838		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVS54759.1|1146008_1146782_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 82
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1150510	1151530	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS51392.1|1150510_1151530_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 83
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1162337	1165623	4740838		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVS51404.1|1162337_1163015_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
AVS51405.1|1163091_1164918_+	SLC13 family permease	NA	NA	NA	NA	NA
AVS51406.1|1165023_1165623_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 84
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1184475	1185480	4740838		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVS51424.1|1184475_1185480_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.0	3.5e-27
>prophage 85
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1198047	1203056	4740838		Tupanvirus(50.0%)	4	NA	NA
AVS51439.1|1198047_1200030_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.5	6.7e-22
AVS51440.1|1200026_1201010_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AVS51441.1|1201012_1202170_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	6.0e-31
AVS51442.1|1202450_1203056_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
>prophage 86
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1206703	1207909	4740838		Oenococcus_phage(100.0%)	1	NA	NA
AVS54761.1|1206703_1207909_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.1e-26
>prophage 87
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1217499	1224700	4740838		Pseudomonas_phage(50.0%)	6	NA	NA
AVS51455.1|1217499_1218570_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AVS51456.1|1218685_1219564_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS51457.1|1219725_1220916_+	MFS transporter	NA	NA	NA	NA	NA
AVS51458.1|1220917_1221172_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AVS51459.1|1221171_1222302_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AVS51460.1|1222414_1224700_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.1e-282
>prophage 88
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1228140	1235353	4740838		Oenococcus_phage(33.33%)	4	NA	NA
AVS51464.1|1228140_1229343_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	4.6e-58
AVS51465.1|1229442_1229673_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51466.1|1229752_1232389_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
AVS51467.1|1232506_1235353_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	26.4	7.1e-41
>prophage 89
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1239520	1245338	4740838		Enterobacteria_phage(33.33%)	5	NA	NA
AVS51471.1|1239520_1240657_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
AVS51472.1|1240771_1241824_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVS51473.1|1241904_1242966_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
AVS51474.1|1242968_1243619_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
AVS51475.1|1243694_1245338_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.6	7.5e-11
>prophage 90
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1252405	1253023	4740838		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS51484.1|1252405_1253023_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.8e-10
>prophage 91
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1261356	1276478	4740838	tail	Salmonella_phage(37.5%)	14	NA	NA
AVS51495.1|1261356_1262148_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	9.7e-49
AVS51496.1|1262231_1262594_+|tail	phage tail protein	tail	S4TUB9	Salmonella_phage	87.4	3.0e-53
AVS51497.1|1262817_1265184_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	89.4	4.9e-72
AVS51498.1|1265344_1265494_+	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	81.6	3.8e-15
AVS51499.1|1265953_1267714_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51500.1|1267745_1267973_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51501.1|1268152_1269160_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.0	2.2e-82
AVS51502.1|1269187_1269808_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51503.1|1269915_1270200_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVS51504.1|1270324_1272085_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AVS51505.1|1272236_1272932_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVS51506.1|1272959_1274150_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.2	5.4e-19
AVS51507.1|1274540_1274885_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51508.1|1274888_1276478_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
>prophage 92
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1282402	1282975	4740838		Clostridioides_phage(100.0%)	1	NA	NA
AVS51514.1|1282402_1282975_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 93
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1293111	1293969	4740838		Catovirus(100.0%)	1	NA	NA
AVS51527.1|1293111_1293969_-	endonuclease	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
>prophage 94
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1298085	1300077	4740838		Acinetobacter_phage(100.0%)	1	NA	NA
AVS51531.1|1298085_1300077_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 95
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1305516	1306185	4740838		Cellulophaga_phage(100.0%)	1	NA	NA
AVS51538.1|1305516_1306185_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 96
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1310144	1311665	4740838		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS51541.1|1310144_1311665_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 97
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1337719	1346890	4740838	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVS51568.1|1337719_1338667_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AVS51569.1|1338650_1339382_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS51570.1|1339362_1339470_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51571.1|1339529_1340261_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVS54766.1|1340483_1342169_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVS51572.1|1342165_1342885_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS51573.1|1342931_1343399_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVS51574.1|1343455_1343986_-	lipoprotein	NA	NA	NA	NA	NA
AVS51575.1|1344157_1344616_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVS51576.1|1344856_1346890_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 98
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1358085	1359090	4740838		Catopsilia_pomona_nucleopolyhedrovirus(100.0%)	1	NA	NA
AVS51588.1|1358085_1359090_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	22.1	8.4e-05
>prophage 99
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1364086	1366946	4740838		Salmonella_phage(50.0%)	2	NA	NA
AVS51594.1|1364086_1365133_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	76.4	2.4e-148
AVS54767.1|1365584_1366946_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 100
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1370956	1371313	4740838		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS51599.1|1370956_1371313_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.7	1.2e-14
>prophage 101
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1375563	1375770	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS54769.1|1375563_1375770_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	67.2	2.3e-18
>prophage 102
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1381777	1388389	4740838		Bacillus_phage(66.67%)	4	NA	NA
AVS51606.1|1381777_1382500_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
AVS51607.1|1382496_1383900_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	4.7e-30
AVS51608.1|1383899_1385312_-	MFS transporter	NA	NA	NA	NA	NA
AVS51609.1|1385308_1388389_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	23.2	1.4e-63
>prophage 103
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1398837	1408137	4740838		Catovirus(25.0%)	8	NA	NA
AVS51615.1|1398837_1399479_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
AVS51616.1|1399569_1400151_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AVS51617.1|1400189_1402046_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVS51618.1|1402131_1403712_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AVS51619.1|1404067_1404313_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51620.1|1404386_1405526_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVS51621.1|1405531_1405981_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVS51622.1|1405977_1408137_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
>prophage 104
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1413312	1419937	4740838		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
AVS51629.1|1413312_1414434_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
AVS51630.1|1414436_1415402_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.8	3.5e-85
AVS51631.1|1415404_1415878_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVS51632.1|1415874_1417098_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVS51633.1|1417094_1418537_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	9.4e-50
AVS51634.1|1418647_1419937_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.2	2.9e-26
>prophage 105
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1425494	1427969	4740838		Klebsiella_phage(50.0%)	2	NA	NA
AVS51639.1|1425494_1426898_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
AVS51640.1|1427075_1427969_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	3.1e-43
>prophage 106
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1432607	1440168	4740838		Hokovirus(25.0%)	5	NA	NA
AVS51645.1|1432607_1434026_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	1.3e-56
AVS51646.1|1434040_1435411_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	9.9e-33
AVS51647.1|1435696_1437223_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51648.1|1437359_1438766_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.5e-36
AVS51649.1|1439001_1440168_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.5	2.4e-112
>prophage 107
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1447610	1448510	4740838		Cellulophaga_phage(100.0%)	1	NA	NA
AVS51658.1|1447610_1448510_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	6.3e-12
>prophage 108
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1457197	1462124	4740838		Escherichia_phage(66.67%)	4	NA	NA
AVS51664.1|1457197_1459474_+	thiosulfate reductase	NA	A0A077SK27	Escherichia_phage	27.1	4.9e-37
AVS51665.1|1459488_1460067_+	thiosulfate reductase electron transporter PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
AVS51666.1|1460063_1460828_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVS51667.1|1460951_1462124_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	88.2	2.1e-201
>prophage 109
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1481831	1482626	4740838		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVS51692.1|1481831_1482626_+	aquaporin	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 110
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1496138	1496954	4740838		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVS51709.1|1496138_1496954_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	1.2e-09
>prophage 111
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1523941	1539127	4740838		Morganella_phage(20.0%)	18	NA	NA
AVS51726.1|1523941_1524415_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AVS51727.1|1525062_1525353_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
AVS51728.1|1525724_1526522_-	protein MtfA	NA	NA	NA	NA	NA
AVS51729.1|1526782_1527025_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51730.1|1527002_1527164_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51731.1|1527290_1527710_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVS51732.1|1527712_1528981_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.4	1.1e-227
AVS51733.1|1529435_1529648_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVS54776.1|1529658_1529847_+	cold-shock protein	NA	NA	NA	NA	NA
AVS51734.1|1530104_1531301_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
AVS51735.1|1531950_1532262_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51736.1|1532341_1533037_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AVS51737.1|1533110_1534541_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVS51738.1|1534521_1534992_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AVS51739.1|1534980_1535901_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVS51740.1|1536070_1536988_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVS51741.1|1537004_1537250_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVS51742.1|1537414_1539127_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 112
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1566817	1567570	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS51776.1|1566817_1567570_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.5	3.2e-25
>prophage 113
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1575829	1576495	4740838		Sphingomonas_phage(100.0%)	1	NA	NA
AVS51786.1|1575829_1576495_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 114
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1591642	1595777	4740838		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AVS51803.1|1591642_1593304_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	1.7e-10
AVS51804.1|1593457_1594324_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AVS51805.1|1594320_1595370_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVS51806.1|1595387_1595777_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 115
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1603729	1610289	4740838	tRNA	Tupanvirus(33.33%)	7	NA	NA
AVS51813.1|1603729_1605463_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	3.7e-85
AVS51814.1|1605699_1606269_+	VOC family protein	NA	NA	NA	NA	NA
AVS51815.1|1606288_1607035_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVS51816.1|1607270_1608242_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVS51817.1|1608238_1608982_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	4.1e-25
AVS51818.1|1609022_1609418_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51819.1|1609470_1610289_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	1.7e-56
>prophage 116
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1614301	1622288	4740838		Bacillus_virus(50.0%)	9	NA	NA
AVS51824.1|1614301_1614823_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVS51825.1|1614824_1615424_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54778.1|1615649_1616324_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51826.1|1616683_1617295_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVS51827.1|1617303_1618314_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
AVS51828.1|1618392_1619178_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVS51829.1|1619174_1619930_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.9	3.2e-17
AVS54779.1|1619993_1620953_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVS51830.1|1620968_1622288_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 117
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1626225	1627701	4740838		Cyanophage(100.0%)	1	NA	NA
AVS51836.1|1626225_1627701_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 118
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1635600	1710091	4740838	tail,head,terminase,integrase,protease,holin,transposase,lysis	Edwardsiella_phage(16.98%)	97	1672546:1672561	1692843:1692858
AVS51844.1|1635600_1636299_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AVS51845.1|1636322_1636979_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVS51846.1|1637086_1637317_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AVS51847.1|1637454_1637829_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVS51848.1|1637829_1638705_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51849.1|1638721_1639075_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVS54780.1|1639132_1639252_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51850.1|1639457_1640537_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
AVS51851.1|1640511_1640790_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
AVS54781.1|1640850_1641087_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51852.1|1641377_1641563_-	DUF1187 domain-containing protein	NA	NA	NA	NA	NA
AVS51853.1|1641609_1642440_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.3e-104
AVS51854.1|1642432_1645123_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	73.2	3.0e-118
AVS51855.1|1645263_1645599_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51856.1|1645674_1645881_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
AVS51857.1|1645884_1646160_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51858.1|1646508_1646775_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51859.1|1647190_1647616_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	1.2e-13
AVS51860.1|1647712_1647967_+	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
AVS51861.1|1647953_1648448_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51862.1|1648491_1649493_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	68.1	4.4e-123
AVS51863.1|1649485_1649947_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
AVS51864.1|1649961_1650357_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	38.1	1.7e-17
AVS51865.1|1650353_1650626_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51866.1|1650829_1650985_+	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
AVS51867.1|1651236_1651485_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51868.1|1651548_1652148_+	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	82.9	3.6e-96
AVS51869.1|1652144_1652372_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
AVS51870.1|1652501_1653191_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
AVS51871.1|1653287_1653812_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51872.1|1654185_1654635_-	lipoprotein	NA	NA	NA	NA	NA
AVS51873.1|1654995_1655682_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
AVS54782.1|1655957_1656287_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
AVS51874.1|1656270_1656723_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	3.0e-79
AVS54783.1|1656740_1657205_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.9	2.7e-59
AVS51875.1|1657430_1657613_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AVS51876.1|1657683_1658436_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.3	5.3e-12
AVS51877.1|1658401_1659823_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.4e-186
AVS51878.1|1659822_1661343_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	2.4e-104
AVS51879.1|1661383_1662073_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AVS51880.1|1662069_1663416_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.9	1.0e-69
AVS51881.1|1663417_1663900_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
AVS51882.1|1663899_1664928_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
AVS51883.1|1664931_1665279_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
AVS51884.1|1665285_1665741_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AVS51885.1|1665734_1666319_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.1	2.1e-16
AVS51886.1|1666315_1666681_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.3e-21
AVS51887.1|1666665_1667211_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51888.1|1667191_1668676_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.4	7.6e-95
AVS51889.1|1668676_1669123_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AVS51890.1|1669122_1669527_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AVS51891.1|1669568_1669751_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AVS51892.1|1669734_1671906_+	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AVS51893.1|1671902_1672613_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	8.5e-28
1672546:1672561	attL	TTACGGCGTCGGTGAC	NA	NA	NA	NA
AVS51894.1|1672612_1672915_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AVS51895.1|1672911_1673781_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AVS51896.1|1673761_1674439_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
AVS51897.1|1674451_1674808_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
AVS51898.1|1674804_1676046_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	5.3e-102
AVS51899.1|1676047_1676650_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
AVS51900.1|1676639_1678094_+	short-chain dehydrogenase	NA	E5G6P0	Salmonella_phage	68.2	1.5e-39
AVS51901.1|1678093_1678669_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
AVS51902.1|1678864_1679587_-	guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AVS51903.1|1680066_1680867_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51904.1|1681820_1682900_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	8.2e-99
AVS51905.1|1684033_1684321_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	92.7	1.4e-37
AVS51906.1|1684317_1684851_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	3.2e-11
AVS51907.1|1685107_1685275_-	lytic enzyme	NA	NA	NA	NA	NA
AVS51908.1|1685339_1685528_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51909.1|1686977_1687178_-	phage virulence factor	NA	NA	NA	NA	NA
AVS51910.1|1687368_1687485_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVS51911.1|1687747_1687873_+	arsenic transporter	NA	NA	NA	NA	NA
AVS51912.1|1688001_1688268_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51913.1|1689020_1689635_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVS51914.1|1689644_1689803_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51915.1|1689935_1690850_-	protein PagO	NA	NA	NA	NA	NA
AVS54784.1|1691467_1691668_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51916.1|1691933_1692302_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	1.2e-17
AVS51917.1|1692425_1693634_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	1.0e-44
1692843:1692858	attR	GTCACCGACGCCGTAA	NA	NA	NA	NA
AVS51918.1|1693779_1693920_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51919.1|1694085_1694355_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	6.9e-07
AVS51920.1|1694401_1694596_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51921.1|1694725_1695145_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS51922.1|1695532_1696009_-	hypothetical protein	NA	NA	NA	NA	NA
AVS51923.1|1696337_1696733_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	5.4e-16
AVS51924.1|1697416_1698139_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVS51925.1|1698423_1698588_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51926.1|1698811_1699462_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
AVS51927.1|1699480_1699672_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVS51928.1|1699782_1700022_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
AVS54785.1|1700136_1701576_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AVS51929.1|1701653_1704293_-	MCE family protein	NA	NA	NA	NA	NA
AVS51930.1|1704255_1705539_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVS51931.1|1705580_1706165_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AVS51932.1|1706262_1706949_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AVS51933.1|1706968_1709017_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVS51934.1|1709209_1710091_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 119
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1714393	1714603	4740838		Morganella_phage(100.0%)	1	NA	NA
AVS51941.1|1714393_1714603_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 120
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1722090	1723650	4740838		Moraxella_phage(100.0%)	1	NA	NA
AVS51950.1|1722090_1723650_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 121
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1727620	1734933	4740838	tRNA	Pandoravirus(33.33%)	8	NA	NA
AVS51954.1|1727620_1728985_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	2.5e-44
AVS51955.1|1729065_1729245_+	YoaH family protein	NA	NA	NA	NA	NA
AVS51956.1|1729250_1729595_-	RidA family protein	NA	NA	NA	NA	NA
AVS51957.1|1729726_1731637_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AVS51958.1|1731694_1732390_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVS51959.1|1732461_1733043_+	hypothetical protein	NA	NA	NA	NA	NA
AVS51960.1|1733021_1733228_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54786.1|1733247_1734933_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 122
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1769637	1772395	4740838		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS51996.1|1769637_1771323_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	2.3e-23
AVS54788.1|1771447_1772395_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 123
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1775742	1781400	4740838		Pseudomonas_phage(33.33%)	7	NA	NA
AVS52000.1|1775742_1776825_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
AVS52001.1|1776824_1777658_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS52002.1|1777654_1778044_+	protein sirB2	NA	NA	NA	NA	NA
AVS52003.1|1778047_1778857_+	protein sirB1	NA	NA	NA	NA	NA
AVS52004.1|1778894_1779749_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AVS52005.1|1779802_1780903_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVS54789.1|1781169_1781400_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
>prophage 124
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1791739	1793275	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS52012.1|1791739_1793275_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 125
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1797418	1803828	4740838		Synechococcus_phage(33.33%)	7	NA	NA
AVS52017.1|1797418_1798261_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
AVS52018.1|1798311_1798770_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52019.1|1798880_1799786_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AVS52020.1|1799876_1800890_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVS52021.1|1801092_1802001_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AVS52022.1|1802134_1802548_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVS52023.1|1803210_1803828_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 126
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1812199	1815092	4740838		Planktothrix_phage(33.33%)	3	NA	NA
AVS52029.1|1812199_1813207_+	oligopeptide transport ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.3	1.3e-13
AVS52030.1|1813203_1814208_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AVS52031.1|1814255_1815092_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 127
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1826755	1829713	4740838		Acinetobacter_phage(100.0%)	2	NA	NA
AVS52046.1|1826755_1828114_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
AVS52047.1|1828117_1829713_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
>prophage 128
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1834694	1840033	4740838	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AVS52053.1|1834694_1835456_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
AVS52054.1|1835693_1836740_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AVS52055.1|1836781_1837033_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52056.1|1837435_1840033_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.3	2.0e-87
>prophage 129
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1845126	1845717	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS52061.1|1845126_1845717_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 130
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1851301	1855480	4740838		Bacillus_virus(50.0%)	3	NA	NA
AVS54793.1|1851301_1853284_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.1	1.3e-17
AVS52071.1|1853298_1853520_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52072.1|1853545_1855480_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	1.5e-05
>prophage 131
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1860857	1861664	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS52079.1|1860857_1861664_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 132
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1880153	1881023	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS52098.1|1880153_1881023_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.9e-51
>prophage 133
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1884575	1885433	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS52103.1|1884575_1885433_-	hypothetical protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 134
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1895643	1903691	4740838	tRNA	Streptococcus_phage(20.0%)	11	NA	NA
AVS52115.1|1895643_1896159_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.7e-22
AVS52116.1|1896416_1896980_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AVS52117.1|1896960_1897140_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52118.1|1897390_1898545_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
AVS52119.1|1898690_1899674_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS52120.1|1899949_1900132_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52121.1|1900160_1901534_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
AVS52122.1|1901577_1902513_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AVS52123.1|1902723_1902876_+	multidrug transporter	NA	NA	NA	NA	NA
AVS52124.1|1902868_1903207_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVS52125.1|1903256_1903691_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 135
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1908803	1909793	4740838		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS52130.1|1908803_1909793_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.6e-69
>prophage 136
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1914585	1919999	4740838		Klosneuvirus(50.0%)	3	NA	NA
AVS54796.1|1914585_1918488_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	4.2e-52
AVS52136.1|1918551_1919352_+	YdcF family protein	NA	NA	NA	NA	NA
AVS52137.1|1919468_1919999_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	5.4e-19
>prophage 137
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1923759	1924491	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS52141.1|1923759_1924491_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 138
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1931030	1938120	4740838		Synechococcus_phage(33.33%)	6	NA	NA
AVS52148.1|1931030_1932149_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	7.6e-31
AVS52149.1|1932103_1932319_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52150.1|1932317_1933943_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
AVS52151.1|1934003_1934927_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS52152.1|1935219_1936563_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AVS52153.1|1936611_1938120_+	carboxylesterase/lipase family protein	NA	G5CSV8	Megavirus	38.2	1.6e-31
>prophage 139
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1954222	1956187	4740838		Phage_TP(100.0%)	1	NA	NA
AVS52171.1|1954222_1956187_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	1.1e-21
>prophage 140
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1973792	1975913	4740838		Salmonella_phage(100.0%)	1	NA	NA
AVS52188.1|1973792_1975913_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	2.4e-134
>prophage 141
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1983852	1985397	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS52198.1|1983852_1985397_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 142
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	1993559	1994642	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS52203.1|1993559_1994642_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	72.4	5.1e-141
>prophage 143
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2001010	2002021	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS52210.1|2001010_2002021_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 144
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2023007	2023292	4740838		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS52230.1|2023007_2023292_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	8.9e-21
>prophage 145
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2042313	2043432	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS52249.1|2042313_2043432_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 146
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2052318	2052753	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS52259.1|2052318_2052753_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 147
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2062038	2081320	4740838		Escherichia_phage(40.0%)	19	NA	NA
AVS52271.1|2062038_2062242_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AVS52272.1|2062308_2063775_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	2.5e-42
AVS52273.1|2063918_2065298_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	5.7e-28
AVS52274.1|2065351_2066371_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS52275.1|2066381_2067596_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	5.3e-46
AVS52276.1|2067717_2068044_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
AVS52277.1|2068195_2068537_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVS52278.1|2068572_2069133_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVS52279.1|2069173_2069884_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVS52280.1|2069987_2070296_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVS52281.1|2070452_2072891_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
AVS52282.1|2072989_2075425_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	1.3e-205
AVS52283.1|2075435_2076053_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AVS52284.1|2076054_2076912_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVS52285.1|2076954_2077569_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.8	1.1e-28
AVS52286.1|2077873_2078584_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
AVS52287.1|2078612_2079515_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AVS52288.1|2079524_2080172_+	osmoprotectant import permease OsmW	NA	NA	NA	NA	NA
AVS52289.1|2080171_2081320_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 148
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2099034	2103472	4740838		Enterobacteria_phage(50.0%)	3	NA	NA
AVS52308.1|2099034_2100201_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.9	4.2e-117
AVS52309.1|2100353_2102060_+	amidohydrolase	NA	NA	NA	NA	NA
AVS52310.1|2102170_2103472_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	4.4e-14
>prophage 149
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2125116	2126391	4740838	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVS52330.1|2125116_2126391_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 150
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2133307	2133829	4740838		Salmonella_phage(100.0%)	1	NA	NA
AVS52339.1|2133307_2133829_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	59.8	8.9e-51
>prophage 151
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2138904	2146328	4740838		Streptococcus_phage(20.0%)	8	NA	NA
AVS52347.1|2138904_2139759_+	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
AVS52348.1|2139885_2140467_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	4.0e-44
AVS52349.1|2140549_2140639_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVS52350.1|2140934_2141960_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AVS52351.1|2141956_2142889_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS52352.1|2143001_2144207_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVS52353.1|2144496_2145645_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
AVS52354.1|2145686_2146328_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 152
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2170281	2174620	4740838		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
AVS52385.1|2170281_2173044_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.3	7.9e-29
AVS52386.1|2173074_2173713_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS52387.1|2173891_2174620_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
>prophage 153
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2192821	2196031	4740838		environmental_halophage(50.0%)	3	NA	NA
AVS52405.1|2192821_2194042_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
AVS52406.1|2194038_2195310_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVS52407.1|2195284_2196031_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
>prophage 154
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2218543	2277991	4740838	tail,head,terminase,protease,holin,tRNA,capsid,lysis,portal	Salmonella_phage(45.45%)	79	NA	NA
AVS52427.1|2218543_2220184_+	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
AVS52428.1|2220225_2222604_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
AVS52429.1|2222940_2223774_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVS52430.1|2223929_2224976_+	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
AVS52431.1|2225132_2225324_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVS52432.1|2225359_2226802_-	YdiU family protein	NA	NA	NA	NA	NA
AVS52433.1|2226863_2227577_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AVS52434.1|2227890_2228355_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AVS52435.1|2228431_2229181_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	3.5e-08
AVS52436.1|2229180_2229732_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVS52437.1|2229823_2230804_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVS52438.1|2231006_2231306_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVS52439.1|2231310_2233698_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVS52440.1|2233713_2234697_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVS54807.1|2234833_2234878_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVS52441.1|2234998_2235355_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVS52442.1|2235405_2235603_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVS52443.1|2235698_2236241_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AVS52444.1|2236244_2238173_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	7.2e-130
AVS52445.1|2238504_2239773_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	96.9	2.1e-239
AVS52446.1|2239775_2240195_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	59.8	3.8e-36
AVS52447.1|2240431_2241730_-|tail	phage tail protein	tail	I6R0Q9	Salmonella_phage	99.3	5.9e-245
AVS52448.1|2241740_2242700_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.1	9.0e-182
AVS52449.1|2242708_2245420_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	95.9	0.0e+00
AVS52450.1|2245419_2245818_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
AVS52451.1|2245824_2246409_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.9	1.1e-105
AVS52452.1|2246408_2247002_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
AVS52453.1|2247164_2247419_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52454.1|2247789_2251104_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	95.3	0.0e+00
AVS52455.1|2251150_2251486_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
AVS54808.1|2251542_2251821_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
AVS52456.1|2251844_2252216_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
AVS52457.1|2252243_2252948_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AVS52458.1|2253004_2253352_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
AVS52459.1|2253348_2253798_-	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AVS52460.1|2253794_2254133_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AVS52461.1|2254142_2254469_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AVS52462.1|2254468_2254657_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	60.6	2.6e-13
AVS52463.1|2254700_2255918_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
AVS52464.1|2255927_2256776_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	3.4e-132
AVS52465.1|2256789_2258097_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.5	6.4e-215
AVS52466.1|2258096_2259839_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.7e-142
AVS52467.1|2259792_2260257_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AVS52468.1|2260389_2260734_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AVS52469.1|2260852_2261323_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	84.1	1.5e-60
AVS52470.1|2261319_2261757_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	4.1e-73
AVS52471.1|2261740_2262067_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
AVS52472.1|2262491_2263265_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.2	2.6e-131
AVS52473.1|2263261_2263441_-	hypothetical protein	NA	A0A0M4QWY9	Salmonella_phage	94.9	5.1e-22
AVS52474.1|2263421_2263625_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AVS52475.1|2263621_2263846_-	protein ninY	NA	I6R0N9	Salmonella_phage	97.3	2.0e-36
AVS52476.1|2263842_2264499_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.4	3.4e-39
AVS52477.1|2264495_2264891_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	97.7	2.2e-70
AVS52478.1|2264887_2265184_-	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	100.0	2.0e-47
AVS52479.1|2265146_2265323_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	93.1	2.5e-26
AVS52480.1|2265319_2265502_-	NinE family protein	NA	Q716C5	Shigella_phage	96.7	1.8e-27
AVS52481.1|2265468_2265642_-	protein ninD	NA	C6ZR56	Salmonella_phage	91.2	7.8e-28
AVS52482.1|2265638_2266511_-	hypothetical protein	NA	I6R0S6	Salmonella_phage	93.4	6.1e-169
AVS52483.1|2266507_2266966_-	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	95.9	2.9e-77
AVS52484.1|2267024_2268476_-	helicase DnaB	NA	Q7Y2K5	Escherichia_phage	98.6	1.8e-274
AVS52485.1|2268450_2269350_-	DNA replication protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
AVS52486.1|2269342_2269489_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AVS52487.1|2269523_2269802_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
AVS52488.1|2269908_2270094_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AVS52489.1|2270174_2270825_+	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
AVS52490.1|2271163_2271499_+	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.7e-47
AVS54809.1|2271721_2271907_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52491.1|2271838_2272033_+	restriction endonuclease	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
AVS52492.1|2272116_2272806_+	pentapeptide repeat-containing protein	NA	I6S1T3	Salmonella_phage	75.3	2.0e-34
AVS52493.1|2272805_2273036_+	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	48.1	1.7e-09
AVS54810.1|2273226_2273400_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
AVS52494.1|2273380_2273569_+	protein kil	NA	A0A1R3Y5S5	Salmonella_virus	98.4	4.8e-31
AVS52495.1|2273698_2274316_+	recombinase	NA	I6RSN3	Salmonella_phage	94.6	1.2e-102
AVS52496.1|2274315_2274699_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	94.5	1.4e-64
AVS52497.1|2274722_2275016_+	RecBCD nuclease inhibitor	NA	A0A192Y654	Salmonella_phage	95.9	5.2e-48
AVS52498.1|2275026_2275197_+	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
AVS52499.1|2275413_2275764_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52500.1|2276588_2276834_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	56.7	9.1e-14
AVS52501.1|2276779_2277991_-	DUF4102 domain-containing protein	NA	I6R9B6	Salmonella_phage	99.5	1.6e-236
>prophage 155
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2288419	2290672	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS52514.1|2288419_2290672_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.8	1.7e-143
>prophage 156
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2296839	2297667	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS52522.1|2296839_2297667_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 157
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2304365	2305592	4740838		Klosneuvirus(100.0%)	1	NA	NA
AVS52530.1|2304365_2305592_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.1	1.2e-26
>prophage 158
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2309179	2311129	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS52536.1|2309179_2311129_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 159
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2316014	2316671	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS52541.1|2316014_2316671_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
>prophage 160
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2326079	2329525	4740838		Bacillus_phage(100.0%)	3	NA	NA
AVS52550.1|2326079_2327366_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	35.5	2.9e-10
AVS54812.1|2327518_2327734_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52551.1|2328031_2329525_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 161
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2344474	2345272	4740838		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS52577.1|2344474_2345272_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
>prophage 162
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2349820	2350351	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS52582.1|2349820_2350351_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 163
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2354976	2358319	4740838		Enterobacterial_phage(50.0%)	5	NA	NA
AVS52588.1|2354976_2355534_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
AVS52589.1|2356345_2356609_+	virulence protein PagD	NA	NA	NA	NA	NA
AVS52590.1|2356740_2356953_+	cold-shock protein CspH	NA	NA	NA	NA	NA
AVS52591.1|2357367_2357889_+	lipoprotein	NA	NA	NA	NA	NA
AVS52592.1|2358079_2358319_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	1.9e-32
>prophage 164
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2362224	2363475	4740838		Phage_21(100.0%)	1	NA	NA
AVS52597.1|2362224_2363475_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 165
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2367002	2368373	4740838		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS52602.1|2367002_2368373_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 166
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2374693	2376677	4740838		Bacillus_virus(50.0%)	2	NA	NA
AVS52608.1|2374693_2375830_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AVS52609.1|2375813_2376677_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 167
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2380263	2383989	4740838		Vibrio_phage(50.0%)	4	NA	NA
AVS52613.1|2380263_2381085_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AVS52614.1|2381103_2382015_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVS52615.1|2382043_2383288_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVS52616.1|2383287_2383989_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 168
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2390174	2390432	4740838		Erwinia_phage(100.0%)	1	NA	NA
AVS52620.1|2390174_2390432_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	7.3e-06
>prophage 169
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2403594	2404236	4740838		Pseudomonas_phage(100.0%)	1	NA	NA
AVS52633.1|2403594_2404236_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	4.2e-26
>prophage 170
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2407510	2408637	4740838		Ralstonia_phage(50.0%)	2	NA	NA
AVS52637.1|2407510_2407747_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVS52638.1|2407902_2408637_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 171
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2422456	2423407	4740838		Brevibacillus_phage(100.0%)	1	NA	NA
AVS52652.1|2422456_2423407_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 172
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2439418	2439664	4740838		Salmonella_phage(100.0%)	1	NA	NA
AVS52672.1|2439418_2439664_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 173
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2444323	2445244	4740838		Morganella_phage(100.0%)	1	NA	NA
AVS52680.1|2444323_2445244_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	8.1e-55
>prophage 174
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2454306	2454846	4740838		Scale_drop_disease_virus(100.0%)	1	NA	NA
AVS52687.1|2454306_2454846_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 175
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2458997	2459831	4740838		Pelagibacter_phage(100.0%)	1	NA	NA
AVS52696.1|2458997_2459831_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 176
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2469724	2473348	4740838		Aeromonas_phage(33.33%)	3	NA	NA
AVS52707.1|2469724_2471221_+	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
AVS52708.1|2471506_2472388_+	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
AVS52709.1|2472493_2473348_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 177
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2481292	2481460	4740838		Enterobacteria_phage(100.0%)	1	NA	NA
AVS52716.1|2481292_2481460_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 178
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2487745	2489987	4740838		Klosneuvirus(50.0%)	4	NA	NA
AVS52724.1|2487745_2488666_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
AVS52725.1|2488665_2488971_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVS52726.1|2489021_2489177_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52727.1|2489624_2489987_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
>prophage 179
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2503283	2504030	4740838		Bacillus_phage(100.0%)	1	NA	NA
AVS52742.1|2503283_2504030_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.4e-33
>prophage 180
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2511439	2513397	4740838	protease	Phage_Gifsy-2(50.0%)	2	NA	NA
AVS52750.1|2511439_2512120_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
AVS52751.1|2512737_2513397_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.1e-44
>prophage 181
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2519176	2521231	4740838		Bacillus_phage(100.0%)	1	NA	NA
AVS52761.1|2519176_2521231_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
>prophage 182
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2533752	2535660	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS52774.1|2533752_2535660_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.0	8.3e-54
>prophage 183
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2540911	2543524	4740838		Acinetobacter_phage(100.0%)	1	NA	NA
AVS52779.1|2540911_2543524_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	8.2e-20
>prophage 184
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2548945	2625138	4740838	tRNA,transposase,integrase,protease	Bacillus_phage(16.67%)	64	2559612:2559628	2626305:2626321
AVS52785.1|2548945_2550346_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AVS52786.1|2550951_2552043_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AVS52787.1|2552227_2553418_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVS52788.1|2553479_2554127_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVS52789.1|2554154_2554703_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
AVS52790.1|2554962_2556810_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AVS52791.1|2557154_2561621_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2559612:2559628	attL	TTCCGCGCCGCCCGGCT	NA	NA	NA	NA
AVS52792.1|2561620_2562325_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
AVS52793.1|2562305_2563628_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AVS52794.1|2563620_2564424_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AVS52795.1|2564559_2565336_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AVS52796.1|2565315_2566209_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52797.1|2566419_2567166_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AVS52798.1|2567162_2567345_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52799.1|2567396_2568629_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVS52800.1|2568672_2569650_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AVS52801.1|2569646_2571395_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
AVS52802.1|2571431_2573696_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	5.1e-10
AVS52803.1|2573872_2575128_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AVS52804.1|2575164_2575371_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52805.1|2575652_2576330_-	hydrolase	NA	NA	NA	NA	NA
AVS52806.1|2576349_2577210_-	pirin family protein	NA	NA	NA	NA	NA
AVS52807.1|2577318_2578230_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS52808.1|2578320_2578539_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVS52809.1|2578466_2578850_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52810.1|2578850_2579555_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVS52811.1|2579599_2581321_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
AVS52812.1|2581321_2583088_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	4.1e-23
AVS52813.1|2583201_2584170_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AVS54819.1|2584512_2584788_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52814.1|2584716_2585211_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVS54820.1|2585345_2589404_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AVS52815.1|2589546_2590158_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVS52816.1|2590167_2591511_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AVS54821.1|2591507_2591726_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52817.1|2591769_2593062_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AVS52818.1|2593298_2595743_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AVS52819.1|2595753_2596371_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AVS52820.1|2596372_2597236_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVS52821.1|2597585_2598734_+	MFS transporter	NA	NA	NA	NA	NA
AVS52822.1|2598951_2600373_+	amino acid permease	NA	NA	NA	NA	NA
AVS52823.1|2600665_2601490_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
AVS52824.1|2601581_2601908_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVS52825.1|2602038_2602998_+	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
AVS52826.1|2603073_2605356_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AVS52827.1|2605415_2606273_-	formate transporter FocA	NA	NA	NA	NA	NA
AVS54822.1|2606677_2608438_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AVS52828.1|2608574_2609267_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AVS52829.1|2609452_2610541_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.0	4.7e-78
AVS52830.1|2610611_2611895_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AVS52831.1|2612037_2612799_+|protease	metalloprotease	protease	NA	NA	NA	NA
AVS52832.1|2612971_2613655_+	cytidylate kinase	NA	NA	NA	NA	NA
AVS52833.1|2613768_2615442_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AVS52834.1|2615597_2615882_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
AVS52835.1|2615994_2617249_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
AVS54823.1|2617509_2617719_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52836.1|2617825_2618203_+|integrase	integrase	integrase	NA	NA	NA	NA
AVS52837.1|2618364_2618562_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52838.1|2618774_2621051_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVS52839.1|2621081_2621402_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVS52840.1|2621725_2621947_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVS52841.1|2621901_2622096_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52842.1|2622076_2624023_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
AVS52843.1|2624019_2625138_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2626305:2626321	attR	TTCCGCGCCGCCCGGCT	NA	NA	NA	NA
>prophage 185
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2631923	2633642	4740838		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVS52849.1|2631923_2633642_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	2.2e-29
>prophage 186
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2637231	2639983	4740838		Roseobacter_phage(50.0%)	4	NA	NA
AVS52853.1|2637231_2638062_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.3e-08
AVS52854.1|2638058_2638382_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52855.1|2638509_2639025_+	lipoprotein	NA	NA	NA	NA	NA
AVS52856.1|2639254_2639983_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
>prophage 187
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2646772	2655941	4740838		Streptococcus_phage(25.0%)	11	NA	NA
AVS52864.1|2646772_2647903_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.4	8.2e-25
AVS52865.1|2647945_2648419_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVS52866.1|2648492_2649338_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVS52867.1|2649334_2650288_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVS52868.1|2650297_2651431_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
AVS52869.1|2651518_2652631_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVS52870.1|2652979_2653456_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVS52871.1|2653551_2654454_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AVS52872.1|2654511_2655234_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS52873.1|2655217_2655508_-	hypothetical protein	NA	NA	NA	NA	NA
AVS52874.1|2655677_2655941_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 188
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2663512	2665518	4740838		Escherichia_phage(50.0%)	2	NA	NA
AVS52881.1|2663512_2664271_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
AVS52882.1|2664315_2665518_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
>prophage 189
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2681014	2682886	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS52897.1|2681014_2682886_-	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 190
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2687207	2693761	4740838		Citrobacter_phage(50.0%)	4	NA	NA
AVS52902.1|2687207_2689640_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
AVS52903.1|2689707_2690517_-	HAD family hydrolase	NA	NA	NA	NA	NA
AVS52904.1|2690778_2692044_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVS52905.1|2692165_2693761_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.7e-58
>prophage 191
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2698747	2704057	4740838	protease	Enterobacteria_phage(33.33%)	6	NA	NA
AVS52911.1|2698747_2699263_-|protease	outer membrane protease	protease	A5LH44	Enterobacteria_phage	34.2	1.1e-16
AVS52912.1|2699616_2700504_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVS52913.1|2700806_2701310_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AVS52914.1|2701786_2702533_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVS52915.1|2702678_2703338_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVS52916.1|2703334_2704057_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
>prophage 192
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2707525	2716838	4740838		Acinetobacter_phage(25.0%)	8	NA	NA
AVS52919.1|2707525_2707792_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
AVS52920.1|2708076_2708337_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS52921.1|2708492_2709467_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVS52922.1|2709496_2711641_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
AVS52923.1|2711848_2713210_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
AVS52924.1|2713439_2714114_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS52925.1|2714113_2715109_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVS52926.1|2715101_2716838_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 193
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2728554	2731822	4740838		Streptococcus_phage(50.0%)	2	NA	NA
AVS52943.1|2728554_2729463_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
AVS52944.1|2729557_2731822_-	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	2.4e-15
>prophage 194
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2738682	2742111	4740838		Klosneuvirus(50.0%)	3	NA	NA
AVS52952.1|2738682_2739972_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	7.7e-19
AVS52953.1|2740029_2740506_+	kinase inhibitor	NA	NA	NA	NA	NA
AVS52954.1|2740590_2742111_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.2e-81
>prophage 195
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2750568	2758186	4740838		Planktothrix_phage(33.33%)	8	NA	NA
AVS52961.1|2750568_2751627_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
AVS52962.1|2751629_2752319_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVS52963.1|2752318_2753092_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS54827.1|2753258_2753408_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVS52964.1|2753536_2754325_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVS52965.1|2754392_2755868_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AVS52966.1|2756038_2756947_+	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AVS52967.1|2757169_2758186_+	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
>prophage 196
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2762494	2763271	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS52973.1|2762494_2763271_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 197
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2768946	2770194	4740838		Oenococcus_phage(100.0%)	1	NA	NA
AVS54828.1|2768946_2770194_-	cation transporter	NA	Q6A201	Oenococcus_phage	26.1	4.5e-32
>prophage 198
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2773940	2777464	4740838		Edwardsiella_phage(33.33%)	4	NA	NA
AVS52983.1|2773940_2774993_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
AVS52984.1|2775312_2775699_+	hypothetical protein	NA	NA	NA	NA	NA
AVS52985.1|2775809_2776748_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.0e-25
AVS52986.1|2776744_2777464_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.8	1.7e-23
>prophage 199
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2803664	2804456	4740838		Kaumoebavirus(100.0%)	1	NA	NA
AVS53006.1|2803664_2804456_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 200
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2807971	2815404	4740838		Acinetobacter_phage(33.33%)	6	NA	NA
AVS53012.1|2807971_2809453_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.7	8.5e-46
AVS53013.1|2809491_2810913_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	2.7e-57
AVS53014.1|2811023_2811230_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVS53015.1|2811566_2811656_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVS53016.1|2811655_2813335_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AVS53017.1|2813355_2815404_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.4e-27
>prophage 201
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2818674	2819352	4740838		Bacillus_phage(100.0%)	1	NA	NA
AVS53019.1|2818674_2819352_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	3.4e-26
>prophage 202
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2830435	2840439	4740838	tRNA	Lactobacillus_phage(25.0%)	8	NA	NA
AVS53030.1|2830435_2831839_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	7.8e-09
AVS53031.1|2831825_2832965_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AVS53032.1|2833015_2834320_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AVS53033.1|2834368_2834701_-	lipoprotein	NA	NA	NA	NA	NA
AVS53034.1|2834750_2836157_-	chitoporin	NA	NA	NA	NA	NA
AVS53035.1|2836284_2836470_-	hypothetical protein	NA	NA	NA	NA	NA
AVS53036.1|2836608_2838276_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
AVS53037.1|2838486_2840439_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
>prophage 203
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2845093	2846758	4740838		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS53042.1|2845093_2846758_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
>prophage 204
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2851374	2852460	4740838		Pseudomonas_phage(100.0%)	1	NA	NA
AVS53046.1|2851374_2852460_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 205
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2858360	2863163	4740838		Planktothrix_phage(50.0%)	4	NA	NA
AVS53052.1|2858360_2859086_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
AVS53053.1|2859202_2860138_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVS53054.1|2860169_2861408_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53055.1|2861483_2863163_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	35.9	2.3e-76
>prophage 206
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2873988	2876571	4740838	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVS53065.1|2873988_2876571_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.6e-185
>prophage 207
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2884798	2887283	4740838		Synechococcus_phage(50.0%)	2	NA	NA
AVS53074.1|2884798_2885932_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
AVS53075.1|2886071_2887283_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
>prophage 208
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2892116	2892766	4740838		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS53082.1|2892116_2892500_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
AVS53083.1|2892556_2892766_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 209
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2907868	2914416	4740838		Morganella_phage(33.33%)	6	NA	NA
AVS53097.1|2907868_2908297_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
AVS53098.1|2908364_2909132_-	hydrogenase	NA	NA	NA	NA	NA
AVS53099.1|2909131_2909689_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVS53100.1|2909685_2911965_-	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.5	4.5e-46
AVS53101.1|2911957_2912518_-	molecular chaperone	NA	NA	NA	NA	NA
AVS53102.1|2912850_2914416_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 210
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2917792	2919618	4740838		Streptococcus_phage(50.0%)	2	NA	NA
AVS53106.1|2917792_2919028_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
AVS53107.1|2919000_2919618_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
>prophage 211
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2934090	2940207	4740838		Klosneuvirus(50.0%)	3	NA	NA
AVS53121.1|2934090_2934885_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
AVS53122.1|2934936_2936073_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVS53123.1|2936322_2940207_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.8	3.2e-60
>prophage 212
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2956416	2961635	4740838		Salmonella_phage(66.67%)	7	NA	NA
AVS53142.1|2956416_2957742_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
AVS53143.1|2957957_2958812_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS53144.1|2958862_2959042_-	cation transporter	NA	NA	NA	NA	NA
AVS53145.1|2959150_2959480_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
AVS53146.1|2959679_2959925_+	copper-binding protein	NA	NA	NA	NA	NA
AVS53147.1|2960349_2960712_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AVS53148.1|2960708_2961635_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	94.1	6.9e-163
>prophage 213
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2965989	2968986	4740838	integrase	Salmonella_phage(100.0%)	4	2958300:2958317	2974331:2974348
2958300:2958317	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
AVS53151.1|2965989_2966916_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	93.4	5.3e-163
AVS53152.1|2966912_2967275_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AVS53153.1|2968012_2968288_+	hypothetical protein	NA	NA	NA	NA	NA
AVS54839.1|2968797_2968986_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	76.2	1.1e-11
2974331:2974348	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
>prophage 214
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2979014	2983448	4740838	tRNA	Enterococcus_phage(50.0%)	6	NA	NA
AVS53165.1|2979014_2979881_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
AVS53166.1|2979882_2980095_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVS53167.1|2980222_2980768_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVS53168.1|2980760_2981198_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53169.1|2981194_2982019_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AVS53170.1|2982062_2983448_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 215
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	2994720	2995869	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS53182.1|2994720_2995869_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 216
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3003319	3005101	4740838		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS53189.1|3003319_3005101_-	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.0	5.4e-39
>prophage 217
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3009572	3010589	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS53195.1|3009572_3010589_-	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 218
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3015442	3016129	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS53199.1|3015442_3016129_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
>prophage 219
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3019404	3024623	4740838		Bacillus_virus(50.0%)	5	NA	NA
AVS53203.1|3019404_3020082_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.9e-22
AVS53204.1|3020228_3021146_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVS53205.1|3021142_3021595_+	NfeD family protein	NA	NA	NA	NA	NA
AVS53206.1|3021595_3022012_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AVS53207.1|3022121_3024623_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	37.2	6.7e-112
>prophage 220
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3033723	3044813	4740838	transposase	Acanthamoeba_polyphaga_moumouvirus(20.0%)	15	NA	NA
AVS53214.1|3033723_3034695_+	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
AVS53215.1|3034691_3035654_-	ferrochelatase	NA	NA	NA	NA	NA
AVS53216.1|3035663_3035870_-	hypothetical protein	NA	NA	NA	NA	NA
AVS53217.1|3035882_3036527_-	adenylate kinase	NA	NA	NA	NA	NA
AVS54843.1|3036443_3036665_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53218.1|3036942_3038817_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
AVS53219.1|3038927_3039533_-	recombination protein RecR	NA	NA	NA	NA	NA
AVS53220.1|3039532_3039862_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVS53221.1|3039907_3041836_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AVS53222.1|3041949_3042501_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
AVS53223.1|3042568_3042676_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS53224.1|3042653_3043031_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AVS53225.1|3043111_3043627_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AVS53226.1|3043640_3043808_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AVS53227.1|3043877_3044813_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.2e-63
>prophage 221
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3062432	3065979	4740838		Bacillus_phage(100.0%)	2	NA	NA
AVS53244.1|3062432_3064214_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
AVS53245.1|3064206_3065979_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	4.7e-51
>prophage 222
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3070379	3071075	4740838		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS53250.1|3070379_3071075_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 223
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3074368	3079536	4740838	protease	Bacillus_phage(25.0%)	4	NA	NA
AVS53254.1|3074368_3074641_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
AVS53255.1|3074849_3077204_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	2.1e-224
AVS53256.1|3077389_3078661_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
AVS53257.1|3078912_3079536_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 224
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3100544	3101654	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS53276.1|3100544_3101654_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 225
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3111176	3112839	4740838		Staphylococcus_phage(50.0%)	2	NA	NA
AVS53287.1|3111176_3111647_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
AVS53288.1|3111735_3112839_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
>prophage 226
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3117524	3121864	4740838	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVS53296.1|3117524_3118496_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
AVS53297.1|3118506_3120354_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVS53298.1|3120381_3120714_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AVS53299.1|3120736_3121864_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
>prophage 227
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3129835	3139754	4740838		Bacillus_phage(60.0%)	7	NA	NA
AVS53306.1|3129835_3131131_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	1.5e-27
AVS53307.1|3131200_3131890_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AVS53308.1|3132104_3133307_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	1.3e-07
AVS53309.1|3133303_3136444_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
AVS53310.1|3136616_3137789_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVS53311.1|3137808_3138717_-	fructokinase	NA	NA	NA	NA	NA
AVS53312.1|3138842_3139754_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
>prophage 228
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3143441	3144554	4740838		Bacillus_phage(100.0%)	1	NA	NA
AVS53319.1|3143441_3144554_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	5.6e-18
>prophage 229
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3159117	3161004	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS53334.1|3159117_3161004_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	7.0e-53
>prophage 230
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3174422	3184133	4740838		Escherichia_phage(33.33%)	6	NA	NA
AVS53347.1|3174422_3177395_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.3	1.6e-83
AVS53348.1|3177404_3179363_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.4	1.3e-81
AVS53349.1|3179551_3180805_-	MFS transporter	NA	NA	NA	NA	NA
AVS53350.1|3181096_3181291_-	copper chaperone	NA	NA	NA	NA	NA
AVS53351.1|3181368_3181833_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVS53352.1|3181829_3184133_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	2.7e-91
>prophage 231
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3191780	3192305	4740838		Escherichia_phage(100.0%)	1	NA	NA
AVS53359.1|3191780_3192305_-	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 232
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3204850	3205123	4740838		Salmonella_phage(100.0%)	1	NA	NA
AVS53372.1|3204850_3205123_+	cytoplasmic protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 233
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3213283	3217611	4740838		Enterobacteria_phage(50.0%)	4	NA	NA
AVS53380.1|3213283_3213559_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.8	2.7e-22
AVS53381.1|3213913_3215161_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	1.2e-98
AVS53382.1|3215172_3216276_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AVS53383.1|3216558_3217611_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 234
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3222382	3223522	4740838		Mycobacterium_phage(100.0%)	1	NA	NA
AVS53389.1|3222382_3223522_-	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.8	1.3e-30
>prophage 235
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3226736	3227315	4740838		Caulobacter_phage(100.0%)	1	NA	NA
AVS53393.1|3226736_3227315_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 236
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3270016	3272656	4740838		Salicola_phage(100.0%)	1	NA	NA
AVS53431.1|3270016_3272656_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	3.1e-75
>prophage 237
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3279716	3283927	4740838		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVS54852.1|3279716_3280448_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
AVS53438.1|3280511_3280979_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AVS53439.1|3280975_3281698_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS53440.1|3281732_3282488_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVS53441.1|3282559_3283927_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
>prophage 238
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3287977	3288781	4740838		Indivirus(100.0%)	1	NA	NA
AVS53446.1|3287977_3288781_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	1.1e-36
>prophage 239
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3295616	3296648	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS53448.1|3295616_3296648_+	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 240
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3310635	3314738	4740838		Saccharomonospora_phage(50.0%)	2	NA	NA
AVS53464.1|3310635_3314118_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	4.8e-209
AVS53465.1|3314141_3314738_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	4.3e-25
>prophage 241
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3323570	3324329	4740838		Flavobacterium_phage(100.0%)	1	NA	NA
AVS53474.1|3323570_3324329_-	ditrans,polycis-undecaprenyl-diphosphate synthase ((2E,6E)-farnesyl-diphosphate specific)	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 242
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3337766	3339194	4740838	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS53488.1|3337766_3339194_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 243
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3343177	3343522	4740838		Lake_Baikal_phage(100.0%)	1	NA	NA
AVS53493.1|3343177_3343522_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 244
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3356917	3357715	4740838		Planktothrix_phage(100.0%)	1	NA	NA
AVS53505.1|3356917_3357715_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 245
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3362962	3365437	4740838		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS53508.1|3362962_3365437_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.2	1.5e-34
>prophage 246
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3368453	3369872	4740838		unidentified_phage(100.0%)	1	NA	NA
AVS53512.1|3368453_3369872_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.4e-26
>prophage 247
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3380637	3390341	4740838		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
AVS53524.1|3380637_3381564_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
AVS53525.1|3381672_3382335_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVS53526.1|3382392_3382929_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AVS53527.1|3383134_3385525_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVS53528.1|3385602_3387213_-	multicopper oxidase	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
AVS53529.1|3387414_3387762_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53530.1|3387868_3388729_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AVS53531.1|3388749_3389544_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVS53532.1|3389573_3390341_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
>prophage 248
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3401679	3403104	4740838		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS53542.1|3401679_3403104_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 249
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3414198	3414762	4740838		Sphingobium_phage(100.0%)	1	NA	NA
AVS53550.1|3414198_3414762_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 250
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3419010	3420054	4740838		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS53556.1|3419010_3420054_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 251
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3452094	3453666	4740838		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AVS53585.1|3452094_3453666_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 252
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3461714	3462422	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS53593.1|3461714_3462422_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	1.6e-23
>prophage 253
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3470197	3475629	4740838		Lymphocystis_disease_virus(50.0%)	3	NA	NA
AVS53601.1|3470197_3472549_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	1.6e-14
AVS53602.1|3472449_3472698_-	hypothetical protein	NA	NA	NA	NA	NA
AVS53603.1|3472722_3475629_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
>prophage 254
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3483358	3484792	4740838		Enterococcus_phage(50.0%)	2	NA	NA
AVS53611.1|3483358_3484207_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	7.5e-07
AVS53612.1|3484312_3484792_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
>prophage 255
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3487929	3489819	4740838		Catovirus(100.0%)	1	NA	NA
AVS53617.1|3487929_3489819_-	phosphatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 256
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3497573	3503213	4740838		Vibrio_phage(50.0%)	4	NA	NA
AVS53627.1|3497573_3499091_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
AVS53628.1|3499125_3500268_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVS53629.1|3500379_3501597_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVS53630.1|3501659_3503213_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.8	6.8e-30
>prophage 257
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3508750	3509899	4740838		Halovirus(100.0%)	1	NA	NA
AVS53635.1|3508750_3509899_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	3.4e-50
>prophage 258
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3528906	3531762	4740838	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS54858.1|3528906_3531762_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.6	1.3e-79
>prophage 259
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3538260	3539427	4740838		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS53658.1|3538260_3539427_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 260
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3543992	3545486	4740838		Tetraselmis_virus(100.0%)	1	NA	NA
AVS53662.1|3543992_3545486_-	DUF229 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	30.9	1.8e-32
>prophage 261
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3565649	3577953	4740838		Plodia_interpunctella_granulovirus(20.0%)	12	NA	NA
AVS53680.1|3565649_3567749_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
AVS53681.1|3568129_3568573_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS53682.1|3568589_3569123_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AVS53683.1|3569183_3569528_-	hypothetical protein	NA	NA	NA	NA	NA
AVS53684.1|3569654_3570602_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS53685.1|3570882_3572022_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AVS53686.1|3572107_3574024_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
AVS53687.1|3574372_3574777_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53688.1|3574812_3575526_+	hypothetical protein	NA	NA	NA	NA	NA
AVS53689.1|3575675_3576242_+	acetate uptake transporter	NA	NA	NA	NA	NA
AVS53690.1|3576298_3576889_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVS53691.1|3576999_3577953_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
>prophage 262
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3596703	3598128	4740838		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVS53708.1|3596703_3598128_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	1.8e-08
>prophage 263
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3602077	3607241	4740838		Bacillus_phage(33.33%)	3	NA	NA
AVS53716.1|3602077_3604051_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
AVS53717.1|3604223_3605891_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AVS54860.1|3606008_3607241_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	3.3e-88
>prophage 264
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3619393	3620716	4740838		Geobacillus_virus(100.0%)	1	NA	NA
AVS53730.1|3619393_3620716_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 265
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3626263	3629162	4740838		Salmonella_phage(50.0%)	3	NA	NA
AVS53736.1|3626263_3626443_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
AVS53737.1|3626553_3627171_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVS53738.1|3627572_3629162_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
>prophage 266
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3632939	3634004	4740838		Bacillus_virus(100.0%)	1	NA	NA
AVS53744.1|3632939_3634004_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	5.5e-15
>prophage 267
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3638978	3640258	4740838		Salmonella_phage(50.0%)	2	NA	NA
AVS53750.1|3638978_3639518_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
AVS53751.1|3639520_3640258_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
>prophage 268
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3643519	3645181	4740838		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS53754.1|3643519_3645181_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 269
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3650188	3654158	4740838		Leptospira_phage(50.0%)	2	NA	NA
AVS53759.1|3650188_3652618_+	DEAD/DEAH box helicase	NA	Q6NDX2	Leptospira_phage	28.2	1.4e-21
AVS53760.1|3652688_3654158_+	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	29.1	1.2e-31
>prophage 270
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3661415	3662381	4740838		Sodalis_phage(100.0%)	1	NA	NA
AVS53768.1|3661415_3662381_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	53.8	8.2e-66
>prophage 271
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3701351	3701627	4740838		Vibrio_phage(100.0%)	1	NA	NA
AVS53806.1|3701351_3701627_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	1.3e-16
>prophage 272
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3708972	3709791	4740838		Yersinia_phage(100.0%)	1	NA	NA
AVS53815.1|3708972_3709791_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	4.4e-44
>prophage 273
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3717280	3731005	4740838		Leptospira_phage(16.67%)	9	NA	NA
AVS53829.1|3717280_3720694_+	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	26.3	1.9e-16
AVS53830.1|3720754_3722389_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	32.0	9.1e-33
AVS53831.1|3722385_3723558_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVS53832.1|3723601_3725191_-	hypothetical protein	NA	Q38324	Lactococcus_phage	25.5	1.1e-22
AVS53833.1|3726453_3727329_-	HNH endonuclease	NA	NA	NA	NA	NA
AVS53834.1|3727394_3727622_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS53835.1|3727724_3728003_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.2	1.7e-16
AVS53836.1|3728209_3729478_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.1	3.7e-82
AVS53837.1|3729985_3731005_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
>prophage 274
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3738825	3743772	4740838	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
AVS53846.1|3738825_3740337_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
AVS53847.1|3740434_3740917_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVS53848.1|3740916_3743772_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	3.0e-140
>prophage 275
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3755880	3762429	4740838	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AVS53863.1|3755880_3756816_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
AVS53864.1|3756828_3757290_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVS53865.1|3757366_3757753_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVS53866.1|3757827_3758274_+|transposase	transposase	transposase	NA	NA	NA	NA
AVS53867.1|3758389_3761098_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.2	1.5e-45
AVS53868.1|3761481_3762429_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
>prophage 276
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3766095	3769435	4740838		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVS53871.1|3766095_3768234_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
AVS53872.1|3768450_3768915_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	7.2e-52
AVS53873.1|3768918_3769203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	8.6e-32
AVS53874.1|3769192_3769435_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 277
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3781368	3783124	4740838		Klosneuvirus(50.0%)	2	NA	NA
AVS53888.1|3781368_3782367_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
AVS53889.1|3782593_3783124_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 278
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3821164	3822328	4740838		Ralstonia_phage(100.0%)	1	NA	NA
AVS53931.1|3821164_3822328_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	2.0e-82
>prophage 279
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3827192	3831599	4740838		Lactococcus_phage(50.0%)	3	NA	NA
AVS53939.1|3827192_3829631_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.6e-68
AVS53940.1|3829668_3830094_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS53941.1|3830300_3831599_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	3.8e-66
>prophage 280
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3837144	3840330	4740838		Wolbachia_phage(50.0%)	2	NA	NA
AVS53948.1|3837144_3839001_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
AVS53949.1|3839010_3840330_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
>prophage 281
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3845351	3845897	4740838		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVS53953.1|3845351_3845897_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 282
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3853711	3854689	4740838		Tupanvirus(100.0%)	1	NA	NA
AVS53959.1|3853711_3854689_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 283
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3858415	3858949	4740838		Morganella_phage(100.0%)	1	NA	NA
AVS53964.1|3858415_3858949_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.8	9.4e-48
>prophage 284
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3864024	3866008	4740838		Vibrio_phage(50.0%)	2	NA	NA
AVS53972.1|3864024_3865671_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
AVS53973.1|3865714_3866008_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 285
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3884543	3889018	4740838		Escherichia_phage(100.0%)	4	NA	NA
AVS53989.1|3884543_3885197_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	1.8e-80
AVS53990.1|3885212_3885986_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	4.6e-104
AVS53991.1|3885978_3886605_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
AVS54868.1|3886618_3889018_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.4	0.0e+00
>prophage 286
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3907237	3915608	4740838		Bacillus_phage(25.0%)	8	NA	NA
AVS54870.1|3907237_3908308_+	two-component system sensor histidine kinase BasS	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
AVS54004.1|3908315_3908405_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AVS54005.1|3908474_3909977_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AVS54006.1|3910444_3910780_+	hypothetical protein	NA	NA	NA	NA	NA
AVS54007.1|3910899_3911343_+	VOC family protein	NA	NA	NA	NA	NA
AVS54008.1|3911464_3911929_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AVS54009.1|3912186_3913095_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.6	1.3e-33
AVS54010.1|3913460_3915608_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
>prophage 287
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3925233	3927192	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS54021.1|3925233_3927192_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 288
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3933410	3934760	4740838		Moraxella_phage(100.0%)	1	NA	NA
AVS54028.1|3933410_3934760_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 289
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3939646	3941713	4740838		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS54034.1|3939646_3941713_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 290
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3964298	3967902	4740838		Enterobacteria_phage(50.0%)	3	NA	NA
AVS54040.1|3964298_3964829_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
AVS54041.1|3964995_3965112_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54042.1|3965076_3967902_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
>prophage 291
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	3971997	4020666	4740838	tRNA,plate,tail	Burkholderia_phage(39.13%)	51	NA	NA
AVS54051.1|3971997_3973077_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	8.9e-29
AVS54052.1|3973108_3974524_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AVS54053.1|3974588_3975572_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVS54054.1|3975746_3975989_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AVS54055.1|3976156_3977155_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVS54056.1|3977242_3978553_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVS54057.1|3978799_3979315_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AVS54873.1|3979414_3979624_-	CsbD family protein	NA	NA	NA	NA	NA
AVS54874.1|3979645_3979759_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54058.1|3979755_3981081_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AVS54059.1|3981259_3981868_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AVS54060.1|3981976_3982345_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AVS54061.1|3982515_3984936_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AVS54062.1|3985034_3985907_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AVS54063.1|3985920_3986418_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AVS54064.1|3986598_3987516_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AVS54065.1|3987679_3989038_-	maltoporin	NA	NA	NA	NA	NA
AVS54066.1|3989126_3990236_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AVS54067.1|3990596_3991787_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AVS54068.1|3991918_3993463_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AVS54069.1|3993477_3994368_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AVS54070.1|3994533_3994944_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AVS54071.1|3995086_3997183_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AVS54072.1|3997182_3997920_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54073.1|3997916_3998555_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AVS54074.1|3998618_3998861_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54075.1|3999304_4000954_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVS54076.1|4001298_4002648_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AVS54077.1|4002778_4003126_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AVS54078.1|4003702_4003990_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
AVS54079.1|4003992_4004598_+	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
AVS54080.1|4004610_4004925_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVS54081.1|4005084_4005540_+	hypothetical protein	NA	NA	NA	NA	NA
AVS54082.1|4005536_4005734_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVS54083.1|4005723_4007151_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	4.0e-194
AVS54084.1|4007150_4007675_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVS54085.1|4007726_4008044_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVS54086.1|4008003_4008132_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVS54087.1|4008228_4010580_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.7	2.4e-66
AVS54088.1|4010579_4011533_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AVS54089.1|4011532_4011742_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVS54090.1|4011729_4012773_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
AVS54091.1|4012782_4013505_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
AVS54092.1|4013513_4013753_+	hypothetical protein	NA	NA	NA	NA	NA
AVS54093.1|4013828_4014191_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AVS54094.1|4014187_4015117_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AVS54095.1|4015116_4016664_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.5e-48
AVS54096.1|4016827_4017187_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVS54097.1|4017177_4018293_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
AVS54098.1|4018285_4018918_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
AVS54099.1|4018920_4020666_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
>prophage 292
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4029104	4032788	4740838		Dickeya_phage(100.0%)	1	NA	NA
AVS54110.1|4029104_4032788_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 293
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4047602	4049192	4740838		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS54119.1|4047602_4049192_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	2.2e-68
>prophage 294
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4054676	4056439	4740838		Bacillus_phage(50.0%)	3	NA	NA
AVS54125.1|4054676_4054949_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AVS54126.1|4055135_4055726_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVS54127.1|4055767_4056439_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
>prophage 295
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4064856	4075304	4740838		Salmonella_phage(33.33%)	5	NA	NA
AVS54137.1|4064856_4065885_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	60.9	1.8e-103
AVS54875.1|4065950_4066193_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54138.1|4066610_4066934_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54139.1|4066975_4071199_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AVS54140.1|4071275_4075304_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 296
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4079424	4082518	4740838		Tupanvirus(50.0%)	3	NA	NA
AVS54147.1|4079424_4080609_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AVS54148.1|4081185_4081359_+	hypothetical protein	NA	NA	NA	NA	NA
AVS54149.1|4081567_4082518_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
>prophage 297
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4091167	4093012	4740838		Acinetobacter_phage(100.0%)	1	NA	NA
AVS54153.1|4091167_4093012_-	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 298
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4114129	4117304	4740838		Hokovirus(50.0%)	2	NA	NA
AVS54172.1|4114129_4116631_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
AVS54173.1|4116641_4117304_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
>prophage 299
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4140640	4145251	4740838		Erwinia_phage(50.0%)	5	NA	NA
AVS54191.1|4140640_4141972_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
AVS54192.1|4142038_4142968_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVS54193.1|4143060_4143546_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVS54194.1|4143767_4144007_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVS54195.1|4144405_4145251_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
>prophage 300
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4156085	4157621	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS54208.1|4156085_4157621_-	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 301
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4170683	4174910	4740838		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVS54222.1|4170683_4171382_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVS54223.1|4171378_4172752_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AVS54224.1|4172799_4173003_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54225.1|4173123_4173519_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AVS54226.1|4173530_4174283_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVS54227.1|4174289_4174910_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 302
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4204870	4207665	4740838		Escherichia_phage(50.0%)	3	NA	NA
AVS54260.1|4204870_4205674_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
AVS54261.1|4205707_4206604_-	sugar kinase	NA	NA	NA	NA	NA
AVS54262.1|4206768_4207665_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
>prophage 303
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4226104	4227154	4740838		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVS54280.1|4226104_4227154_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 304
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4232511	4235298	4740838		Enterococcus_phage(100.0%)	1	NA	NA
AVS54286.1|4232511_4235298_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 305
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4247645	4248260	4740838		Streptococcus_phage(100.0%)	1	NA	NA
AVS54294.1|4247645_4248260_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.0	3.6e-19
>prophage 306
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4259187	4262622	4740838		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS54303.1|4259187_4259967_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
AVS54304.1|4259969_4260518_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVS54305.1|4260521_4260776_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVS54306.1|4260981_4262622_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
>prophage 307
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4276854	4278684	4740838		Catovirus(100.0%)	1	NA	NA
AVS54880.1|4276854_4278684_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.6e-81
>prophage 308
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4283560	4287477	4740838		Bacillus_phage(100.0%)	3	NA	NA
AVS54326.1|4283560_4285723_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	1.3e-116
AVS54327.1|4285858_4286575_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVS54328.1|4286574_4287477_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	30.2	1.6e-26
>prophage 309
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4304915	4311076	4740838		Enterobacteria_phage(40.0%)	6	NA	NA
AVS54346.1|4304915_4306046_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AVS54347.1|4306050_4306755_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVS54348.1|4306705_4307587_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.0	1.3e-107
AVS54349.1|4307619_4308687_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
AVS54350.1|4308686_4309949_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.2e-24
AVS54351.1|4309945_4311076_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	1.8e-27
>prophage 310
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4315210	4320613	4740838		Indivirus(33.33%)	5	NA	NA
AVS54355.1|4315210_4315540_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVS54356.1|4315683_4316949_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
AVS54357.1|4316957_4317062_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVS54358.1|4317067_4318549_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AVS54359.1|4318588_4320613_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
>prophage 311
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4324053	4324395	4740838		Pseudomonas_phage(100.0%)	1	NA	NA
AVS54364.1|4324053_4324395_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	5.7e-06
>prophage 312
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4329756	4331403	4740838		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS54369.1|4329756_4331403_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
>prophage 313
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4346798	4350816	4740838		Staphylococcus_phage(50.0%)	3	NA	NA
AVS54884.1|4346798_4348304_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
AVS54380.1|4348311_4348731_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVS54381.1|4348947_4350816_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
>prophage 314
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4354109	4355102	4740838		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVS54384.1|4354109_4355102_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	1.2e-48
>prophage 315
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4367986	4371375	4740838		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVS54397.1|4367986_4369357_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	8.7e-37
AVS54398.1|4369545_4371375_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	8.1e-131
>prophage 316
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4375783	4382675	4740838		Cyanophage(33.33%)	7	NA	NA
AVS54402.1|4375783_4376824_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
AVS54403.1|4376959_4377919_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AVS54404.1|4377918_4378809_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVS54887.1|4378895_4379669_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AVS54405.1|4379683_4380409_+	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AVS54406.1|4380503_4381169_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVS54407.1|4381211_4382675_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	2.0e-63
>prophage 317
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4389669	4399460	4740838		Staphylococcus_phage(25.0%)	9	NA	NA
AVS54414.1|4389669_4389927_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVS54415.1|4389890_4390250_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVS54416.1|4390266_4390407_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVS54417.1|4391067_4392468_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVS54418.1|4392472_4393573_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AVS54419.1|4393720_4394794_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AVS54420.1|4394822_4397237_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
AVS54421.1|4397255_4398152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS54422.1|4398266_4399460_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.8	1.2e-47
>prophage 318
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4404309	4418120	4740838		Oenococcus_phage(20.0%)	10	NA	NA
AVS54428.1|4404309_4405458_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
AVS54429.1|4405542_4406880_+	MFS transporter	NA	NA	NA	NA	NA
AVS54430.1|4406905_4409641_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.5	2.8e-34
AVS54431.1|4409720_4410761_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVS54888.1|4410733_4411426_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AVS54432.1|4411555_4412740_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVS54433.1|4412729_4415282_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.2	3.7e-73
AVS54434.1|4415274_4415907_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVS54435.1|4416096_4417497_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AVS54889.1|4417502_4418120_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
>prophage 319
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4425763	4426714	4740838		Cyanophage(50.0%)	2	NA	NA
AVS54890.1|4425763_4426177_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
AVS54891.1|4426285_4426714_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
>prophage 320
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4435217	4440174	4740838		Salmonella_phage(50.0%)	6	NA	NA
AVS54452.1|4435217_4436402_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	9.8e-13
AVS54453.1|4436604_4437465_-	EamA family transporter	NA	NA	NA	NA	NA
AVS54454.1|4437557_4437647_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVS54455.1|4438102_4438294_-	hypothetical protein	NA	NA	NA	NA	NA
AVS54456.1|4438280_4438379_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVS54457.1|4438485_4440174_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	2.1e-56
>prophage 321
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4456890	4461372	4740838		Pseudomonas_phage(50.0%)	5	NA	NA
AVS54476.1|4456890_4457670_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.4	1.5e-38
AVS54477.1|4457854_4458178_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS54478.1|4458161_4458521_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVS54479.1|4458736_4459930_+	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
AVS54480.1|4459989_4461372_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	1.2e-41
>prophage 322
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4469736	4475770	4740838	transposase	Sodalis_phage(33.33%)	4	NA	NA
AVS54490.1|4469736_4470678_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
AVS54893.1|4470720_4471623_-	EamA family transporter	NA	NA	NA	NA	NA
AVS54491.1|4472128_4472824_+	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AVS54492.1|4473043_4475770_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.8	9.5e-35
>prophage 323
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4479622	4485518	4740838		Escherichia_phage(50.0%)	3	NA	NA
AVS54498.1|4479622_4482490_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	43.7	2.1e-93
AVS54499.1|4482564_4483182_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVS54500.1|4484486_4485518_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.8	8.4e-69
>prophage 324
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4494602	4495994	4740838		environmental_Halophage(100.0%)	1	NA	NA
AVS54506.1|4494602_4495994_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 325
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4501064	4506090	4740838		Bordetella_phage(33.33%)	4	NA	NA
AVS54511.1|4501064_4503176_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVS54512.1|4503194_4503470_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVS54513.1|4503524_4504148_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AVS54514.1|4504404_4506090_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.5	3.7e-21
>prophage 326
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4512068	4516622	4740838		Xanthomonas_phage(25.0%)	7	NA	NA
AVS54896.1|4512068_4512524_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
AVS54522.1|4512504_4513725_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	5.5e-43
AVS54523.1|4513900_4514566_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVS54524.1|4514783_4515020_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVS54525.1|4515040_4515208_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVS54526.1|4515305_4516115_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.9	7.7e-25
AVS54527.1|4516142_4516622_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.2e-28
>prophage 327
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4530996	4540698	4740838		Prochlorococcus_phage(16.67%)	9	NA	NA
AVS54541.1|4530996_4531929_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
AVS54542.1|4532131_4533328_+	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AVS54543.1|4533337_4534363_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVS54544.1|4534856_4535891_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
AVS54545.1|4535877_4536840_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVS54546.1|4536843_4538127_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AVS54547.1|4538136_4539681_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVS54548.1|4539928_4540360_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVS54549.1|4540446_4540698_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 328
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4566200	4568051	4740838	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS54574.1|4566200_4568051_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	1.7e-11
>prophage 329
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4594497	4595493	4740838		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS54598.1|4594497_4595493_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.8	8.3e-13
>prophage 330
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4599405	4599879	4740838		Macacine_betaherpesvirus(100.0%)	2	NA	NA
AVS54603.1|4599405_4599645_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	60.4	2.2e-12
AVS54604.1|4599687_4599879_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
>prophage 331
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4603156	4609487	4740838		Morganella_phage(33.33%)	6	NA	NA
AVS54609.1|4603156_4603369_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AVS54610.1|4603656_4603947_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS54611.1|4604385_4605096_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AVS54612.1|4605145_4606120_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	4.1e-17
AVS54613.1|4606338_4607001_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
AVS54614.1|4607153_4609487_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	2.0e-73
>prophage 332
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4627805	4629799	4740838		Planktothrix_phage(50.0%)	2	NA	NA
AVS54630.1|4627805_4628789_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
AVS54631.1|4628785_4629799_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
>prophage 333
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4658738	4659641	4740838		Burkholderia_virus(100.0%)	1	NA	NA
AVS54651.1|4658738_4659641_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.2	3.1e-06
>prophage 334
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4674356	4676399	4740838		Indivirus(100.0%)	1	NA	NA
AVS54665.1|4674356_4676399_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 335
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4684623	4687365	4740838		Staphylococcus_phage(100.0%)	1	NA	NA
AVS54673.1|4684623_4687365_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 336
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4692733	4704393	4740838		Dickeya_phage(28.57%)	12	NA	NA
AVS54900.1|4692733_4693399_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	2.8e-57
AVS54901.1|4693568_4693814_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AVS54679.1|4693837_4695481_-	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.5e-14
AVS54680.1|4695677_4697876_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	2.2e-111
AVS54681.1|4697956_4698583_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AVS54682.1|4698724_4699096_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AVS54683.1|4699117_4699390_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
AVS54684.1|4699376_4699973_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AVS54685.1|4700098_4701574_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AVS54686.1|4701576_4702245_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AVS54687.1|4702237_4703293_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVS54688.1|4703538_4704393_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
>prophage 337
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4710184	4712385	4740838		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
AVS54695.1|4710184_4710952_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
AVS54696.1|4710953_4711667_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
AVS54697.1|4711792_4712020_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AVS54698.1|4712016_4712385_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	28.1	9.5e-07
>prophage 338
CP028196	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 chromosome, complete genome	4740838	4715796	4717604	4740838		Planktothrix_phage(50.0%)	2	NA	NA
AVS54702.1|4715796_4716867_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
AVS54703.1|4716863_4717604_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
>prophage 1
CP028197	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence	444417	160445	203279	444417	transposase,integrase	Escherichia_phage(50.0%)	51	164724:164783	180682:181502
AVS55366.1|160445_161369_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AVS55053.1|161485_161815_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55054.1|163630_163870_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55055.1|163932_164244_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55056.1|164240_164435_+	hypothetical protein	NA	NA	NA	NA	NA
164724:164783	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
AVS55057.1|164787_165492_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55058.1|167125_168028_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AVS55059.1|168065_168299_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55060.1|168289_169051_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AVS55061.1|169071_169932_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AVS55062.1|169895_170078_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55063.1|170068_170773_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55064.1|170806_171298_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55065.1|171565_172579_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVS55066.1|172741_173323_+	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
AVS55067.1|173810_175166_+|transposase	IS1380 family transposase IS1247	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
AVS55367.1|175407_176217_+	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
AVS55068.1|176344_176758_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
AVS55069.1|177120_177552_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVS55070.1|178861_179209_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVS55071.1|179202_180042_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVS55072.1|179971_180151_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55073.1|180169_180670_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS55074.1|180745_181450_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55075.1|181570_184537_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
180682:181502	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AVS55076.1|184615_185620_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AVS55077.1|185801_185978_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AVS55078.1|186307_187123_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVS55079.1|187209_187512_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVS55080.1|187405_187657_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55081.1|187687_189181_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVS55082.1|189391_189616_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55083.1|189612_190350_-	resolvase	NA	NA	NA	NA	NA
AVS55084.1|190456_190948_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55085.1|190981_191686_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55086.1|191995_192889_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55087.1|193060_193291_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55088.1|193469_193790_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55089.1|193886_194105_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55090.1|194306_194618_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AVS55091.1|194622_195114_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
AVS55092.1|195193_195487_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
AVS55093.1|195666_195870_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55094.1|195924_196149_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55095.1|196188_196389_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55096.1|196611_196923_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55097.1|197298_197580_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55098.1|197796_198402_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55099.1|198734_200103_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
AVS55100.1|200278_201619_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVS55101.1|202040_203279_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
>prophage 2
CP028197	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence	444417	246919	296630	444417	transposase,integrase	Escherichia_phage(42.11%)	46	265124:265183	281867:282688
AVS55147.1|246919_248323_+|transposase	ISNCY family transposase ISKpn21	transposase	NA	NA	NA	NA
AVS55148.1|248351_248984_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55149.1|249037_249460_+	hypothetical protein	NA	A0A1B0VFY5	Salmonella_phage	97.6	6.7e-65
AVS55370.1|249506_250430_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AVS55150.1|250494_251391_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55151.1|251393_251909_-	nuclease	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AVS55152.1|252123_253551_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AVS55153.1|253801_255121_+	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
AVS55154.1|255133_255337_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55155.1|255400_256606_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AVS55156.1|256602_257421_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AVS55157.1|257886_258159_-	transcriptional repressor RcnR	NA	NA	NA	NA	NA
AVS55158.1|258281_259397_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AVS55159.1|259654_260089_-	copper-binding protein	NA	NA	NA	NA	NA
AVS55160.1|260306_261653_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
AVS55161.1|261736_262660_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
AVS55162.1|262848_264468_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AVS55163.1|264544_265021_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
265124:265183	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVS55164.1|265186_265891_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55165.1|266227_266569_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AVS55166.1|266583_267375_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AVS55167.1|267555_268392_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVS55168.1|268391_269195_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVS55169.1|269352_270366_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVS55170.1|270304_270586_+|transposase	transposase	transposase	NA	NA	NA	NA
AVS55171.1|270968_271538_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
AVS55172.1|271537_272038_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
AVS55173.1|272303_273845_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVS55174.1|274249_275089_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVS55175.1|275579_276224_+	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
AVS55176.1|276265_276718_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVS55177.1|277583_278288_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55178.1|278777_279887_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AVS55179.1|279981_281166_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AVS55180.1|281261_281918_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AVS55181.1|281929_282634_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55182.1|282777_283419_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
281867:282688	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTT	NA	NA	NA	NA
AVS55183.1|283568_284069_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55184.1|284148_284853_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55185.1|288866_291872_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AVS55186.1|292035_292620_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.4	8.4e-90
AVS55187.1|292631_293336_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55188.1|293369_293861_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55189.1|293967_294705_+	resolvase	NA	NA	NA	NA	NA
AVS55190.1|294701_294926_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55191.1|295136_296630_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP028197	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence	444417	423047	440379	444417	transposase,integrase	Escherichia_phage(33.33%)	20	424027:424039	440670:440682
AVS55338.1|423047_423509_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
AVS55339.1|423511_424009_+	hypothetical protein	NA	NA	NA	NA	NA
424027:424039	attL	AGGGCGGCTATGG	NA	NA	NA	NA
AVS55340.1|424223_424928_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55341.1|425478_426183_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55342.1|426073_427033_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AVS55343.1|427195_427777_+	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
AVS55344.1|428264_429620_+|transposase	IS1380 family transposase IS1247	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
AVS55378.1|429861_430671_+	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
AVS55345.1|430798_431212_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
AVS55346.1|431574_432006_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AVS55347.1|433315_433663_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVS55348.1|433656_434496_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVS55349.1|434425_434605_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55350.1|434623_435124_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVS55351.1|435199_435904_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS55352.1|436240_436582_+	ArdK family transcriptional regulator	NA	NA	NA	NA	NA
AVS55353.1|436596_437388_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AVS55354.1|437568_438405_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AVS55355.1|438404_439208_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AVS55356.1|439365_440379_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
440670:440682	attR	AGGGCGGCTATGG	NA	NA	NA	NA
>prophage 1
CP028198	Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_2, complete sequence	92366	3271	91593	92366	plate,lysis,head,capsid,portal,terminase,integrase,tail,holin,tRNA	Escherichia_phage(87.88%)	108	8304:8320	22333:22349
AVS55480.1|3271_3463_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AVS55382.1|3462_3855_+	hypothetical protein	NA	A0A222YWH1	Escherichia_phage	100.0	2.9e-70
AVS55383.1|3963_4356_+	late promoter activating protein	NA	NA	NA	NA	NA
AVS55481.1|4736_5717_+	DNA pacase A subunit	NA	NA	NA	NA	NA
AVS55384.1|5716_7225_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	57.0	4.3e-162
AVS55482.1|7252_7492_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
8304:8320	attL	TTTAGTTTTCTAACATA	NA	NA	NA	NA
AVS55385.1|8684_9713_+|integrase	integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
AVS55483.1|9822_10131_+	hypothetical protein	NA	Q5QBE7	Escherichia_phage	99.0	6.9e-51
AVS55386.1|10127_10604_+	hypothetical protein	NA	NA	NA	NA	NA
AVS55387.1|10600_11095_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	96.3	2.1e-86
AVS55388.1|11109_11760_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	59.1	4.2e-66
AVS55389.1|11766_12534_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	97.2	4.7e-133
AVS55390.1|12523_13618_+	hypothetical protein	NA	Q71T61	Escherichia_phage	33.1	2.7e-41
AVS55391.1|13653_14034_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	91.9	1.2e-57
AVS55392.1|14033_14255_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AVS55393.1|14327_14717_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	98.4	1.1e-69
AVS55394.1|14982_15507_-	hypothetical protein	NA	A0A2D2W4T4	Escherichia_phage	48.5	4.9e-33
AVS55395.1|15503_15809_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55396.1|15808_16093_-	antitoxin PHD	NA	NA	NA	NA	NA
AVS55397.1|16076_16859_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	53.1	5.4e-76
AVS55398.1|16837_17047_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55399.1|17302_17596_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	94.8	2.0e-47
AVS55400.1|17619_17901_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	93.5	2.1e-46
AVS55401.1|17900_18161_-	eaa protein	NA	A0A1B0V7L4	Salmonella_phage	95.3	6.0e-40
AVS55402.1|19075_19363_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	97.9	1.0e-48
AVS55403.1|19364_19814_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.0	6.7e-39
AVS55404.1|19810_20071_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	89.4	9.3e-41
AVS55405.1|20021_20210_-	hypothetical protein	NA	Q286W7	Escherichia_phage	92.6	3.7e-23
AVS55406.1|20214_20997_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	59.4	9.6e-49
AVS55407.1|20983_21283_-	hypothetical protein	NA	A0A222YY12	Escherichia_phage	98.0	1.1e-50
AVS55408.1|21296_22292_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	94.3	1.0e-188
AVS55409.1|22390_23083_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	97.4	2.3e-134
22333:22349	attR	TATGTTAGAAAACTAAA	NA	NA	NA	NA
AVS55410.1|23079_23391_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	97.1	3.4e-58
AVS55411.1|23387_23612_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	1.9e-34
AVS55412.1|23608_23884_-	DUF4752 domain-containing protein	NA	A0A222YWQ2	Escherichia_phage	83.5	1.6e-35
AVS55413.1|23880_24129_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	86.1	7.0e-30
AVS55414.1|24125_24911_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	97.5	7.4e-41
AVS55415.1|24919_25330_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	75.7	1.1e-32
AVS55416.1|25326_25815_-	hypothetical protein	NA	G9L663	Escherichia_phage	63.4	3.0e-40
AVS55484.1|25804_26089_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	92.6	6.3e-43
AVS55417.1|26118_26730_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	98.5	2.9e-109
AVS55418.1|27002_27581_+	recombinase	NA	A0A222YXV2	Escherichia_phage	96.4	1.4e-73
AVS55419.1|28148_28460_+	transcriptional regulator	NA	A0A222YY28	Escherichia_phage	84.1	3.5e-34
AVS55485.1|28456_28684_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55420.1|28869_29478_-	hypothetical protein	NA	NA	NA	NA	NA
AVS55421.1|29761_30415_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
AVS55422.1|30743_31073_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
AVS55423.1|31065_32262_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	98.0	7.7e-199
AVS55424.1|33095_33455_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	97.5	7.7e-62
AVS55425.1|33458_33761_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	1.3e-17
AVS55426.1|33906_34698_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.5	4.4e-150
AVS55427.1|34694_35462_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
AVS55428.1|35465_36446_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
AVS55429.1|36442_37096_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	97.7	1.5e-100
AVS55430.1|37155_38061_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	89.7	1.3e-150
AVS55486.1|38074_38725_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	91.2	2.8e-118
AVS55431.1|38717_39623_+	DNA methylase	NA	A0A222YYM0	Escherichia_phage	99.3	5.5e-173
AVS55432.1|39671_41333_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.5	0.0e+00
AVS55433.1|41601_41889_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
AVS55434.1|41881_42523_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
AVS55435.1|42810_43149_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	100.0	2.3e-52
AVS55436.1|43161_44118_-	recombinase	NA	A0A222YXF2	Escherichia_phage	100.0	7.6e-181
AVS55437.1|44384_44669_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
AVS55438.1|44668_45475_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	98.9	2.9e-117
AVS55487.1|45545_46004_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	99.3	9.2e-68
AVS55439.1|46157_46616_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
AVS55440.1|46632_47025_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.2	1.5e-66
AVS55441.1|47183_48881_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	99.6	0.0e+00
AVS55442.1|49028_49307_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	98.9	9.0e-42
AVS55443.1|49375_51034_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	99.5	3.9e-310
AVS55444.1|51078_51813_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
AVS55445.1|51880_52453_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
AVS55446.1|52461_52953_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
AVS55447.1|53007_53559_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	99.5	4.6e-98
AVS55448.1|53574_54282_+|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	100.0	1.0e-126
AVS55449.1|54663_55419_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AVS55450.1|55807_56629_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	1.3e-157
AVS55451.1|56643_60426_+	transglycosylase	NA	A0A222YXR4	Escherichia_phage	97.8	0.0e+00
AVS55452.1|60431_60806_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	99.2	1.6e-65
AVS55453.1|60802_62233_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	99.2	2.0e-270
AVS55454.1|62243_63089_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	100.0	4.5e-161
AVS55488.1|63480_63630_+|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
AVS55455.1|63632_66929_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	62.0	0.0e+00
AVS55456.1|66930_67458_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.1	4.1e-88
AVS55457.1|67485_68019_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.3	1.6e-95
AVS55458.1|68021_69317_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	89.1	2.0e-232
AVS55459.1|69586_70147_-	DNA-invertase	NA	A0A222YWP5	Escherichia_phage	100.0	1.2e-98
AVS55460.1|70252_70579_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
AVS55461.1|70578_71025_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AVS55462.1|71014_71635_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.5	1.1e-79
AVS55463.1|71627_73577_+|head	head protein	head	A0A222YWA3	Escherichia_phage	94.3	2.8e-307
AVS55464.1|73576_73945_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
AVS55465.1|74039_75425_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.4	4.1e-236
AVS55466.1|75933_77172_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	98.8	1.2e-234
AVS55467.1|77185_78184_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	99.1	2.1e-181
AVS55468.1|78384_79347_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	97.8	9.0e-174
AVS55469.1|79602_79758_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS55470.1|79760_79985_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AVS55471.1|79984_80692_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	98.7	6.5e-129
AVS55472.1|80691_80889_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
AVS55473.1|80921_81407_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AVS55474.1|81558_88395_+	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
AVS55475.1|88431_88866_+	olxA	NA	A0A222YZ35	Escherichia_phage	93.1	8.1e-74
AVS55476.1|88868_89129_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	93.0	4.9e-42
AVS55477.1|89463_89760_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AVS55478.1|89774_89975_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
AVS55489.1|89989_90271_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	97.8	2.0e-41
AVS55479.1|90384_91593_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
