The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	0	28596	5071057	lysis,tRNA,tail,terminase,head,transposase,holin	Enterobacteria_phage(47.83%)	51	NA	NA
AVS45288.1|363_570_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVS45289.1|566_2492_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
AVS45290.1|2593_4165_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
AVS45291.1|4184_4532_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS45292.1|4531_5209_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS45293.1|5245_5719_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	79.9	2.9e-64
AVS45294.1|6106_6340_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AVS45295.1|6396_6807_+	hypothetical protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AVS45296.1|6852_7017_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45297.1|7327_7933_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	96.5	2.7e-107
AVS45298.1|8082_8520_-|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.9	6.5e-71
AVS45299.1|8516_8993_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
AVS45300.1|8976_9300_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AVS45301.1|9778_9994_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45302.1|10359_10983_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AVS45303.1|10979_11168_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
AVS45304.1|11164_11527_-	hypothetical protein	NA	K7PKF0	Enterobacteria_phage	100.0	9.2e-63
AVS45305.1|11523_11814_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	96.9	1.2e-49
AVS45306.1|11813_12536_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	97.9	1.9e-128
AVS45307.1|12610_13294_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	84.6	2.6e-111
AVS45308.1|13573_13750_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	7.9e-28
AVS45309.1|13746_14157_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
AVS45310.1|14128_14485_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	7.9e-59
AVS45311.1|14496_14697_-	hypothetical protein	NA	Q716C9	Shigella_phage	98.5	3.9e-31
AVS45312.1|14693_15020_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
AVS45313.1|15032_15239_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.2e-30
AVS45314.1|15311_15602_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AVS45315.1|15598_16300_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AVS45316.1|16296_17196_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	1.6e-172
AVS45317.1|17228_17525_-	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
AVS45318.1|17676_17904_-	DNA-binding protein	NA	G9L677	Escherichia_phage	97.3	1.1e-34
AVS45319.1|17981_18689_+	phage repressor protein C	NA	G9L676	Escherichia_phage	100.0	1.5e-133
AVS45320.1|18836_19532_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45321.1|19528_20347_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AVS45322.1|20791_21064_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.4e-39
AVS45323.1|21066_21429_+	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
AVS45324.1|21459_21954_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
AVS45325.1|22154_22625_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
AVS45326.1|22775_23144_+	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
AVS45327.1|23223_23463_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	93.7	3.5e-34
AVS45328.1|23459_23648_+	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
AVS45329.1|23656_24337_+	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
AVS45330.1|24333_24921_+	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
AVS45331.1|24944_25238_+	RecBCD nuclease inhibitor	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
AVS45332.1|25248_25416_+	DUF2737 domain-containing protein	NA	K7PJV9	Enterobacteria_phage	100.0	1.0e-24
AVS45333.1|25412_26228_+	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	81.0	4.9e-120
AVS45334.1|26227_26800_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	9.6e-107
AVS45335.1|26836_27109_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	98.9	3.6e-43
AVS45336.1|27142_27691_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	96.2	6.0e-90
AVS45337.1|27713_28187_-	DUF4065 domain-containing protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
AVS45338.1|28473_28596_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
>prophage 2
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	32519	33128	5071057		Lactococcus_phage(100.0%)	1	NA	NA
AVS45341.1|32519_33128_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 3
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	42341	43457	5071057		Mycoplasma_phage(100.0%)	1	NA	NA
AVS45350.1|42341_43457_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 4
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	68629	72313	5071057		Dickeya_phage(100.0%)	1	NA	NA
AVS45374.1|68629_72313_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 5
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	88154	89744	5071057		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS45382.1|88154_89744_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 6
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	95112	96876	5071057		Bacillus_phage(50.0%)	3	NA	NA
AVS45388.1|95112_95385_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
AVS45389.1|95571_96162_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVS45390.1|96204_96876_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 7
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	105172	113501	5071057		Vibrio_phage(50.0%)	2	NA	NA
AVS45400.1|105172_109396_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
AVS45401.1|109472_113501_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 8
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	117617	120670	5071057		Tupanvirus(50.0%)	4	NA	NA
AVS45408.1|117617_118802_-	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AVS45409.1|119377_119533_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45410.1|119542_119737_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45411.1|119719_120670_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
>prophage 9
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	129093	130938	5071057		Acinetobacter_phage(100.0%)	1	NA	NA
AVS45415.1|129093_130938_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 10
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	148034	155281	5071057		Serratia_phage(33.33%)	5	NA	NA
AVS45429.1|148034_150332_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
AVS45430.1|150382_150703_-	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AVS45431.1|150717_151797_-	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AVS45432.1|152105_154607_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.9e-11
AVS45433.1|154618_155281_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 11
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	162148	163702	5071057		Pandoravirus(100.0%)	1	NA	NA
AVS45439.1|162148_163702_-	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	3.9e-09
>prophage 12
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	175324	179827	5071057		Erwinia_phage(50.0%)	5	NA	NA
AVS45450.1|175324_176656_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AVS45451.1|176722_177649_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVS45452.1|177741_178227_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVS45453.1|178311_178557_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVS45454.1|178981_179827_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 13
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	188472	189820	5071057	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVS45464.1|188472_189820_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	7.9e-75
>prophage 14
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	192836	197696	5071057		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVS45467.1|192836_193535_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVS45468.1|193531_194905_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AVS45469.1|195010_195685_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVS45470.1|195833_196778_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AVS45471.1|196793_196901_-	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
AVS45472.1|197075_197696_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 15
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	228016	230796	5071057		Escherichia_phage(50.0%)	3	NA	NA
AVS45503.1|228016_228802_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
AVS45504.1|228835_229732_-	sugar kinase	NA	NA	NA	NA	NA
AVS45505.1|229899_230796_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 16
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	246954	249425	5071057		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVS45517.1|246954_248004_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
AVS49893.1|248015_249425_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 17
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	253503	256290	5071057		uncultured_virus(100.0%)	1	NA	NA
AVS45522.1|253503_256290_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 18
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	270072	270687	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS45533.1|270072_270687_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 19
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	279476	282763	5071057		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS45541.1|279476_280253_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
AVS45542.1|280255_280771_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVS45543.1|280774_281044_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVS45544.1|281122_282763_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	1.1e-41
>prophage 20
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	297401	299231	5071057		Catovirus(100.0%)	1	NA	NA
AVS49894.1|297401_299231_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 21
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	306618	310477	5071057		Bacillus_phage(100.0%)	3	NA	NA
AVS45568.1|306618_308781_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
AVS45569.1|308864_309581_-	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AVS45570.1|309580_310477_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 22
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	320807	322463	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
AVS45582.1|320807_322463_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	8.0e-45
>prophage 23
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	330482	334722	5071057		uncultured_marine_virus(33.33%)	4	NA	NA
AVS45589.1|330482_331613_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
AVS45590.1|331617_332292_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVS45591.1|332332_333595_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
AVS45592.1|333591_334722_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 24
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	338750	344164	5071057		Indivirus(33.33%)	5	NA	NA
AVS45598.1|338750_339080_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVS45599.1|339210_340476_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AVS45600.1|340483_340606_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVS45601.1|340611_342096_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AVS45602.1|342142_344164_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 25
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	352492	354139	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS45610.1|352492_354139_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.1e-65
>prophage 26
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	367521	373374	5071057		Enterobacteria_phage(33.33%)	5	NA	NA
AVS45618.1|367521_368412_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
AVS45619.1|368436_369402_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
AVS45620.1|369406_370912_-	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AVS49898.1|370919_371339_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVS45621.1|371505_373374_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.3e-64
>prophage 27
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	376542	377535	5071057		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVS45624.1|376542_377535_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 28
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	389487	392849	5071057		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVS45638.1|389487_390858_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
AVS45639.1|391019_392849_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	9.5e-132
>prophage 29
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	398383	402223	5071057		Cyanophage(50.0%)	4	NA	NA
AVS45644.1|398383_399424_+	phosphate-binding protein	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
AVS45645.1|399509_400469_+	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVS45646.1|400468_401359_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVS45647.1|401449_402223_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 30
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	411229	412567	5071057		Moraxella_phage(100.0%)	1	NA	NA
AVS45653.1|411229_412567_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 31
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	425237	432606	5071057		Staphylococcus_phage(33.33%)	8	NA	NA
AVS45663.1|425237_425495_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVS45664.1|425458_425818_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVS45665.1|425834_425975_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVS45666.1|426087_426288_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45667.1|426581_427985_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVS45668.1|427989_429090_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AVS45669.1|429089_430163_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVS45670.1|430191_432606_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 32
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	437310	438459	5071057		Oenococcus_phage(100.0%)	1	NA	NA
AVS45676.1|437310_438459_+	D-galactonate dehydratase 2	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 33
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	442885	443839	5071057		Cyanophage(50.0%)	2	NA	NA
AVS45680.1|442885_443299_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
AVS45681.1|443410_443839_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 34
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	450699	459721	5071057		Aeromonas_phage(25.0%)	13	NA	NA
AVS45687.1|450699_452415_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
AVS45688.1|452411_453905_+	hypothetical protein	NA	A0A2K9L727	Tupanvirus	28.3	2.5e-29
AVS45689.1|453951_454401_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45690.1|454509_454857_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45691.1|454846_455209_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45692.1|455205_455703_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45693.1|455710_456895_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
AVS45694.1|457174_457264_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVS45695.1|457260_457374_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AVS45696.1|457396_457555_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45697.1|457566_457842_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45698.1|457828_457927_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVS45699.1|458032_459721_+	acetolactate synthase catalytic subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.3e-55
>prophage 35
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	470418	471753	5071057		Moraxella_phage(100.0%)	1	NA	NA
AVS49903.1|470418_471753_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 36
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	488319	489592	5071057	transposase	Shigella_phage(100.0%)	1	NA	NA
AVS45714.1|488319_489592_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
>prophage 37
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	511824	513216	5071057		environmental_Halophage(100.0%)	1	NA	NA
AVS45736.1|511824_513216_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 38
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	518336	536622	5071057	integrase	Morganella_phage(27.27%)	22	533595:533608	537386:537399
AVS45741.1|518336_520445_-	bifunctional (p)ppGpp synthetase II/ guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVS45742.1|520463_520739_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVS45743.1|520793_521417_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AVS45744.1|521674_523357_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.6e-24
AVS45745.1|523353_523971_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AVS45746.1|524261_525086_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.6	5.8e-97
AVS45747.1|525558_526269_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	54.6	8.1e-71
AVS45748.1|526265_526751_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	37.9	2.7e-25
AVS45749.1|527117_527297_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45750.1|527601_528129_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45751.1|528227_528500_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45752.1|528774_529062_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AVS45753.1|529058_529589_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	37.5	9.5e-08
AVS45754.1|530065_531478_-	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	56.6	2.2e-112
AVS45755.1|531474_531765_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVS45756.1|531769_531970_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45757.1|531962_532328_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49904.1|532320_533034_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45758.1|533320_534121_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	41.4	3.2e-23
533595:533608	attL	TTTTTACCCAGTTC	NA	NA	NA	NA
AVS45759.1|534198_534417_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVS45760.1|534529_535312_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	23.9	3.5e-06
AVS45761.1|535368_536622_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.3	6.0e-186
537386:537399	attR	TTTTTACCCAGTTC	NA	NA	NA	NA
>prophage 39
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	539963	544526	5071057		Xanthomonas_phage(25.0%)	7	NA	NA
AVS49906.1|539963_540419_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AVS45766.1|540399_541620_-	bifunctional phosphopantothenoylcysteine decarboxylase CoaC/phosphopantothenate--cysteine ligase CoaB	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
AVS45767.1|541791_542460_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVS45768.1|542676_542913_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVS45769.1|542933_543101_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVS45770.1|543198_544008_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.4	3.4e-25
AVS45771.1|544046_544526_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 40
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	551963	552992	5071057		Archaeal_BJ1_virus(100.0%)	1	NA	NA
AVS45779.1|551963_552992_+	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 41
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	557151	566658	5071057		Synechococcus_phage(16.67%)	9	NA	NA
AVS45784.1|557151_558084_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
AVS45785.1|558297_559494_+	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AVS45786.1|559503_560529_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVS45787.1|560767_561802_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
AVS45788.1|561788_562748_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVS45789.1|562751_564035_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AVS45790.1|564044_565589_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVS45791.1|565833_566265_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVS45792.1|566406_566658_+	glutaredoxin	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 42
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	588598	603517	5071057	tRNA	Acinetobacter_phage(33.33%)	11	NA	NA
AVS45810.1|588598_592729_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	7.4e-23
AVS45811.1|592957_593566_+	glutathione S-transferase	NA	NA	NA	NA	NA
AVS45812.1|593663_595055_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
AVS45813.1|595051_596896_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
AVS45814.1|597086_598238_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AVS45815.1|598368_599664_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	1.4e-20
AVS45816.1|599771_601310_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVS49909.1|601350_602424_-	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.7	2.1e-62
AVS49910.1|602702_602930_-	hypothetical protein	NA	NA	NA	NA	NA
AVS45817.1|602904_603090_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
AVS45818.1|603106_603517_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	1.1e-19
>prophage 43
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	624989	626531	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS45834.1|624989_626531_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 44
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	631848	632844	5071057		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS45839.1|631848_632844_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.2	7.0e-12
>prophage 45
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	637073	637286	5071057		Morganella_phage(100.0%)	1	NA	NA
AVS45844.1|637073_637286_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 46
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	640940	643274	5071057		Escherichia_phage(100.0%)	1	NA	NA
AVS45849.1|640940_643274_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	5.4e-71
>prophage 47
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	653383	655368	5071057		Planktothrix_phage(50.0%)	2	NA	NA
AVS45858.1|653383_654367_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
AVS45859.1|654363_655368_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 48
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	702268	703738	5071057		Bacillus_virus(50.0%)	2	NA	NA
AVS49917.1|702268_702916_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.7	6.1e-17
AVS45897.1|702967_703738_-	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	30.0	1.7e-18
>prophage 49
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	716808	723902	5071057		uncultured_Caudovirales_phage(75.0%)	7	NA	NA
AVS45911.1|716808_717234_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
AVS45912.1|717246_718536_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.7e-172
AVS45913.1|718590_718944_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.9	4.8e-24
AVS45914.1|719253_719337_+	Damage inducible protein	NA	NA	NA	NA	NA
AVS45915.1|719390_720743_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
AVS45916.1|720814_721657_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AVS45917.1|721859_723902_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 50
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	737312	740048	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS45930.1|737312_740048_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 51
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	743561	749206	5071057		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVS45935.1|743561_747791_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	7.6e-23
AVS45936.1|747993_748395_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AVS45937.1|748399_749206_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
>prophage 52
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	757087	761220	5071057		Dickeya_phage(50.0%)	4	NA	NA
AVS45946.1|757087_757753_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
AVS45947.1|757973_758219_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AVS45948.1|758321_760520_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.6	7.2e-118
AVS45949.1|760593_761220_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 53
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	764226	769917	5071057	transposase	Staphylococcus_phage(33.33%)	6	NA	NA
AVS45954.1|764226_764895_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AVS45955.1|764887_765946_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS45956.1|766190_767045_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
AVS45957.1|767072_767258_+	hypothetical protein	NA	NA	NA	NA	NA
AVS45958.1|767316_768441_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS45959.1|768569_769917_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	7.9e-75
>prophage 54
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	774237	775720	5071057		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVS45964.1|774237_775005_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
AVS45965.1|775006_775720_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 55
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	779340	781151	5071057		Planktothrix_phage(50.0%)	2	NA	NA
AVS45969.1|779340_780411_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
AVS45970.1|780407_781151_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	2.2e-10
>prophage 56
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	801169	803617	5071057		Dickeya_phage(100.0%)	1	NA	NA
AVS45987.1|801169_803617_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 57
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	817241	818477	5071057		Ralstonia_phage(100.0%)	1	NA	NA
AVS46000.1|817241_818477_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.6	6.4e-132
>prophage 58
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	822855	825249	5071057		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVS46003.1|822855_825249_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 59
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	831218	832097	5071057	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS46009.1|831218_832097_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	52.4	7.2e-69
>prophage 60
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	838679	842447	5071057		Bacillus_phage(66.67%)	3	NA	NA
AVS46017.1|838679_839399_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVS46018.1|839395_840748_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AVS46019.1|840824_842447_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	2.6e-141
>prophage 61
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	859424	860261	5071057		Vibrio_phage(100.0%)	1	NA	NA
AVS46035.1|859424_860261_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 62
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	879186	888733	5071057		Acinetobacter_phage(25.0%)	10	NA	NA
AVS46055.1|879186_879750_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.0e-60
AVS46056.1|879835_881056_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	NA	NA	NA	NA
AVS46057.1|881122_883225_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
AVS46058.1|883263_883896_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AVS46059.1|883902_884118_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46060.1|884197_884602_+	OsmC family protein	NA	NA	NA	NA	NA
AVS46061.1|884656_885526_-	phosphoribulokinase	NA	NA	NA	NA	NA
AVS46062.1|885579_885798_-	hypothetical protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AVS46063.1|885791_886814_-	hydrolase	NA	NA	NA	NA	NA
AVS46064.1|886813_888733_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	3.3e-74
>prophage 63
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	894304	899878	5071057		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AVS46073.1|894304_894691_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
AVS46074.1|894690_895050_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	4.0e-10
AVS46075.1|895057_895345_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVS46076.1|895470_895845_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVS46077.1|895941_896412_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVS46078.1|896508_898623_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AVS46079.1|898693_899878_+	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 64
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	919755	921227	5071057	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
AVS46118.1|919755_920703_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
AVS46119.1|920717_921227_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 65
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	931732	935886	5071057		Bacillus_virus(50.0%)	4	NA	NA
AVS46127.1|931732_932491_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
AVS46128.1|932498_933602_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVS46129.1|933611_934793_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVS46130.1|934860_935886_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
>prophage 66
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	942390	943275	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS46139.1|942390_943275_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.6	4.6e-23
>prophage 67
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	948612	953125	5071057		Escherichia_phage(50.0%)	4	NA	NA
AVS46146.1|948612_949443_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
AVS46147.1|949784_950639_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AVS46148.1|950674_951565_+	sugar ABC transporter	NA	NA	NA	NA	NA
AVS46149.1|951625_953125_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	7.5e-18
>prophage 68
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	962412	963456	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS46159.1|962412_963456_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 69
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	980663	983188	5071057	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
AVS46176.1|980663_981731_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
AVS46177.1|981820_983188_-|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 70
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	987154	987652	5071057		Pseudomonas_phage(100.0%)	1	NA	NA
AVS46184.1|987154_987652_+	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 71
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	991357	996090	5071057		Burkholderia_virus(50.0%)	5	NA	NA
AVS46188.1|991357_992848_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
AVS46189.1|992895_993585_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AVS46190.1|993581_994457_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
AVS46191.1|994453_994918_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AVS46192.1|994977_996090_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	89.2	1.2e-73
>prophage 72
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1002839	1017633	5071057		Staphylococcus_phage(25.0%)	17	NA	NA
AVS49926.1|1002839_1003769_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
AVS46196.1|1003864_1006201_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AVS46197.1|1006430_1007084_+	glutamine amidotransferase	NA	NA	NA	NA	NA
AVS46198.1|1007080_1007809_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVS46199.1|1007805_1008438_-	protein YrbL	NA	NA	NA	NA	NA
AVS46200.1|1008650_1008923_-	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AVS46201.1|1008919_1009774_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AVS46202.1|1009819_1010311_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVS46203.1|1010428_1010716_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AVS46204.1|1010738_1012172_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVS46205.1|1012219_1012945_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AVS46206.1|1012951_1013509_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVS46207.1|1013477_1014053_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVS46208.1|1014049_1014616_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
AVS46209.1|1014636_1015623_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AVS46210.1|1015636_1016614_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVS46211.1|1016823_1017633_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	3.7e-19
>prophage 73
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1021701	1023179	5071057		Vibrio_phage(50.0%)	2	NA	NA
AVS46216.1|1021701_1021980_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
AVS46217.1|1022207_1023179_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.7e-07
>prophage 74
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1029797	1032670	5071057	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVS46226.1|1029797_1031732_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
AVS46227.1|1031821_1032670_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 75
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1036750	1043389	5071057		Dickeya_phage(50.0%)	4	NA	NA
AVS46231.1|1036750_1038094_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
AVS49929.1|1038724_1039177_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVS46232.1|1039204_1040692_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVS46233.1|1040716_1043389_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 76
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1048865	1054482	5071057	transposase	Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
AVS46240.1|1048865_1050755_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
AVS46241.1|1050908_1052153_+	tryptophan permease	NA	NA	NA	NA	NA
AVS46242.1|1053269_1054482_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	4.9e-100
>prophage 77
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1058998	1066803	5071057		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
AVS46248.1|1058998_1059301_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
AVS46249.1|1059351_1059795_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46250.1|1059774_1060293_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
AVS46251.1|1060420_1061056_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46252.1|1061128_1062169_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46253.1|1062290_1062866_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVS46254.1|1062875_1063466_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AVS46255.1|1063485_1063881_-	YraN family protein	NA	NA	NA	NA	NA
AVS46256.1|1063838_1065875_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVS46257.1|1065939_1066803_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 78
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1084426	1085572	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS46275.1|1084426_1085572_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.4e-50
>prophage 79
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1093392	1095687	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
AVS46282.1|1093392_1095687_+	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 80
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1116480	1117446	5071057		Escherichia_phage(100.0%)	1	NA	NA
AVS46307.1|1116480_1117446_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.8	4.0e-36
>prophage 81
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1130246	1138416	5071057	tRNA	Herpes_simplex_virus(33.33%)	7	NA	NA
AVS46317.1|1130246_1133339_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.8	1.0e-157
AVS46318.1|1133522_1134506_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AVS46319.1|1134435_1134618_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46320.1|1134724_1135057_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AVS49934.1|1135098_1136478_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.0e-32
AVS49935.1|1136413_1136620_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46321.1|1136895_1138416_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
>prophage 82
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1144427	1157673	5071057	capsid,head,terminase,tRNA	Morganella_phage(16.67%)	17	NA	NA
AVS46330.1|1144427_1146551_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.6	3.1e-174
AVS46331.1|1146929_1147172_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46332.1|1147168_1147591_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVS46333.1|1147808_1148849_+|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	6.7e-66
AVS46334.1|1148858_1149200_+|head	head decoration protein	head	NA	NA	NA	NA
AVS46335.1|1149211_1149595_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVS46336.1|1149587_1149797_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46337.1|1149796_1150339_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.1	2.2e-36
AVS46338.1|1150412_1150694_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46339.1|1150818_1151013_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46340.1|1151729_1152236_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AVS46341.1|1152314_1154156_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AVS46342.1|1154214_1154337_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVS46343.1|1154350_1156096_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AVS46344.1|1156206_1156422_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVS46345.1|1156420_1156651_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46346.1|1156659_1157673_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 83
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1163975	1165214	5071057		Sinorhizobium_phage(100.0%)	1	NA	NA
AVS46353.1|1163975_1165214_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 84
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1170351	1171785	5071057		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS46357.1|1170351_1171785_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 85
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1176072	1176726	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS46363.1|1176072_1176726_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 86
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1182618	1194084	5071057		Ralstonia_phage(20.0%)	11	NA	NA
AVS46370.1|1182618_1183779_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.4	2.0e-87
AVS46371.1|1183784_1184456_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AVS46372.1|1184343_1184604_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46373.1|1184603_1186085_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AVS46374.1|1186289_1186919_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AVS46375.1|1186919_1187342_+	dehydrogenase	NA	NA	NA	NA	NA
AVS46376.1|1187366_1188194_+	phosphodiesterase	NA	NA	NA	NA	NA
AVS46377.1|1188193_1188775_+	esterase YqiA	NA	NA	NA	NA	NA
AVS46378.1|1188803_1190696_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
AVS46379.1|1190759_1192901_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AVS46380.1|1193274_1194084_+	cobalamin/Fe(3+)-siderophore ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	2.3e-13
>prophage 87
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1201190	1213321	5071057		Stx_converting_phage(25.0%)	10	NA	NA
AVS46388.1|1201190_1201583_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
AVS46389.1|1201635_1202118_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS46390.1|1202226_1203834_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS46391.1|1203971_1206230_+	DNA topoisomerase 4 subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
AVS46392.1|1206463_1207201_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AVS46393.1|1207275_1208688_+	cell division protein FtsP	NA	NA	NA	NA	NA
AVS46394.1|1208798_1211018_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.3e-103
AVS46395.1|1211059_1211317_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46396.1|1211367_1212294_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46397.1|1212493_1213321_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	2.8e-62
>prophage 88
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1219875	1220760	5071057		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AVS46406.1|1219875_1220760_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.5	3.4e-66
>prophage 89
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1242920	1244093	5071057		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
AVS46431.1|1242920_1244093_-	aminotransferase class V-fold PLP-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 90
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1276751	1277417	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS46456.1|1276751_1277417_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.6e-07
>prophage 91
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1294373	1295393	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
AVS46466.1|1294373_1295393_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 92
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1300575	1303410	5071057		Pseudomonas_phage(50.0%)	5	NA	NA
AVS46471.1|1300575_1301220_-	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	34.1	4.1e-29
AVS46472.1|1301233_1301455_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AVS49941.1|1301523_1301970_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46473.1|1302014_1302500_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	8.1e-14
AVS46474.1|1302591_1303410_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	3.6e-46
>prophage 93
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1314472	1329509	5071057	transposase	Escherichia_phage(28.57%)	10	NA	NA
AVS46484.1|1314472_1315686_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
AVS46485.1|1315833_1316616_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
AVS46486.1|1316612_1317635_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
AVS46487.1|1317648_1317789_-	chemotaxis protein	NA	NA	NA	NA	NA
AVS46488.1|1318489_1320547_+	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	33.4	4.9e-36
AVS46489.1|1320539_1321826_+	restriction endonuclease	NA	NA	NA	NA	NA
AVS46490.1|1322511_1325508_+	adenine methyltransferase	NA	A0A2R2ZGH5	Clostridioides_phage	23.4	3.8e-21
AVS46491.1|1325577_1327203_-	SAM-dependent methyltransferase	NA	A0A2I6UHU5	Bacillus_phage	27.7	2.5e-14
AVS46492.1|1327192_1327381_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46493.1|1328243_1329509_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	43.1	1.8e-81
>prophage 94
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1355318	1356473	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS46523.1|1355318_1356473_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 95
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1365008	1365953	5071057		Yersinia_phage(100.0%)	1	NA	NA
AVS46534.1|1365008_1365953_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	1.2e-53
>prophage 96
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1387125	1388358	5071057		Catovirus(100.0%)	1	NA	NA
AVS46554.1|1387125_1388358_+	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 97
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1397205	1401682	5071057		Prochlorococcus_phage(50.0%)	2	NA	NA
AVS46566.1|1397205_1400079_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	6.3e-263
AVS46567.1|1400242_1401682_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 98
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1405481	1421584	5071057	tRNA,transposase	Brevibacillus_phage(14.29%)	15	NA	NA
AVS46574.1|1405481_1406378_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.9e-30
AVS46575.1|1406402_1407113_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVS46576.1|1407118_1408852_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
AVS46577.1|1408942_1410040_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVS46578.1|1410050_1411568_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AVS46579.1|1411707_1412217_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS46580.1|1412321_1412870_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVS46581.1|1412992_1413118_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46582.1|1413119_1414568_-	uric acid transporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
AVS46583.1|1414614_1414701_-	purine permease YgfU	NA	NA	NA	NA	NA
AVS46584.1|1415003_1416923_+	oxidoreductase (Fe-S)-binding subunit	NA	NA	NA	NA	NA
AVS46585.1|1416922_1417411_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVS46586.1|1417446_1418814_-	permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
AVS46587.1|1418849_1420169_-	guanine deaminase	NA	NA	NA	NA	NA
AVS46588.1|1420183_1421584_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 99
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1445864	1446617	5071057		Clostridium_phage(100.0%)	1	NA	NA
AVS46605.1|1445864_1446617_+	hypothetical protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 100
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1478346	1480841	5071057		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVS46636.1|1478346_1479108_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
AVS49951.1|1479422_1480841_+	arabinose-proton symporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 101
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1490472	1497245	5071057		Moraxella_phage(33.33%)	6	NA	NA
AVS46645.1|1490472_1491186_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
AVS46646.1|1491254_1491944_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVS46647.1|1492628_1493159_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVS46648.1|1493171_1495418_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.7	1.0e-10
AVS46649.1|1495568_1496444_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVS46650.1|1496450_1497245_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 102
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1502722	1517997	5071057	protease,tRNA	Klosneuvirus(16.67%)	9	NA	NA
AVS46656.1|1502722_1505611_+|protease	protease 3	protease	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
AVS46657.1|1505603_1509146_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
AVS46658.1|1509145_1510972_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
AVS46659.1|1511033_1512365_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AVS46660.1|1512596_1513850_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AVS46661.1|1514318_1515416_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVS46662.1|1515491_1516298_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-16
AVS46663.1|1516348_1516792_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVS46664.1|1516791_1517997_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
>prophage 103
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1529523	1530279	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS46676.1|1529523_1530279_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 104
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1535136	1535985	5071057		Vibrio_phage(100.0%)	1	NA	NA
AVS46680.1|1535136_1535985_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 105
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1543418	1547533	5071057		Hokovirus(50.0%)	2	NA	NA
AVS46688.1|1543418_1546175_-	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
AVS46689.1|1546231_1547533_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	4.4e-38
>prophage 106
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1550929	1555850	5071057		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
AVS46692.1|1550929_1552567_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
AVS46693.1|1552654_1553953_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AVS46694.1|1555178_1555850_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.3e-14
>prophage 107
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1560138	1560924	5071057		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AVS46697.1|1560138_1560924_+	oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 108
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1585206	1587239	5071057		Hokovirus(50.0%)	2	NA	NA
AVS46719.1|1585206_1586634_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
AVS46720.1|1586633_1587239_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 109
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1590351	1600372	5071057		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
AVS46726.1|1590351_1591113_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
AVS46727.1|1591106_1591733_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AVS46728.1|1591872_1593012_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AVS46729.1|1593074_1594067_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVS46730.1|1594186_1594594_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS46731.1|1594740_1595334_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AVS46732.1|1595333_1596761_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AVS46733.1|1596771_1597008_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46734.1|1597048_1597705_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
AVS46735.1|1597810_1600372_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	6.6e-30
>prophage 110
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1619480	1620491	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
AVS49955.1|1619480_1620491_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 111
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1627904	1628870	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
AVS46759.1|1627904_1628870_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 112
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1634336	1640433	5071057	tRNA,transposase	Pseudomonas_phage(25.0%)	7	NA	NA
AVS46766.1|1634336_1634834_+	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
AVS46767.1|1634913_1635975_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AVS49957.1|1636004_1636208_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46768.1|1636113_1636623_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS46769.1|1636754_1637255_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVS46770.1|1637382_1640013_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AVS46771.1|1640247_1640433_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 113
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1654081	1659379	5071057		Bacillus_virus(20.0%)	6	NA	NA
AVS46785.1|1654081_1655284_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
AVS46786.1|1655273_1655522_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46787.1|1655640_1656600_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.3e-132
AVS46788.1|1656609_1658754_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.2e-195
AVS46789.1|1658726_1659137_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AVS46790.1|1659133_1659379_-	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 114
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1665185	1669237	5071057		Clostridium_phage(50.0%)	4	NA	NA
AVS46800.1|1665185_1665635_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
AVS46801.1|1665635_1666298_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS46802.1|1666318_1667719_-	GABA permease	NA	NA	NA	NA	NA
AVS46803.1|1667956_1669237_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
>prophage 115
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1678794	1679004	5071057		Salmonella_phage(100.0%)	1	NA	NA
AVS46808.1|1678794_1679004_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	74.5	2.0e-09
>prophage 116
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1684654	1685137	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS46809.1|1684654_1685137_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 117
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1694693	1764218	5071057	holin,capsid,plate,tRNA,tail,terminase,transposase,integrase,portal	Enterobacteria_phage(79.59%)	80	1690899:1690915	1767739:1767755
1690899:1690915	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
AVS46819.1|1694693_1695461_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AVS46820.1|1695502_1695850_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AVS46821.1|1695925_1696408_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46822.1|1696850_1697117_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46823.1|1697022_1697532_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS46824.1|1698350_1698869_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVS46825.1|1699018_1699384_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AVS46826.1|1699593_1700664_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	5.3e-90
AVS46827.1|1700674_1701796_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AVS46828.1|1701838_1702999_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AVS49962.1|1703098_1703146_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46829.1|1703313_1704303_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
AVS46830.1|1704369_1704672_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
AVS46831.1|1704767_1705094_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46832.1|1705112_1705454_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
AVS46833.1|1705464_1705743_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	8.1e-35
AVS46834.1|1705754_1705997_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AVS46835.1|1706633_1706837_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AVS46836.1|1706833_1707100_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AVS46837.1|1707096_1707396_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AVS46838.1|1707446_1707662_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46839.1|1707718_1707949_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	88.2	1.0e-27
AVS46840.1|1708021_1708387_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	5.1e-61
AVS49963.1|1708531_1711222_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	97.2	0.0e+00
AVS46841.1|1711298_1712258_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	7.6e-181
AVS46842.1|1712262_1712574_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	93.2	6.1e-47
AVS46843.1|1712637_1713237_+	hypothetical protein	NA	K7P881	Enterobacteria_phage	63.6	9.0e-31
AVS46844.1|1713233_1713773_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	59.3	2.8e-23
AVS46845.1|1714339_1714864_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46846.1|1714879_1715926_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AVS46847.1|1715925_1717677_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
AVS46848.1|1717831_1718668_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	1.0e-149
AVS46849.1|1718691_1719744_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	3.3e-193
AVS46850.1|1719789_1720590_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
AVS46851.1|1720693_1721188_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.6	5.1e-88
AVS46852.1|1721187_1721388_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AVS46853.1|1721390_1721714_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AVS46854.1|1721710_1722103_+	M15 family peptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AVS46855.1|1722099_1722507_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.6e-63
AVS46856.1|1722644_1723112_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AVS46857.1|1723104_1723740_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
AVS46858.1|1723736_1724318_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	6.1e-101
AVS46859.1|1724314_1724665_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	6.6e-58
AVS46860.1|1724668_1725565_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	4.3e-154
AVS46861.1|1725557_1726085_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	88.3	2.1e-84
AVS46862.1|1726095_1728753_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.3	4.6e-284
AVS46863.1|1728752_1729370_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.3e-85
AVS49964.1|1729333_1729879_-	transferase	NA	NA	NA	NA	NA
AVS46864.1|1730067_1730562_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.1e-85
AVS46865.1|1730568_1733376_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
AVS46866.1|1733362_1733599_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AVS46867.1|1733526_1733892_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	84.3	5.5e-47
AVS46868.1|1733946_1734459_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
AVS46869.1|1734458_1735643_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	1.3e-222
AVS46870.1|1735800_1736910_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.7	7.9e-198
AVS46871.1|1736952_1737213_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46872.1|1737404_1737545_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
AVS46873.1|1737794_1737992_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVS46874.1|1737936_1738743_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.2e-65
AVS46875.1|1738893_1739235_-	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AVS46876.1|1739269_1739473_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46877.1|1739502_1740240_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AVS46878.1|1740374_1741355_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AVS46879.1|1741351_1742083_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AVS46880.1|1742212_1744786_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AVS46881.1|1750580_1750694_+	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
AVS46882.1|1750675_1751974_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
AVS46883.1|1751970_1752294_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46884.1|1752339_1753695_-	phosphatidylserine synthase	NA	NA	NA	NA	NA
AVS46885.1|1753808_1756469_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AVS49965.1|1756500_1757199_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AVS46886.1|1757267_1757687_-	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AVS46887.1|1757700_1757904_+	hypothetical protein	NA	NA	NA	NA	NA
AVS46888.1|1757893_1758931_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVS46889.1|1758978_1759668_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
AVS46890.1|1759972_1760356_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AVS46891.1|1760410_1760998_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AVS49966.1|1761100_1761982_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS46892.1|1762014_1763349_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AVS46893.1|1763480_1764218_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
1767739:1767755	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
>prophage 118
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1769120	1772863	5071057		Tupanvirus(50.0%)	4	NA	NA
AVS46899.1|1769120_1770920_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
AVS46900.1|1770935_1771910_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVS46901.1|1771960_1772239_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46902.1|1772182_1772863_+	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 119
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1776322	1776583	5071057		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS46909.1|1776322_1776583_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 120
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1780702	1792010	5071057		Bacillus_phage(50.0%)	7	NA	NA
AVS46915.1|1780702_1784590_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	5.9e-131
AVS46916.1|1785165_1786593_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	2.0e-15
AVS49967.1|1786757_1787471_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVS46917.1|1787460_1788795_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AVS46918.1|1788855_1789194_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVS46919.1|1789238_1790429_-	flavohemoprotein	NA	NA	NA	NA	NA
AVS46920.1|1790756_1792010_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
>prophage 121
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1797775	1799287	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS46923.1|1797775_1799287_+	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 122
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1814422	1820946	5071057		Faustovirus(20.0%)	8	NA	NA
AVS46938.1|1814422_1815637_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AVS46939.1|1815664_1816051_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AVS46940.1|1816067_1816391_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AVS46941.1|1816486_1817002_+	co-chaperone HscB	NA	NA	NA	NA	NA
AVS46942.1|1817018_1818869_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
AVS46943.1|1818870_1819206_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVS46944.1|1819217_1819418_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVS46945.1|1819662_1820946_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 123
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1830833	1831265	5071057		Powai_lake_megavirus(100.0%)	1	NA	NA
AVS46950.1|1830833_1831265_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 124
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1851733	1858224	5071057		Escherichia_phage(66.67%)	7	NA	NA
AVS46962.1|1851733_1853110_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
AVS46963.1|1853271_1854738_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
AVS46964.1|1854806_1856384_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AVS46965.1|1856478_1857018_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
AVS46966.1|1857033_1857552_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AVS46967.1|1857862_1858054_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AVS46968.1|1858071_1858224_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 125
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1864471	1868473	5071057		Prochlorococcus_phage(33.33%)	5	NA	NA
AVS46972.1|1864471_1865110_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
AVS46973.1|1865109_1866147_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AVS46974.1|1866165_1866348_-	hypothetical protein	NA	NA	NA	NA	NA
AVS46975.1|1866471_1867098_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS46976.1|1867183_1868473_+	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 126
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1889740	1890454	5071057		Synechococcus_phage(100.0%)	1	NA	NA
AVS46997.1|1889740_1890454_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 127
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1907721	1908672	5071057		Cyanophage(100.0%)	1	NA	NA
AVS47010.1|1907721_1908672_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 128
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1927278	1931564	5071057	transposase	Deep-sea_thermophilic_phage(50.0%)	8	NA	NA
AVS47027.1|1927278_1928148_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
AVS47028.1|1928361_1928787_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVS47029.1|1928773_1928926_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47030.1|1928874_1929222_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVS47031.1|1929282_1929858_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVS47032.1|1929899_1930127_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47033.1|1930032_1930542_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS47034.1|1930664_1931564_+	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 129
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1935217	1950599	5071057		Streptococcus_phage(33.33%)	15	NA	NA
AVS47038.1|1935217_1936009_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AVS47039.1|1936179_1937196_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS47040.1|1937195_1938029_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AVS47041.1|1938028_1938904_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AVS47042.1|1938893_1939991_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AVS47043.1|1940124_1941036_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	7.7e-58
AVS47044.1|1941038_1941407_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47045.1|1941511_1942363_+	bifunctional pyridoxal kinase/hydroxymethylpyrimidine kinase	NA	NA	NA	NA	NA
AVS47046.1|1942404_1942914_-	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AVS47047.1|1942954_1944682_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AVS47048.1|1944726_1944984_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVS47049.1|1945367_1946339_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AVS47050.1|1946523_1947285_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVS47051.1|1947514_1948513_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVS47052.1|1948583_1950599_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
>prophage 130
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1959895	1961104	5071057	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVS47062.1|1959895_1961104_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	93.3	7.0e-208
>prophage 131
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1967666	1969015	5071057	transposase	Bacillus_phage(100.0%)	1	NA	NA
AVS47068.1|1967666_1969015_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	3.3e-73
>prophage 132
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1979318	1980053	5071057		Clostridioides_phage(100.0%)	1	NA	NA
AVS47078.1|1979318_1980053_-	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	4.7e-13
>prophage 133
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1983871	1984792	5071057		Morganella_phage(100.0%)	1	NA	NA
AVS47081.1|1983871_1984792_-	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 134
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1988483	1996059	5071057		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AVS47086.1|1988483_1990178_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
AVS47087.1|1990246_1991191_+	transporter YfdV	NA	NA	NA	NA	NA
AVS47088.1|1991264_1992410_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AVS47089.1|1992465_1996059_-	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	29.3	1.0e-36
>prophage 135
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2002712	2004146	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS47094.1|2002712_2004146_-	glycosyl hydrolase family 32	NA	F8WPR5	Bacillus_phage	25.0	7.0e-29
>prophage 136
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2007185	2008118	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
AVS47098.1|2007185_2008118_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 137
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2024500	2032585	5071057	transposase	Bacillus_phage(66.67%)	9	NA	NA
AVS47115.1|2024500_2025848_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	3.3e-73
AVS47116.1|2025914_2026466_-	endonuclease SmrB	NA	NA	NA	NA	NA
AVS47117.1|2026631_2027564_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS47118.1|2027598_2028684_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AVS47119.1|2028687_2029512_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVS47120.1|2029511_2030321_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47121.1|2030320_2030869_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVS47122.1|2030902_2031181_+	YfcL family protein	NA	NA	NA	NA	NA
AVS47123.1|2031236_2032585_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.0e-74
>prophage 138
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2038601	2039738	5071057		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS47128.1|2038601_2039738_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	2.2e-22
>prophage 139
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2046202	2047720	5071057		Mollivirus(100.0%)	1	NA	NA
AVS47136.1|2046202_2047720_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 140
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2051931	2053780	5071057	transposase	Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
AVS47142.1|2051931_2052705_+	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AVS47143.1|2052877_2053780_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 141
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2064339	2067567	5071057		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVS47155.1|2064339_2064990_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
AVS47156.1|2065076_2066909_+	SLC13 family permease	NA	NA	NA	NA	NA
AVS47157.1|2066967_2067567_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 142
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2102387	2107391	5071057		Tupanvirus(50.0%)	4	NA	NA
AVS47188.1|2102387_2104370_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
AVS47189.1|2104369_2105338_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
AVS49977.1|2105341_2106481_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	30.1	9.4e-29
AVS47190.1|2106788_2107391_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 143
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2110994	2115552	5071057		Oenococcus_phage(50.0%)	5	NA	NA
AVS49978.1|2110994_2112200_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	9.3e-27
AVS47195.1|2112256_2113546_+	MFS transporter	NA	NA	NA	NA	NA
AVS47196.1|2113562_2114366_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AVS47197.1|2114406_2114580_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47198.1|2114592_2115552_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.8	2.1e-69
>prophage 144
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2121444	2122521	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS47203.1|2121444_2122521_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 145
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2125566	2138162	5071057		Pseudomonas_phage(40.0%)	6	NA	NA
AVS47207.1|2125566_2125821_-	2Fe-2S ferredoxin	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
AVS49979.1|2125820_2126951_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
AVS47208.1|2127865_2130151_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
AVS47209.1|2130846_2134605_+	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	26.3	5.0e-18
AVS47210.1|2134665_2135388_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AVS47211.1|2135534_2138162_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 146
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2153084	2157927	5071057		Bacillus_phage(50.0%)	2	NA	NA
AVS47221.1|2153084_2154911_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
AVS47222.1|2155077_2157927_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.5	8.4e-42
>prophage 147
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2162090	2167892	5071057		Enterobacteria_phage(25.0%)	5	NA	NA
AVS47227.1|2162090_2163218_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.2	1.6e-116
AVS47228.1|2163329_2164385_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVS47229.1|2164458_2165523_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	39.1	1.8e-18
AVS47230.1|2165522_2166173_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
AVS47231.1|2166248_2167892_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	25.0	1.2e-13
>prophage 148
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2176622	2177246	5071057		Bacillus_virus(100.0%)	1	NA	NA
AVS47242.1|2176622_2177246_+	heme ABC transporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.0e-12
>prophage 149
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2188944	2196593	5071057		Vibrio_phage(50.0%)	7	NA	NA
AVS47255.1|2188944_2189952_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	9.1e-84
AVS47256.1|2190090_2190375_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVS47257.1|2190499_2192260_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
AVS47258.1|2192409_2193105_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVS47259.1|2193132_2194323_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.7	1.7e-20
AVS47260.1|2194655_2195000_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47261.1|2195003_2196593_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 150
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2202347	2206648	5071057		Clostridioides_phage(50.0%)	4	NA	NA
AVS47266.1|2202347_2202914_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
AVS47267.1|2203325_2204039_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47268.1|2204077_2205064_-	GTP-binding protein	NA	NA	NA	NA	NA
AVS47269.1|2205181_2206648_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
>prophage 151
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2221141	2221999	5071057		Hokovirus(100.0%)	1	NA	NA
AVS47281.1|2221141_2221999_-	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	34.3	1.4e-24
>prophage 152
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2226068	2229841	5071057	tRNA	Acinetobacter_phage(50.0%)	5	NA	NA
AVS47286.1|2226068_2228048_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
AVS47287.1|2228078_2228915_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AVS47288.1|2228842_2229019_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47289.1|2229075_2229189_+|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AVS47290.1|2229172_2229841_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 153
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2233535	2235056	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS47295.1|2233535_2235056_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 154
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2255182	2264625	5071057		Enterobacteria_phage(85.71%)	10	NA	NA
AVS47314.1|2255182_2256109_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
AVS47315.1|2256113_2256845_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS47316.1|2256825_2256933_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47317.1|2256992_2257724_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AVS47318.1|2257945_2259631_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AVS47319.1|2259627_2260347_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS47320.1|2260393_2260864_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AVS47321.1|2260905_2261367_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AVS47322.1|2261491_2263492_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
AVS47323.1|2263488_2264625_-	hypothetical protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 155
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2276481	2278515	5071057	tRNA	Indivirus(100.0%)	1	NA	NA
AVS47328.1|2276481_2278515_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 156
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2289168	2292725	5071057		Paenibacillus_phage(50.0%)	4	NA	NA
AVS47341.1|2289168_2289987_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	39.4	2.9e-24
AVS47342.1|2290038_2290785_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS47343.1|2290758_2291724_-	sugar kinase	NA	NA	NA	NA	NA
AVS47344.1|2291720_2292725_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	8.9e-15
>prophage 157
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2301865	2307970	5071057		Bacillus_phage(50.0%)	7	NA	NA
AVS47354.1|2301865_2302765_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
AVS49981.1|2303179_2303497_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47355.1|2303484_2303664_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47356.1|2303826_2305188_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	2.5e-217
AVS47357.1|2305335_2305668_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AVS47358.1|2305847_2306570_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AVS47359.1|2306566_2307970_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 158
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2321411	2322764	5071057		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS47367.1|2321411_2322764_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	6.0e-06
>prophage 159
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2327427	2337837	5071057		Catovirus(20.0%)	8	NA	NA
AVS47370.1|2327427_2328069_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
AVS47371.1|2328160_2328742_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
AVS47372.1|2328763_2330617_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVS47373.1|2330909_2332493_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AVS47374.1|2333151_2334291_+	lipoprotein	NA	NA	NA	NA	NA
AVS47375.1|2334296_2334740_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
AVS47376.1|2334742_2336905_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
AVS47377.1|2336997_2337837_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	7.5e-07
>prophage 160
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2342081	2348875	5071057		Synechococcus_phage(25.0%)	6	NA	NA
AVS47383.1|2342081_2343203_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.2e-132
AVS47384.1|2343205_2344171_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	4.9e-87
AVS47385.1|2344173_2344653_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVS47386.1|2344649_2345873_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVS47387.1|2345875_2347312_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.4	8.8e-48
AVS47388.1|2347504_2348875_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 161
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2354383	2363094	5071057		Enterobacteria_phage(42.86%)	9	NA	NA
AVS47393.1|2354383_2355778_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.4e-18
AVS47394.1|2355952_2356846_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
AVS47395.1|2356881_2357145_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47396.1|2357216_2358302_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.9e-101
AVS47397.1|2358301_2359201_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.7e-28
AVS47398.1|2359258_2360137_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	8.7e-107
AVS47399.1|2360141_2360675_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.3	1.5e-56
AVS47400.1|2360659_2361949_+	flippase	NA	NA	NA	NA	NA
AVS47401.1|2361960_2363094_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.7	3.4e-31
>prophage 162
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2366387	2371298	5071057	transposase	Indivirus(33.33%)	5	NA	NA
AVS47405.1|2366387_2367533_+	glycosyltransferase family 1 protein	NA	A0A1V0SD18	Indivirus	28.8	1.9e-08
AVS47406.1|2367767_2369174_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
AVS47407.1|2369192_2369414_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47408.1|2369319_2369829_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS47409.1|2370131_2371298_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.7e-110
>prophage 163
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2378651	2379551	5071057		Cellulophaga_phage(100.0%)	1	NA	NA
AVS47419.1|2378651_2379551_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 164
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2384201	2427940	5071057	holin,lysis,terminase,head,transposase,integrase,portal,coat	Enterobacteria_phage(47.37%)	63	2376551:2376566	2434921:2434936
2376551:2376566	attL	CATGGCGACGATCCCC	NA	NA	NA	NA
AVS47425.1|2384201_2384711_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS47426.1|2384823_2386248_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AVS47427.1|2386429_2387608_+|integrase	integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.2	2.0e-231
AVS47428.1|2387588_2387780_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	98.4	2.9e-31
AVS49987.1|2387861_2388206_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
AVS47429.1|2388306_2388486_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	98.3	5.6e-29
AVS47430.1|2388998_2389367_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	97.5	6.1e-62
AVS47431.1|2389363_2389531_-	DUF2737 domain-containing protein	NA	K7PJV9	Enterobacteria_phage	100.0	1.0e-24
AVS47432.1|2389541_2389835_-	RecBCD nuclease inhibitor	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
AVS47433.1|2389858_2390446_-	DUF669 domain-containing protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
AVS47434.1|2390442_2391123_-	ATP-binding protein	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
AVS47435.1|2391131_2391320_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
AVS47436.1|2391316_2391556_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	92.4	3.5e-34
AVS47437.1|2391635_2392004_-	DUF2528 domain-containing protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
AVS47438.1|2392154_2392625_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
AVS47439.1|2392825_2393320_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
AVS49988.1|2393350_2393713_-	antitermination N domain protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
AVS47440.1|2393757_2393988_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.4	2.0e-31
AVS47441.1|2394432_2395185_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
AVS47442.1|2395181_2395739_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47443.1|2395829_2396534_-	XRE family transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
AVS47444.1|2396647_2396881_+	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
AVS47445.1|2397019_2397319_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	94.9	4.5e-47
AVS47446.1|2397351_2398251_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.9e-173
AVS47447.1|2398247_2398949_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
AVS47448.1|2398945_2399236_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
AVS47449.1|2399308_2399515_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.2e-30
AVS47450.1|2399527_2399854_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
AVS47451.1|2399850_2400051_+	hypothetical protein	NA	Q716C9	Shigella_phage	98.5	3.9e-31
AVS47452.1|2400062_2400419_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	7.9e-59
AVS47453.1|2400390_2400801_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
AVS47454.1|2400797_2400974_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	7.9e-28
AVS47455.1|2401253_2401937_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	84.6	2.6e-111
AVS47456.1|2402011_2402734_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	98.3	3.3e-128
AVS47457.1|2402733_2403339_+	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	98.5	3.3e-97
AVS47458.1|2403335_2403542_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
AVS47459.1|2403519_2404185_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	98.6	6.5e-131
AVS47460.1|2404181_2404805_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.2e-113
AVS47461.1|2405473_2405797_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AVS47462.1|2405780_2406257_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
AVS47463.1|2406253_2406691_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.9	6.5e-71
AVS47464.1|2406840_2407323_+	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	94.7	1.8e-77
AVS47465.1|2407225_2407453_+	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.6e-25
AVS47466.1|2407455_2407896_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	99.3	7.7e-80
AVS47467.1|2407892_2409308_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.2	2.2e-277
AVS47468.1|2409309_2411508_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
AVS47469.1|2411598_2412492_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	87.2	5.3e-120
AVS47470.1|2412510_2413764_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	100.0	2.6e-237
AVS47471.1|2413805_2413994_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	96.8	9.4e-27
AVS47472.1|2413974_2414436_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AVS47473.1|2414445_2415864_+	hypothetical protein	NA	A5VW69	Enterobacteria_phage	99.6	1.6e-275
AVS47474.1|2415863_2416817_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.2	7.7e-93
AVS47475.1|2416816_2417272_+	hypothetical protein	NA	A5VW67	Enterobacteria_phage	98.7	4.4e-86
AVS47476.1|2417274_2417967_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	99.1	9.5e-117
AVS47477.1|2417977_2419390_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	69.6	1.7e-165
AVS47478.1|2419386_2421219_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.0	1.3e-290
AVS49989.1|2421236_2421425_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47479.1|2421581_2422550_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
AVS47480.1|2422565_2422805_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.7	8.6e-17
AVS47481.1|2422893_2423067_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVS47482.1|2423129_2424008_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	3.2e-93
AVS47483.1|2426298_2426430_+	umuD domain protein	NA	O64339	Escherichia_phage	66.7	4.7e-09
AVS47484.1|2426773_2427940_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	2.5e-226
2434921:2434936	attR	CATGGCGACGATCCCC	NA	NA	NA	NA
>prophage 165
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2445429	2446239	5071057		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVS47506.1|2445429_2446239_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.7	4.1e-10
>prophage 166
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2460438	2465671	5071057		Vibrio_phage(50.0%)	3	NA	NA
AVS47519.1|2460438_2460627_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.1	2.1e-10
AVS47520.1|2460623_2461085_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47521.1|2461606_2465671_+	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.1	1.8e-21
>prophage 167
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2482212	2553900	5071057	holin,capsid,tail,terminase,head,transposase,integrase	Enterobacteria_phage(41.18%)	82	2478810:2478825	2495038:2495053
2478810:2478825	attL	TGATATTCACCACGGC	NA	NA	NA	NA
AVS47528.1|2482212_2483238_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
AVS47529.1|2483237_2483441_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVS47530.1|2483499_2485977_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
AVS47531.1|2486069_2486261_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVS47532.1|2486263_2486446_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AVS47533.1|2487007_2487283_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47534.1|2487251_2487581_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47535.1|2487603_2487822_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47536.1|2487851_2487980_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47537.1|2487981_2488137_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
AVS47538.1|2488339_2488747_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
AVS47539.1|2488823_2489051_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS47540.1|2489034_2489586_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47541.1|2490386_2491052_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AVS49992.1|2491084_2491846_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.9	1.8e-116
AVS49991.1|2493402_2493615_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47542.1|2493979_2494753_-	iroE	NA	NA	NA	NA	NA
AVS47543.1|2495399_2495612_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	8.6e-29
2495038:2495053	attR	TGATATTCACCACGGC	NA	NA	NA	NA
AVS47544.1|2495828_2496080_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47545.1|2496146_2496425_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47546.1|2497488_2497854_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
AVS47547.1|2497862_2498405_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	72.3	1.6e-71
AVS47548.1|2498636_2498834_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
AVS47549.1|2498984_2500034_+	DNA adenine methylase	NA	Q8W637	Enterobacteria_phage	92.2	4.7e-192
AVS47550.1|2500507_2500933_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	86.5	3.8e-60
AVS47551.1|2500929_2501082_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AVS47552.1|2501170_2501563_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
AVS49993.1|2501552_2501828_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
AVS47553.1|2501830_2502208_+	M15 family peptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	1.5e-63
AVS49994.1|2502340_2502454_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
AVS47554.1|2502812_2503205_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
AVS47555.1|2503364_2503550_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47556.1|2503789_2504335_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	2.1e-79
AVS47557.1|2504309_2506235_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
AVS47558.1|2506231_2506438_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVS47559.1|2508117_2509689_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AVS47560.1|2509708_2510056_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS47561.1|2510055_2510733_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS47562.1|2511413_2512091_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS47563.1|2512090_2512438_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS47564.1|2512457_2514029_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AVS47565.1|2514771_2515104_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
AVS47566.1|2515159_2516185_+|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.7e-183
AVS47567.1|2516226_2516622_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	92.4	4.8e-57
AVS47568.1|2516633_2516987_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
AVS47569.1|2516998_2517577_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	8.6e-79
AVS47570.1|2517573_2517969_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
AVS49995.1|2517976_2518717_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	6.1e-130
AVS47571.1|2518732_2519155_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVS47572.1|2519136_2519571_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
AVS47573.1|2523297_2523897_+	endopeptidase	NA	K7PLW1	Enterobacteria_phage	97.0	1.3e-117
AVS47574.1|2523794_2524436_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.7e-96
AVS47575.1|2528044_2528644_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	5.7e-102
AVS47576.1|2528665_2528884_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47577.1|2528789_2529299_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS47578.1|2529419_2531795_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	2.0e-169
AVS47579.1|2531794_2532076_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	52.2	3.7e-19
AVS47580.1|2532085_2532787_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	4.1e-59
AVS47581.1|2532800_2533091_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47582.1|2533590_2534304_+	toxin	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
AVS47583.1|2534300_2535122_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
AVS47584.1|2535118_2535691_+	toxin	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
AVS47585.1|2536396_2536726_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47586.1|2536761_2537412_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
AVS47587.1|2537672_2539020_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	1.5e-73
AVS47588.1|2539104_2539740_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AVS47589.1|2539740_2540745_-	sulfoxide reductase	NA	NA	NA	NA	NA
AVS47590.1|2540853_2541267_-	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AVS49996.1|2541399_2542071_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AVS47591.1|2542070_2543429_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AVS47592.1|2543535_2544387_-	protein deglycase HchA	NA	NA	NA	NA	NA
AVS47593.1|2544547_2544898_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47594.1|2544978_2546172_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.0	6.5e-105
AVS47595.1|2546459_2546645_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47596.1|2546737_2547103_+	permease	NA	NA	NA	NA	NA
AVS47597.1|2547142_2547838_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AVS47598.1|2547904_2549323_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
AVS47599.1|2549303_2549774_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	3.1e-34
AVS47600.1|2549762_2550683_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVS47601.1|2550855_2551773_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVS47602.1|2551851_2552034_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVS47603.1|2552262_2553900_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 168
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2567443	2570383	5071057	integrase	Salmonella_phage(50.0%)	5	2565406:2565420	2576863:2576877
2565406:2565420	attL	TTCACGGATACGCTG	NA	NA	NA	NA
AVS47621.1|2567443_2567722_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	53.2	2.5e-07
AVS47622.1|2567872_2568676_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AVS47623.1|2568771_2568987_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AVS47624.1|2569124_2569604_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVS47625.1|2569714_2570383_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
2576863:2576877	attR	CAGCGTATCCGTGAA	NA	NA	NA	NA
>prophage 169
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2583389	2584142	5071057		Bacillus_virus(100.0%)	1	NA	NA
AVS47640.1|2583389_2584142_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 170
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2596123	2597638	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS47656.1|2596123_2597638_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	1.6e-12
>prophage 171
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2607726	2613370	5071057		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AVS47667.1|2607726_2609388_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AVS47668.1|2609433_2611035_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	1.6e-13
AVS47669.1|2611053_2611914_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AVS47670.1|2611916_2612966_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVS47671.1|2612980_2613370_+	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 172
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2617890	2619624	5071057	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS47676.1|2617890_2619624_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 173
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2626108	2628159	5071057		Synechococcus_phage(50.0%)	3	NA	NA
AVS47682.1|2626108_2626852_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AVS47683.1|2626892_2627288_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47684.1|2627340_2628159_-	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	96.1	1.8e-69
>prophage 174
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2632177	2639242	5071057		Bacillus_virus(50.0%)	9	NA	NA
AVS47689.1|2632177_2632699_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AVS47690.1|2632700_2633303_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49999.1|2633373_2633439_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47691.1|2633577_2634189_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVS47692.1|2634197_2635208_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AVS47693.1|2635355_2636141_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVS47694.1|2636137_2636893_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AVS50000.1|2636971_2637904_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVS47695.1|2637919_2639242_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 175
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2643241	2644717	5071057		Cyanophage(100.0%)	1	NA	NA
AVS47699.1|2643241_2644717_+	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 176
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2650670	2659715	5071057	transposase	Escherichia_phage(40.0%)	12	NA	NA
AVS47706.1|2650670_2651840_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	99.7	1.9e-205
AVS47707.1|2651896_2652322_+|transposase	IS200/IS605 family transposase ISEc46	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
AVS47708.1|2652478_2654539_+	oligopeptidase B	NA	NA	NA	NA	NA
AVS47709.1|2654535_2655198_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AVS47710.1|2655221_2655878_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVS47711.1|2655978_2656209_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	63.2	3.5e-15
AVS47712.1|2656347_2656722_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVS47713.1|2656725_2657598_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47714.1|2657610_2657952_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVS47715.1|2658087_2658597_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS47716.1|2658502_2658739_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47717.1|2659058_2659715_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.4e-56
>prophage 177
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2667211	2669260	5071057		Moraxella_phage(100.0%)	1	NA	NA
AVS47723.1|2667211_2669260_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.0e-85
>prophage 178
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2675303	2675513	5071057		Morganella_phage(100.0%)	1	NA	NA
AVS47732.1|2675303_2675513_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 179
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2681153	2682710	5071057		Moraxella_phage(100.0%)	1	NA	NA
AVS47741.1|2681153_2682710_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 180
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2686572	2694677	5071057	tRNA	Pandoravirus(33.33%)	8	NA	NA
AVS47745.1|2686572_2687934_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	33.7	2.0e-41
AVS47746.1|2688007_2688187_+	YoaH family protein	NA	NA	NA	NA	NA
AVS47747.1|2688306_2688666_-	DUF1889 domain-containing protein	NA	NA	NA	NA	NA
AVS50005.1|2689027_2689372_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47748.1|2689503_2691414_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	1.2e-92
AVS47749.1|2691471_2692167_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVS47750.1|2692205_2692787_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47751.1|2692991_2694677_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 181
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2709431	2714008	5071057		Bacillus_phage(100.0%)	3	NA	NA
AVS47768.1|2709431_2710922_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
AVS47769.1|2711102_2712578_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47770.1|2712724_2714008_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 182
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2717326	2718181	5071057		Indivirus(100.0%)	1	NA	NA
AVS47773.1|2717326_2718181_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.0	3.9e-11
>prophage 183
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2726995	2731080	5071057		Staphylococcus_phage(50.0%)	4	NA	NA
AVS47783.1|2726995_2727976_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.6	3.0e-07
AVS47784.1|2728112_2728871_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AVS47785.1|2728987_2730346_+	MFS transporter	NA	NA	NA	NA	NA
AVS47786.1|2730438_2731080_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
>prophage 184
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2736005	2739415	5071057	transposase	Streptococcus_phage(50.0%)	2	NA	NA
AVS47793.1|2736005_2737961_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
AVS47794.1|2738067_2739415_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 185
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2743787	2744441	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS47800.1|2743787_2744441_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.4e-15
>prophage 186
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2751205	2752426	5071057		Klosneuvirus(100.0%)	1	NA	NA
AVS47808.1|2751205_2752426_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 187
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2759902	2760730	5071057		Bacillus_virus(100.0%)	1	NA	NA
AVS47816.1|2759902_2760730_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 188
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2766848	2769110	5071057		Tupanvirus(100.0%)	1	NA	NA
AVS47824.1|2766848_2769110_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 189
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2780399	2799794	5071057	tRNA	Tupanvirus(22.22%)	20	NA	NA
AVS47837.1|2780399_2782328_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AVS47838.1|2782331_2782874_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AVS47839.1|2782970_2783168_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVS47840.1|2783221_2783578_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVS50010.1|2783700_2783745_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVS47841.1|2783883_2784867_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	8.4e-34
AVS47842.1|2784881_2787269_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVS47843.1|2787273_2787573_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVS47844.1|2787673_2788654_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AVS47845.1|2788716_2789268_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVS47846.1|2789267_2790017_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AVS47847.1|2790094_2790559_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
AVS47848.1|2790805_2791519_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AVS47849.1|2791581_2793018_+	YdiU family protein	NA	NA	NA	NA	NA
AVS47850.1|2793021_2793213_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVS47851.1|2793344_2794391_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
AVS47852.1|2794547_2795381_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVS47853.1|2795491_2795659_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47854.1|2795712_2798091_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	1.6e-171
AVS50011.1|2798147_2799794_-	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
>prophage 190
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2818264	2823348	5071057		Lake_Baikal_phage(33.33%)	5	NA	NA
AVS47871.1|2818264_2818633_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
AVS47872.1|2818641_2820129_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AVS47873.1|2820138_2820885_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
AVS47874.1|2820859_2822131_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVS47875.1|2822127_2823348_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	2.2e-92
>prophage 191
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2831638	2833905	5071057		Escherichia_phage(50.0%)	3	NA	NA
AVS50012.1|2831638_2832307_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
AVS47884.1|2832303_2833089_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVS47885.1|2833092_2833905_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 192
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2839410	2848214	5071057		Orpheovirus(20.0%)	10	NA	NA
AVS47890.1|2839410_2840052_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
AVS47891.1|2840091_2841240_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
AVS47892.1|2841530_2842742_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVS47893.1|2842854_2843787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS47894.1|2843783_2844809_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AVS47895.1|2844796_2845021_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47896.1|2845107_2845197_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVS47897.1|2845362_2846532_+	MFS transporter	NA	NA	NA	NA	NA
AVS47898.1|2846677_2847259_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AVS47899.1|2847386_2848214_-	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 193
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2857015	2858514	5071057		Indivirus(50.0%)	2	NA	NA
AVS47907.1|2857015_2857912_+	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
AVS50013.1|2857992_2858514_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 194
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2865425	2866700	5071057	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVS47915.1|2865425_2866700_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 195
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2886482	2888294	5071057		Vaccinia_virus(100.0%)	1	NA	NA
AVS47937.1|2886482_2888294_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 196
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2898189	2899491	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS47944.1|2898189_2899491_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	1.1e-17
>prophage 197
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2909591	2967118	5071057	tail,transposase,holin,portal,protease	Enterobacteria_phage(31.43%)	66	NA	NA
AVS47957.1|2909591_2910413_-|protease	serine protease	protease	NA	NA	NA	NA
AVS47958.1|2910512_2910596_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47959.1|2910688_2911024_-	acid shock protein	NA	NA	NA	NA	NA
AVS47960.1|2911420_2912674_-	MFS transporter	NA	NA	NA	NA	NA
AVS47961.1|2912780_2913674_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS47962.1|2913808_2915029_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AVS47963.1|2915153_2915849_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AVS50016.1|2915801_2917094_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AVS47964.1|2917251_2917866_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
AVS47965.1|2917908_2918763_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AVS47966.1|2918764_2919382_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AVS50017.1|2919392_2921816_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AVS47967.1|2924501_2924807_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVS47968.1|2924914_2925625_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVS47969.1|2925627_2926188_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVS47970.1|2926222_2926564_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVS47971.1|2926698_2927025_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AVS47972.1|2927229_2928444_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AVS47973.1|2928455_2929475_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
AVS47974.1|2929532_2929643_+	transporter	NA	NA	NA	NA	NA
AVS47975.1|2929662_2930958_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	8.7e-156
AVS47976.1|2930977_2931229_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AVS47977.1|2931301_2933773_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AVS47978.1|2933866_2934058_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AVS47979.1|2934054_2934243_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AVS47980.1|2934745_2934946_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50018.1|2934914_2935280_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47981.1|2935291_2935444_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AVS47982.1|2935636_2936095_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	46.2	2.8e-24
AVS47983.1|2936121_2936349_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS47984.1|2936332_2936854_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47985.1|2936780_2937800_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.8	6.2e-56
AVS47986.1|2937802_2938015_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47987.1|2938264_2939821_+	DNA repair protein	NA	NA	NA	NA	NA
AVS47988.1|2939994_2940207_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AVS50019.1|2940435_2940687_+	hypothetical protein	NA	NA	NA	NA	NA
AVS47989.1|2940753_2941032_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AVS47990.1|2941033_2942083_+	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	57.9	5.7e-113
AVS47991.1|2942100_2942478_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
AVS47992.1|2942633_2943158_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
AVS47993.1|2943350_2944310_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AVS47994.1|2944402_2945676_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
AVS47995.1|2946043_2946766_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS47996.1|2946956_2947172_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	6.1e-30
AVS47997.1|2947176_2947728_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
AVS47998.1|2947675_2947936_-	hypothetical protein	NA	NA	NA	NA	NA
AVS47999.1|2948048_2948582_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	7.1e-96
AVS48000.1|2948578_2949076_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AVS48001.1|2949439_2949652_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AVS50020.1|2949662_2949851_+	cold-shock protein	NA	NA	NA	NA	NA
AVS50021.1|2949998_2950154_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50022.1|2950326_2950500_+	protein GnsB	NA	NA	NA	NA	NA
AVS48002.1|2950793_2951000_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AVS48003.1|2951552_2952047_+	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
AVS48004.1|2952046_2954149_+	DNA packaging protein	NA	K7PH40	Enterobacteria_phage	99.4	0.0e+00
AVS48005.1|2954145_2954358_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
AVS48006.1|2954357_2955866_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	2.9e-288
AVS48007.1|2955982_2957196_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
AVS48008.1|2957754_2958354_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	97.0	4.1e-108
AVS50023.1|2958418_2961445_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	4.2e-68
AVS48009.1|2961444_2962020_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	3.2e-102
AVS48010.1|2962117_2962708_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
AVS48011.1|2963026_2963260_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
AVS48012.1|2964045_2965329_+	MFS transporter	NA	NA	NA	NA	NA
AVS48013.1|2965418_2966879_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	5.1e-43
AVS48014.1|2966914_2967118_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.7e-11
>prophage 198
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2972017	2972908	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS48019.1|2972017_2972908_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 199
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2982157	2982541	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS48028.1|2982157_2982541_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 200
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2990759	2991707	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS50025.1|2990759_2991707_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	35.7	1.9e-19
>prophage 201
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2999578	2999842	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS50026.1|2999578_2999842_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	5.7e-06
>prophage 202
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3030063	3036999	5071057		Bacillus_phage(50.0%)	3	NA	NA
AVS48068.1|3030063_3031749_+	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
AVS48069.1|3031786_3034159_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AVS48070.1|3034203_3036999_+	peptidase M16	NA	A0A167R9K4	Powai_lake_megavirus	24.0	6.8e-20
>prophage 203
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3042279	3046086	5071057		Bacillus_virus(50.0%)	2	NA	NA
AVS48074.1|3042279_3043662_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	1.2e-17
AVS48075.1|3043662_3046086_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 204
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3050402	3052308	5071057		Planktothrix_phage(100.0%)	2	NA	NA
AVS48080.1|3050402_3051389_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	8.5e-18
AVS48081.1|3051381_3052308_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
>prophage 205
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3055581	3056993	5071057		Tupanvirus(50.0%)	2	NA	NA
AVS48085.1|3055581_3056592_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
AVS48086.1|3056708_3056993_+	transcriptional regulator	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 206
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3063005	3064106	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
AVS48091.1|3063005_3064106_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 207
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3072390	3073935	5071057		Escherichia_phage(100.0%)	1	NA	NA
AVS48096.1|3072390_3073935_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 208
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3077474	3091290	5071057	transposase	Escherichia_phage(33.33%)	9	NA	NA
AVS48101.1|3077474_3078497_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
AVS48102.1|3078493_3079276_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AVS50030.1|3079353_3079923_+	flavin reductase family protein	NA	NA	NA	NA	NA
AVS48103.1|3079926_3080154_-	tautomerase PptA	NA	NA	NA	NA	NA
AVS48104.1|3080459_3082436_+	hypothetical protein	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	2.7e-156
AVS48105.1|3082530_3083580_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.4e-18
AVS48106.1|3084510_3084909_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48107.1|3084909_3089115_-	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.9	6.4e-22
AVS48108.1|3089181_3091290_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
>prophage 209
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3096195	3098298	5071057		Salmonella_phage(100.0%)	1	NA	NA
AVS48115.1|3096195_3098298_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 210
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3105430	3112480	5071057		Mycoplasma_phage(25.0%)	7	NA	NA
AVS48125.1|3105430_3106444_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AVS48126.1|3106461_3107607_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS48127.1|3107851_3109258_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AVS50032.1|3109336_3109753_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AVS48128.1|3109798_3109975_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
AVS48129.1|3110196_3110427_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
AVS48130.1|3110518_3112480_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	2.4e-24
>prophage 211
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3126374	3127323	5071057		Moraxella_phage(50.0%)	2	NA	NA
AVS48146.1|3126374_3126548_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
AVS48147.1|3126792_3127323_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
>prophage 212
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3131262	3135165	5071057		Klosneuvirus(100.0%)	1	NA	NA
AVS48151.1|3131262_3135165_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 213
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3166442	3167432	5071057		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS48177.1|3166442_3167432_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 214
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3172392	3179662	5071057	tRNA	Enterobacteria_phage(20.0%)	7	NA	NA
AVS48181.1|3172392_3173526_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.1	1.2e-103
AVS48182.1|3173666_3174101_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AVS48183.1|3174276_3175212_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
AVS48184.1|3175340_3176714_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
AVS48185.1|3176743_3176917_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48186.1|3177191_3178175_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS50034.1|3178429_3179662_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 215
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3189477	3189993	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS48192.1|3189477_3189993_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 216
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3207916	3208999	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS48211.1|3207916_3208999_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 217
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3222702	3223968	5071057		Klosneuvirus(100.0%)	1	NA	NA
AVS48223.1|3222702_3223968_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 218
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3236758	3238777	5071057		Bacillus_virus(50.0%)	2	NA	NA
AVS48236.1|3236758_3237565_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
AVS48237.1|3237613_3238777_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	27.4	3.3e-29
>prophage 219
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3247710	3249645	5071057		Lactococcus_phage(100.0%)	1	NA	NA
AVS48243.1|3247710_3249645_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.8	3.4e-31
>prophage 220
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3257457	3258048	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS48253.1|3257457_3258048_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 221
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3262972	3268264	5071057	protease	Tupanvirus(33.33%)	5	NA	NA
AVS48259.1|3262972_3265570_-	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
AVS48260.1|3265692_3265905_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48261.1|3265949_3266201_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48262.1|3266236_3267286_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AVS48263.1|3267505_3268264_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 222
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3276768	3279726	5071057		Acinetobacter_phage(100.0%)	2	NA	NA
AVS48271.1|3276768_3278364_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AVS50042.1|3278367_3279726_+	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	6.6e-37
>prophage 223
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3291390	3293405	5071057		Bacillus_virus(50.0%)	2	NA	NA
AVS48286.1|3291390_3292395_-	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
AVS48287.1|3292391_3293405_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 224
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3301816	3312183	5071057		Citrobacter_phage(25.0%)	10	NA	NA
AVS48292.1|3301816_3302434_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
AVS48293.1|3303037_3303451_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVS48294.1|3303595_3304504_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AVS48295.1|3304705_3305719_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVS48296.1|3305810_3306716_-	patatin family protein	NA	NA	NA	NA	NA
AVS48297.1|3306828_3307287_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48298.1|3307336_3308179_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AVS48299.1|3309260_3309938_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AVS48300.1|3309937_3310648_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AVS48301.1|3310644_3312183_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 225
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3323316	3330120	5071057		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
AVS48309.1|3323316_3323547_-	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
AVS48310.1|3323816_3324917_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVS48311.1|3325321_3325429_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AVS48312.1|3325856_3325964_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AVS48313.1|3326112_3326967_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AVS48314.1|3327002_3327812_-	protein sirB1	NA	NA	NA	NA	NA
AVS48315.1|3327815_3328208_-	protein sirB2	NA	NA	NA	NA	NA
AVS48316.1|3328204_3329038_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS48317.1|3329037_3330120_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 226
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3333256	3336008	5071057		Tupanvirus(50.0%)	2	NA	NA
AVS48321.1|3333256_3334204_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
AVS48322.1|3334328_3336008_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.1e-22
>prophage 227
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3351863	3352622	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS48336.1|3351863_3352622_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 228
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3371287	3372975	5071057		Salmonella_phage(50.0%)	2	NA	NA
AVS48352.1|3371287_3372556_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	7.4e-208
AVS48353.1|3372555_3372975_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 229
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3380610	3382412	5071057	transposase	Escherichia_phage(100.0%)	2	NA	NA
AVS48364.1|3380610_3381393_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AVS48365.1|3381389_3382412_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
>prophage 230
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3386502	3388152	5071057		Escherichia_phage(100.0%)	1	NA	NA
AVS48369.1|3386502_3388152_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	1.3e-84
>prophage 231
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3394710	3399149	5071057	transposase	Enterobacteria_phage(50.0%)	5	NA	NA
AVS48378.1|3394710_3395442_+	MerR family DNA-binding transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	6.0e-53
AVS48379.1|3395662_3396067_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AVS48380.1|3396386_3396896_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS48381.1|3396801_3397020_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48382.1|3397898_3399149_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 232
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3402285	3403656	5071057		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS48386.1|3402285_3403656_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 233
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3408678	3410656	5071057		Mycoplasma_phage(100.0%)	2	NA	NA
AVS48391.1|3408678_3409815_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	7.2e-29
AVS48392.1|3409798_3410656_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 234
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3413908	3417631	5071057		Vibrio_phage(50.0%)	4	NA	NA
AVS48397.1|3413908_3414730_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AVS48398.1|3414745_3415657_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVS48399.1|3415685_3416930_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVS48400.1|3416929_3417631_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 235
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3425617	3425875	5071057		Erwinia_phage(100.0%)	1	NA	NA
AVS48406.1|3425617_3425875_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 236
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3438198	3439841	5071057		Streptococcus_virus(50.0%)	2	NA	NA
AVS48420.1|3438198_3439203_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
AVS48421.1|3439199_3439841_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 237
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3443113	3444295	5071057		Ralstonia_phage(50.0%)	2	NA	NA
AVS48425.1|3443113_3443350_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVS48426.1|3443560_3444295_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 238
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3456651	3457593	5071057		Brevibacillus_phage(100.0%)	1	NA	NA
AVS48438.1|3456651_3457593_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 239
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3473438	3473684	5071057		Salmonella_phage(100.0%)	1	NA	NA
AVS48458.1|3473438_3473684_+	DNA-damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 240
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3478346	3479267	5071057		Morganella_phage(100.0%)	1	NA	NA
AVS48465.1|3478346_3479267_+	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 241
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3488575	3489109	5071057		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
AVS48473.1|3488575_3489109_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 242
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3493243	3494077	5071057		Pelagibacter_phage(100.0%)	1	NA	NA
AVS48481.1|3493243_3494077_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 243
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3497468	3498836	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS48485.1|3497468_3498836_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
>prophage 244
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3505660	3506725	5071057		Cronobacter_phage(100.0%)	1	NA	NA
AVS48489.1|3505660_3506725_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 245
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3521451	3523551	5071057		Enterobacteria_phage(100.0%)	3	NA	NA
AVS48502.1|3521451_3521946_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
AVS48503.1|3521966_3523295_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.2e-234
AVS48504.1|3523377_3523551_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 246
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3527859	3540114	5071057		Klosneuvirus(20.0%)	13	NA	NA
AVS48510.1|3527859_3528780_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
AVS48511.1|3528779_3529085_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVS48512.1|3529177_3529777_-	molecular chaperone TorD	NA	NA	NA	NA	NA
AVS48513.1|3529773_3532320_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	1.2e-71
AVS48514.1|3532319_3533492_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVS48515.1|3533621_3534314_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AVS48516.1|3534286_3535315_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AVS48517.1|3535397_3538130_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	9.2e-38
AVS48518.1|3538212_3539286_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
AVS48519.1|3539334_3539508_-	protein GnsA	NA	NA	NA	NA	NA
AVS48520.1|3539497_3539728_-	cold-shock protein	NA	NA	NA	NA	NA
AVS50057.1|3539702_3539891_-	cold-shock protein	NA	NA	NA	NA	NA
AVS48521.1|3539901_3540114_-	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 247
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3551108	3551768	5071057		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS48532.1|3551108_3551768_+	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 248
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3556001	3558056	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS48540.1|3556001_3558056_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 249
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3570667	3572575	5071057		Tupanvirus(100.0%)	1	NA	NA
AVS48552.1|3570667_3572575_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 250
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3581475	3592274	5071057	tRNA	Bacillus_virus(20.0%)	9	NA	NA
AVS48561.1|3581475_3582243_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AVS48562.1|3582285_3584898_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
AVS48563.1|3585163_3586366_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS48564.1|3586534_3587935_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AVS48565.1|3588537_3589626_+	outer membrane porin 1a	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AVS48566.1|3589641_3589824_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48567.1|3589810_3591001_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVS48568.1|3591051_3591699_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVS50062.1|3591725_3592274_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 251
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3606979	3611520	5071057		Bacillus_phage(100.0%)	3	NA	NA
AVS48579.1|3606979_3608728_-	lipid ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AVS48580.1|3608764_3611029_-	ComEC family protein	NA	NA	NA	NA	NA
AVS48581.1|3611235_3611520_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 252
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3617318	3618407	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS48587.1|3617318_3618407_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 253
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3622505	3625720	5071057		Tetraselmis_virus(100.0%)	2	NA	NA
AVS48591.1|3622505_3624788_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AVS48592.1|3624979_3625720_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 254
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3630559	3654679	5071057	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
AVS48597.1|3630559_3631177_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AVS48598.1|3631187_3633632_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.1e-220
AVS48599.1|3633870_3635163_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AVS48600.1|3635253_3636597_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AVS48601.1|3636607_3637219_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVS48602.1|3637377_3641445_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AVS48603.1|3641579_3642074_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVS48604.1|3642617_3643583_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AVS48605.1|3643705_3645472_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AVS48606.1|3645472_3647194_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.7e-21
AVS48607.1|3647235_3647940_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVS48608.1|3648224_3648443_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AVS48609.1|3649485_3651762_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AVS48610.1|3651792_3652113_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AVS48611.1|3652435_3652660_+	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AVS48612.1|3652732_3654679_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 255
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3663965	3665684	5071057		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVS48620.1|3663965_3665684_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
>prophage 256
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3669271	3670102	5071057		Roseobacter_phage(100.0%)	1	NA	NA
AVS48623.1|3669271_3670102_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 257
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3673782	3674511	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS48629.1|3673782_3674511_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 258
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3677636	3686786	5071057		Streptococcus_phage(25.0%)	12	NA	NA
AVS48634.1|3677636_3678764_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
AVS48635.1|3678804_3679293_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVS48636.1|3679352_3680198_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVS48637.1|3680194_3681148_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVS48638.1|3681157_3682291_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.1e-29
AVS48639.1|3682385_3683498_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVS48640.1|3683481_3683643_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS48641.1|3683848_3684325_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVS48642.1|3684412_3685315_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.0e-37
AVS48643.1|3685375_3686098_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
AVS48644.1|3686081_3686369_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48645.1|3686528_3686786_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 259
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3695351	3696554	5071057		Stx2-converting_phage(100.0%)	1	NA	NA
AVS50064.1|3695351_3696554_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 260
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3701652	3702693	5071057	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVS48661.1|3701652_3702693_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.3	2.8e-181
>prophage 261
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3710051	3711923	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS48666.1|3710051_3711923_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	5.2e-16
>prophage 262
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3715138	3723473	5071057		Synechococcus_phage(33.33%)	6	NA	NA
AVS48670.1|3715138_3715801_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	2.8e-25
AVS48671.1|3715931_3716831_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AVS48672.1|3716836_3719269_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AVS48673.1|3719414_3720230_+	HAD family hydrolase	NA	NA	NA	NA	NA
AVS48674.1|3720381_3721641_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVS48675.1|3721880_3723473_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 263
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3729180	3734405	5071057		Escherichia_phage(33.33%)	6	NA	NA
AVS48682.1|3729180_3729696_-	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
AVS48683.1|3730048_3730936_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVS48684.1|3731234_3731738_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AVS48685.1|3732141_3732888_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS48686.1|3733026_3733686_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AVS48687.1|3733682_3734405_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 264
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3737801	3746843	5071057		Erwinia_phage(25.0%)	8	NA	NA
AVS48690.1|3737801_3738206_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AVS48691.1|3738470_3740753_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AVS48692.1|3740794_3741472_+	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.1	1.5e-18
AVS48693.1|3741545_3741812_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
AVS48694.1|3742076_3742337_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS48695.1|3742476_3743562_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
AVS48696.1|3743702_3744665_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVS48697.1|3744692_3746843_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	1.4e-41
>prophage 265
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3751233	3756222	5071057		Catovirus(50.0%)	4	NA	NA
AVS48699.1|3751233_3752595_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AVS50066.1|3752823_3753495_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS48700.1|3753494_3754493_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVS48701.1|3754485_3756222_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 266
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3767206	3768115	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS48717.1|3767206_3768115_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 267
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3774551	3775841	5071057		Klosneuvirus(100.0%)	1	NA	NA
AVS48724.1|3774551_3775841_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
>prophage 268
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3786743	3793318	5071057		Planktothrix_phage(33.33%)	7	NA	NA
AVS48734.1|3786743_3787802_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
AVS48735.1|3787804_3788494_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVS48736.1|3788493_3789267_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS48737.1|3789432_3789582_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AVS48738.1|3789710_3790499_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVS48739.1|3790566_3792039_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
AVS48740.1|3792301_3793318_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 269
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3797680	3801200	5071057		Klebsiella_phage(33.33%)	4	NA	NA
AVS48745.1|3797680_3798733_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	49.1	5.7e-81
AVS48746.1|3799048_3799429_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48747.1|3799542_3800484_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
AVS48748.1|3800480_3801200_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	1.6e-21
>prophage 270
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3845115	3845907	5071057		Kaumoebavirus(100.0%)	1	NA	NA
AVS48789.1|3845115_3845907_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.0	1.7e-08
>prophage 271
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3849285	3858726	5071057		Acinetobacter_phage(33.33%)	4	NA	NA
AVS48794.1|3849285_3850767_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
AVS48795.1|3850809_3852228_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	5.2e-61
AVS48796.1|3852224_3852734_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48797.1|3854475_3858726_-	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.5	6.9e-24
>prophage 272
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3861985	3871290	5071057		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
AVS48803.1|3861985_3864034_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	9.3e-27
AVS48804.1|3864042_3864615_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
AVS48805.1|3864607_3867292_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AVS48806.1|3867288_3867966_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.1	5.2e-27
AVS48807.1|3868129_3869770_-	phosphoglucomutase, alpha-D-glucose phosphate-specific	NA	NA	NA	NA	NA
AVS48808.1|3869795_3870341_-	replication initiation regulator SeqA	NA	NA	NA	NA	NA
AVS48809.1|3870525_3871290_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 273
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3876154	3879968	5071057	tRNA	Escherichia_phage(50.0%)	2	NA	NA
AVS48817.1|3876154_3877819_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
AVS48818.1|3878021_3879968_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
>prophage 274
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3884594	3886259	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS48823.1|3884594_3886259_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 275
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3890355	3891435	5071057		Pseudomonas_phage(100.0%)	1	NA	NA
AVS48827.1|3890355_3891435_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 276
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3897318	3902442	5071057	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
AVS48834.1|3897318_3898044_+	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
AVS48835.1|3898161_3899097_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVS48836.1|3899141_3899624_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AVS50069.1|3899859_3902442_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 277
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3909452	3911892	5071057		Synechococcus_phage(50.0%)	2	NA	NA
AVS48845.1|3909452_3910541_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AVS48846.1|3910680_3911892_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.4	6.8e-102
>prophage 278
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3916708	3917355	5071057		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVS48855.1|3916708_3917092_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	2.3e-24
AVS48856.1|3917145_3917355_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 279
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3931445	3934272	5071057	transposase	Morganella_phage(50.0%)	3	NA	NA
AVS48871.1|3931445_3931874_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
AVS48872.1|3932044_3932554_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AVS48873.1|3932706_3934272_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 280
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3938572	3939202	5071057		uncultured_marine_virus(100.0%)	1	NA	NA
AVS48876.1|3938572_3939202_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 281
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3953522	3959564	5071057		Klosneuvirus(50.0%)	3	NA	NA
AVS48890.1|3953522_3954338_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	1.5e-07
AVS48891.1|3954334_3955468_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVS48892.1|3955682_3959564_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.4	6.4e-61
>prophage 282
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3970992	3974136	5071057		Leptospira_phage(100.0%)	1	NA	NA
AVS48903.1|3970992_3974136_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 283
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3977281	4058297	5071057	holin,capsid,lysis,tail,terminase,head,transposase,integrase,portal,protease	Enterobacteria_phage(50.77%)	97	3996672:3996718	4058311:4058357
AVS48907.1|3977281_3977965_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
AVS48908.1|3977954_3979403_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	1.7e-11
AVS48909.1|3980139_3982041_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	7.1e-29
AVS48910.1|3982068_3982530_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AVS48911.1|3982549_3987412_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.5	4.5e-19
AVS48912.1|3987408_3987660_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48913.1|3988189_3989326_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AVS48914.1|3989596_3991834_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AVS48915.1|3991820_3994793_+	phage receptor	NA	NA	NA	NA	NA
AVS48916.1|3994793_3995684_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48917.1|3995597_3995810_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48918.1|3995866_3996628_+	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
AVS48919.1|3996621_3996738_+	hypothetical protein	NA	NA	NA	NA	NA
3996672:3996718	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
AVS48920.1|3996923_3997115_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48921.1|3997140_3998094_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AVS48922.1|3998280_3999765_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVS48923.1|3999948_4000254_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
AVS50074.1|4000352_4000979_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS48924.1|4000936_4001203_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48925.1|4001420_4003304_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AVS50075.1|4003779_4004073_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48926.1|4004115_4005156_-	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
AVS48927.1|4005165_4005447_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
AVS48928.1|4005446_4007819_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
AVS48929.1|4007883_4008483_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
AVS48930.1|4008549_4011948_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.2	0.0e+00
AVS48931.1|4012008_4012680_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
AVS48932.1|4012577_4013321_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AVS48933.1|4013326_4014025_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AVS48934.1|4014024_4014354_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
AVS48935.1|4014350_4016900_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.6	0.0e+00
AVS48936.1|4016892_4017327_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
AVS48937.1|4017308_4017731_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVS50076.1|4017746_4018487_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.6e-130
AVS48938.1|4018494_4018890_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
AVS48939.1|4018886_4019465_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
AVS48940.1|4019476_4019812_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.3	4.8e-58
AVS48941.1|4019857_4021429_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AVS48942.1|4021448_4021796_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS48943.1|4021795_4022473_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS48944.1|4022548_4022944_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	91.7	1.8e-56
AVS48945.1|4022985_4024011_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.6e-189
AVS48946.1|4024066_4024399_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	2.5e-54
AVS48947.1|4024408_4025728_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
AVS48948.1|4026904_4027180_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48949.1|4027297_4027579_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48950.1|4027590_4028133_-|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
AVS48951.1|4028132_4028342_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48952.1|4028334_4028718_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVS48953.1|4028729_4029071_-|head	head decoration protein	head	NA	NA	NA	NA
AVS48954.1|4029080_4030121_-|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
AVS48955.1|4030338_4030761_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AVS48956.1|4030757_4031009_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48957.1|4031357_4033112_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
AVS48958.1|4033108_4033408_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVS48959.1|4033425_4033647_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48960.1|4033647_4033839_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
AVS48961.1|4033838_4034024_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48962.1|4034016_4035012_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AVS48963.1|4035043_4035622_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
AVS48964.1|4035678_4035936_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AVS48965.1|4035937_4037179_-|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.6	4.5e-93
AVS48966.1|4037327_4038209_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.6	3.6e-161
AVS48967.1|4038205_4038412_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AVS48968.1|4038408_4040334_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
AVS48969.1|4040308_4040854_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
AVS48970.1|4041197_4041380_+	hypothetical protein	NA	NA	NA	NA	NA
AVS48971.1|4041478_4041853_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	83.1	1.1e-50
AVS48972.1|4041891_4042335_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	95.2	3.5e-72
AVS48973.1|4042331_4042808_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	93.0	5.8e-81
AVS48974.1|4042794_4043112_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AVS48975.1|4043329_4044133_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.2	1.1e-68
AVS48976.1|4044354_4045044_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.4	7.6e-58
AVS48977.1|4045040_4045181_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.9e-08
AVS48978.1|4045177_4045540_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	3.3e-60
AVS48979.1|4045536_4045827_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
AVS48980.1|4045819_4045990_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AVS48981.1|4045989_4046445_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
AVS48982.1|4046441_4046543_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48983.1|4046632_4047943_-	hypothetical protein	NA	NA	NA	NA	NA
AVS48984.1|4048332_4048665_-	EmrE family small multidrug resistance (SMR) antibiotic efflux pump	NA	NA	NA	NA	NA
AVS48985.1|4048732_4049035_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AVS48986.1|4049031_4049733_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.9e-128
AVS48987.1|4049729_4050749_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AVS48988.1|4050745_4051285_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
AVS48989.1|4051354_4051585_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AVS48990.1|4051623_4052379_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AVS48991.1|4052974_4053181_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AVS48992.1|4053256_4053553_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
AVS48993.1|4053558_4054344_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AVS48994.1|4054340_4055021_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
AVS48995.1|4055017_4055176_+	DUF1317 domain-containing protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AVS48996.1|4055172_4056237_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
AVS48997.1|4056390_4056609_+	conjugal transfer protein TraR	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
AVS48998.1|4056656_4056935_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AVS48999.1|4056906_4057278_+	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AVS49000.1|4057133_4058297_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4058311:4058357	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 284
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4065375	4068506	5071057	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
AVS49005.1|4065375_4066242_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AVS49006.1|4066243_4066456_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVS49007.1|4066563_4067085_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVS49008.1|4067120_4068506_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 285
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4079917	4081063	5071057		Streptococcus_phage(100.0%)	1	NA	NA
AVS49020.1|4079917_4081063_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 286
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4087255	4089037	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS49026.1|4087255_4089037_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 287
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4094295	4102025	5071057		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AVS49031.1|4094295_4098498_-	RHS element protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.5	1.2e-23
AVS49032.1|4098927_4101342_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS49033.1|4101338_4102025_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	3.8e-33
>prophage 288
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4105161	4105839	5071057		Bacillus_virus(100.0%)	1	NA	NA
AVS49037.1|4105161_4105839_-	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 289
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4111542	4113705	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS49046.1|4111542_4113705_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 290
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4138786	4141291	5071057		uncultured_virus(100.0%)	1	NA	NA
AVS49050.1|4138786_4141291_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.6	2.6e-116
>prophage 291
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4149823	4158281	5071057		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
AVS49059.1|4149823_4150783_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.7	7.2e-14
AVS49060.1|4150779_4151742_-	ferrochelatase	NA	NA	NA	NA	NA
AVS49061.1|4151873_4152518_-	adenylate kinase	NA	NA	NA	NA	NA
AVS49062.1|4152698_4154573_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	8.9e-117
AVS49063.1|4154682_4155288_-	recombination protein RecR	NA	NA	NA	NA	NA
AVS49064.1|4155287_4155617_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVS49065.1|4155669_4157601_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AVS49066.1|4157729_4158281_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 292
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4165119	4168269	5071057		Leptospira_phage(100.0%)	1	NA	NA
AVS49075.1|4165119_4168269_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 293
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4177093	4180640	5071057		Bacillus_phage(100.0%)	2	NA	NA
AVS49085.1|4177093_4178875_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.0e-42
AVS49086.1|4178867_4180640_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 294
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4183963	4184659	5071057		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS49090.1|4183963_4184659_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 295
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4187787	4192834	5071057	protease	Bacillus_phage(25.0%)	4	NA	NA
AVS49094.1|4187787_4188060_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
AVS49095.1|4188268_4190623_-|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AVS49096.1|4190810_4192085_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AVS49097.1|4192210_4192834_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 296
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4216393	4225234	5071057	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AVS49121.1|4216393_4216864_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AVS49122.1|4216952_4218056_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	8.2e-54
AVS49123.1|4218059_4218509_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AVS49124.1|4218659_4219199_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AVS49125.1|4219496_4220381_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AVS49126.1|4220418_4220766_-	HNH endonuclease	NA	NA	NA	NA	NA
AVS49127.1|4220894_4221866_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AVS49128.1|4221876_4223724_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVS49129.1|4223751_4224084_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AVS49130.1|4224106_4225234_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 297
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4234762	4244734	5071057		Bacillus_phage(60.0%)	7	NA	NA
AVS49139.1|4234762_4236058_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
AVS49140.1|4236115_4236805_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AVS49141.1|4236994_4238197_+	exonuclease sbcCD subunit D	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AVS49142.1|4238193_4241337_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.5e-12
AVS50080.1|4241462_4242647_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVS49143.1|4242789_4243698_-	fructokinase	NA	NA	NA	NA	NA
AVS50081.1|4243822_4244734_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 298
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4249020	4250136	5071057		Bacillus_phage(100.0%)	1	NA	NA
AVS49152.1|4249020_4250136_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 299
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4265755	4266523	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS49169.1|4265755_4266523_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.2	4.7e-24
>prophage 300
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4271813	4272923	5071057		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS49175.1|4271813_4272923_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 301
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4276001	4277962	5071057		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AVS49178.1|4276001_4277015_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
AVS49179.1|4277011_4277962_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.1e-35
>prophage 302
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4283372	4287652	5071057		Enterobacteria_phage(50.0%)	2	NA	NA
AVS49184.1|4283372_4284455_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
AVS49185.1|4284577_4287652_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.2	0.0e+00
>prophage 303
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4292178	4299215	5071057	transposase	Lactobacillus_phage(33.33%)	5	NA	NA
AVS49191.1|4292178_4293078_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	7.2e-16
AVS49192.1|4293117_4294401_-	cytosine deaminase	NA	NA	NA	NA	NA
AVS49193.1|4294390_4295650_-	cytosine permease	NA	NA	NA	NA	NA
AVS49194.1|4295863_4297212_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	2.5e-73
AVS49195.1|4297328_4299215_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 304
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4307596	4312149	5071057		Tupanvirus(50.0%)	4	NA	NA
AVS49202.1|4307596_4308646_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	6.3e-72
AVS49203.1|4308732_4309689_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS49204.1|4309685_4310657_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS49205.1|4310649_4312149_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	6.2e-12
>prophage 305
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4324792	4330712	5071057	holin	Vibrio_phage(50.0%)	5	NA	NA
AVS49219.1|4324792_4326826_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AVS50086.1|4326822_4327038_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49220.1|4326954_4327542_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS49221.1|4327555_4329028_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVS49222.1|4329041_4330712_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	3.1e-60
>prophage 306
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4336287	4339607	5071057		Erysipelothrix_phage(50.0%)	4	NA	NA
AVS49230.1|4336287_4337613_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	7.2e-113
AVS49231.1|4337721_4337958_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS49232.1|4337969_4338563_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49233.1|4338722_4339607_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.0	8.0e-52
>prophage 307
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4364716	4366915	5071057		Acinetobacter_phage(100.0%)	1	NA	NA
AVS49255.1|4364716_4366915_+	xanthine dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.8	5.6e-38
>prophage 308
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4374035	4374314	5071057		Vibrio_phage(100.0%)	1	NA	NA
AVS49262.1|4374035_4374314_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.6e-14
>prophage 309
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4379715	4380246	5071057		Sodalis_phage(100.0%)	1	NA	NA
AVS49268.1|4379715_4380246_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	34.0	3.6e-07
>prophage 310
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4385481	4432218	5071057	integrase,plate,transposase	Stx2-converting_phage(36.36%)	43	4384615:4384629	4433099:4433113
4384615:4384629	attL	TTACCGTCAGCCATG	NA	NA	NA	NA
AVS49276.1|4385481_4386330_-	antA/AntB antirepressor family protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	33.0	2.3e-19
AVS49277.1|4386407_4386605_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AVS49278.1|4386832_4387630_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49279.1|4387758_4388973_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
AVS49280.1|4389329_4390583_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	3.2e-94
AVS49281.1|4390594_4391698_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AVS49282.1|4391985_4393041_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
AVS49283.1|4393079_4393481_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AVS49284.1|4393538_4394783_-	esterase FrsA	NA	NA	NA	NA	NA
AVS49285.1|4394874_4395333_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS49286.1|4395593_4397051_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AVS49287.1|4397407_4397662_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49288.1|4397906_4398359_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVS49289.1|4398368_4398767_-	toxin YafO	NA	NA	NA	NA	NA
AVS49290.1|4398769_4399063_-	antitoxin of toxin-antitoxin stability system	NA	NA	NA	NA	NA
AVS49291.1|4399114_4400170_-	DNA polymerase IV	NA	NA	NA	NA	NA
AVS50091.1|4400240_4401011_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AVS49292.1|4400970_4402710_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AVS49293.1|4402814_4403093_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AVS49294.1|4403085_4403442_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AVS49295.1|4403498_4404257_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AVS49296.1|4404548_4405289_+	transpeptidase	NA	NA	NA	NA	NA
AVS49297.1|4405259_4406027_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AVS49298.1|4406131_4406710_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AVS49299.1|4406949_4409394_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVS49300.1|4409436_4409910_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AVS49301.1|4410063_4410834_+	amidohydrolase	NA	NA	NA	NA	NA
AVS49302.1|4412231_4412609_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49303.1|4412608_4417105_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	4.7e-23
AVS49304.1|4418833_4420405_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AVS49305.1|4420424_4420772_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS49306.1|4420771_4421449_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS49307.1|4421448_4422027_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AVS49308.1|4422066_4422204_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49309.1|4423451_4423952_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVS49310.1|4423986_4424211_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49311.1|4424295_4425738_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVS49312.1|4425744_4426158_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVS49313.1|4426161_4428012_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVS49314.1|4427975_4429058_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVS49315.1|4429082_4430363_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AVS49316.1|4430359_4430884_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVS49317.1|4430886_4432218_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
4433099:4433113	attR	TTACCGTCAGCCATG	NA	NA	NA	NA
>prophage 311
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4446309	4454161	5071057		Bradyrhizobium_phage(25.0%)	9	NA	NA
AVS50092.1|4446309_4447041_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AVS49328.1|4447105_4447573_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AVS49329.1|4447569_4448292_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS49330.1|4448325_4449081_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVS49331.1|4449152_4450511_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AVS49332.1|4450557_4451178_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS49333.1|4451405_4452206_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AVS49334.1|4452446_4453361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS49335.1|4453357_4454161_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
>prophage 312
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4461392	4462424	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS49338.1|4461392_4462424_+	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 313
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4475255	4479371	5071057		Saccharomonospora_phage(50.0%)	2	NA	NA
AVS49353.1|4475255_4478738_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
AVS49354.1|4478774_4479371_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 314
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4488199	4488958	5071057		Flavobacterium_phage(100.0%)	1	NA	NA
AVS49363.1|4488199_4488958_-	(2E,6E)-farnesyl- diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 315
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4500806	4502231	5071057	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS49375.1|4500806_4502231_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 316
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4506160	4506505	5071057		Lake_Baikal_phage(100.0%)	1	NA	NA
AVS49380.1|4506160_4506505_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 317
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4512416	4513214	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS49385.1|4512416_4513214_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.7e-13
>prophage 318
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4518355	4525161	5071057	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
AVS49388.1|4518355_4520785_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
AVS49389.1|4520858_4521389_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AVS49390.1|4521403_4522108_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AVS49391.1|4522285_4522741_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AVS49392.1|4522777_4523704_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVS49393.1|4523742_4525161_+	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 319
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4534653	4535526	5071057	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS49403.1|4534653_4535526_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.3e-59
>prophage 320
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4538788	4545250	5071057		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AVS49410.1|4538788_4539715_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AVS49411.1|4539823_4540486_+	carbonic anhydrase	NA	NA	NA	NA	NA
AVS49412.1|4540526_4541063_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	8.7e-17
AVS49413.1|4541268_4543653_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AVS49414.1|4543699_4545250_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
>prophage 321
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4552995	4554420	5071057		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS50094.1|4552995_4554420_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	2.4e-42
>prophage 322
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4563047	4563599	5071057		Sphingobium_phage(100.0%)	1	NA	NA
AVS49427.1|4563047_4563599_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.1	2.3e-12
>prophage 323
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4567844	4568888	5071057		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS49432.1|4567844_4568888_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 324
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4594971	4596696	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS49459.1|4594971_4596696_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	3.2e-36
>prophage 325
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4609186	4609885	5071057		Planktothrix_phage(100.0%)	1	NA	NA
AVS49470.1|4609186_4609885_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 326
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4616185	4621607	5071057		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
AVS49475.1|4616185_4618537_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.9e-37
AVS49476.1|4618700_4621607_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 327
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4630668	4632616	5071057		Microcystis_phage(50.0%)	3	NA	NA
AVS49485.1|4630668_4631517_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
AVS49486.1|4631817_4632051_-	antitoxin	NA	NA	NA	NA	NA
AVS49487.1|4632136_4632616_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 328
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4640510	4646160	5071057		Vibrio_phage(50.0%)	4	NA	NA
AVS49495.1|4640510_4642025_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
AVS49496.1|4642055_4643198_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVS49497.1|4643315_4644533_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVS49498.1|4644606_4646160_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	6.0e-34
>prophage 329
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4651660	4652809	5071057		Halovirus(100.0%)	1	NA	NA
AVS49504.1|4651660_4652809_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 330
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4657215	4660032	5071057	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS49510.1|4657215_4660032_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	3.5e-77
>prophage 331
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4669518	4678586	5071057		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
AVS49520.1|4669518_4670685_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
AVS50099.1|4671213_4671423_+	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
AVS49521.1|4671526_4672657_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AVS49522.1|4672745_4674662_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AVS49523.1|4675037_4675442_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49524.1|4675467_4676181_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49525.1|4676329_4676896_+	acetate uptake transporter	NA	NA	NA	NA	NA
AVS49526.1|4676930_4677518_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVS49527.1|4677632_4678586_-	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 332
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4690240	4692354	5071057		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
AVS49536.1|4690240_4691665_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	3.2e-10
AVS49537.1|4691664_4692354_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
>prophage 333
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4695540	4699356	5071057		Bacillus_phage(50.0%)	3	NA	NA
AVS50103.1|4695540_4697478_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
AVS50104.1|4697586_4697715_-	methionine aminopeptidase	NA	NA	NA	NA	NA
AVS49542.1|4697688_4699356_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
>prophage 334
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4703638	4704871	5071057		Enterococcus_phage(100.0%)	1	NA	NA
AVS49549.1|4703638_4704871_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 335
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4711588	4712911	5071057		Geobacillus_virus(100.0%)	1	NA	NA
AVS49557.1|4711588_4712911_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 336
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4718415	4721291	5071057		Salmonella_phage(50.0%)	3	NA	NA
AVS49563.1|4718415_4718595_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AVS49564.1|4718703_4719309_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVS49565.1|4719701_4721291_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 337
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4729118	4730398	5071057		Salmonella_phage(50.0%)	2	NA	NA
AVS49576.1|4729118_4729658_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	6.4e-28
AVS49577.1|4729660_4730398_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 338
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4733624	4738989	5071057		Tupanvirus(50.0%)	4	NA	NA
AVS49579.1|4733624_4734647_-	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	6.1e-11
AVS49580.1|4734785_4735700_+	FCD domain-containing protein	NA	NA	NA	NA	NA
AVS49581.1|4735914_4737276_+	MFS transporter	NA	NA	NA	NA	NA
AVS49582.1|4737324_4738989_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 339
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4755980	4759949	5071057		Synechococcus_phage(50.0%)	2	NA	NA
AVS49600.1|4755980_4758413_+	DEAD/DEAH box helicase	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
AVS49601.1|4758479_4759949_+	restriction endonuclease subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
>prophage 340
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4766495	4767440	5071057		Sodalis_phage(100.0%)	1	NA	NA
AVS49605.1|4766495_4767440_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	50.8	3.3e-59
>prophage 341
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4783154	4783739	5071057		Clostridioides_phage(100.0%)	1	NA	NA
AVS49614.1|4783154_4783739_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	1.1e-36
>prophage 342
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4791127	4792588	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS49625.1|4791127_4792588_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 343
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4802785	4804462	5071057		Escherichia_phage(100.0%)	2	NA	NA
AVS49637.1|4802785_4803382_-	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
AVS49638.1|4803859_4804462_-	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 344
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4807822	4815322	5071057	transposase	Escherichia_phage(33.33%)	6	NA	NA
AVS49644.1|4807822_4808803_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.4	2.3e-100
AVS49645.1|4809148_4809757_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
AVS49646.1|4810051_4810303_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49647.1|4810457_4811671_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
AVS49648.1|4812342_4812462_+	DNA-binding protein	NA	NA	NA	NA	NA
AVS49649.1|4812784_4815322_+	type I restriction endonuclease subunit M	NA	C7BGE8	Burkholderia_phage	29.3	4.1e-08
>prophage 345
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4818820	4830714	5071057	integrase,tRNA	Stenotrophomonas_phage(25.0%)	7	4809944:4809957	4837912:4837925
4809944:4809957	attL	AATCAATATTCATG	NA	NA	NA	NA
AVS49653.1|4818820_4820074_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.4	5.2e-81
AVS49654.1|4821700_4823203_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	2.0e-82
AVS49655.1|4823321_4824404_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AVS49656.1|4824403_4825504_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AVS49657.1|4825770_4827282_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AVS50108.1|4827415_4827859_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVS49658.1|4827858_4830714_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
4837912:4837925	attR	AATCAATATTCATG	NA	NA	NA	NA
>prophage 346
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4839259	4846634	5071057	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
AVS49668.1|4839259_4840195_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AVS49669.1|4840207_4840669_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVS49670.1|4840741_4841128_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVS49671.1|4841405_4842386_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVS49672.1|4842611_4845308_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-44
AVS50110.1|4845448_4845502_-	MgtA leader peptide	NA	NA	NA	NA	NA
AVS49673.1|4845686_4846634_+	trehalose operon repressor	NA	C6ZCU4	Enterobacteria_phage	21.8	1.3e-12
>prophage 347
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4850272	4853583	5071057		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVS49676.1|4850272_4852411_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AVS49677.1|4852595_4853060_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
AVS49678.1|4853060_4853351_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
AVS49679.1|4853340_4853583_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
>prophage 348
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4857844	4864405	5071057		Klosneuvirus(33.33%)	6	NA	NA
AVS49684.1|4857844_4858843_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AVS49685.1|4858875_4859871_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS49686.1|4859857_4860883_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS49687.1|4860893_4862396_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	5.2e-11
AVS49688.1|4862608_4863565_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS49689.1|4863874_4864405_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 349
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4899306	4900470	5071057		Ralstonia_phage(100.0%)	1	NA	NA
AVS49730.1|4899306_4900470_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
>prophage 350
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4904314	4917345	5071057	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
AVS49737.1|4904314_4906756_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	1.1e-66
AVS49738.1|4906794_4907220_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS49739.1|4907424_4908723_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
AVS49740.1|4908826_4909024_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AVS49741.1|4909105_4910110_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
AVS49742.1|4910112_4911372_-|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AVS49743.1|4911456_4912737_-	GTPase HflX	NA	NA	NA	NA	NA
AVS49744.1|4912813_4913122_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
AVS49745.1|4913207_4914158_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AVS49746.1|4914150_4915998_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
AVS49747.1|4916007_4917345_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 351
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4921376	4921922	5071057		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVS49751.1|4921376_4921922_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	3.8e-28
>prophage 352
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4929350	4930328	5071057		Tupanvirus(100.0%)	1	NA	NA
AVS49756.1|4929350_4930328_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 353
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4935248	4935782	5071057		Morganella_phage(100.0%)	1	NA	NA
AVS49762.1|4935248_4935782_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 354
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4939985	4941969	5071057		Vibrio_phage(50.0%)	2	NA	NA
AVS49770.1|4939985_4941632_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
AVS49771.1|4941675_4941969_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 355
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4956245	4959457	5071057	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
AVS49784.1|4956245_4957703_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.4e-47
AVS49785.1|4957939_4959457_+|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 356
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4979020	4980523	5071057		Burkholderia_virus(100.0%)	1	NA	NA
AVS49801.1|4979020_4980523_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 357
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4985360	4986149	5071057		Pithovirus(100.0%)	1	NA	NA
AVS49804.1|4985360_4986149_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	4.2e-12
>prophage 358
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4991708	4993390	5071057		Bacillus_virus(50.0%)	2	NA	NA
AVS49812.1|4991708_4992467_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
AVS49813.1|4992709_4993390_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 359
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4999506	5005875	5071057		Staphylococcus_phage(50.0%)	5	NA	NA
AVS49821.1|4999506_5001039_+	allose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.8e-20
AVS49822.1|5001017_5001998_+	allose ABC transporter	NA	NA	NA	NA	NA
AVS49823.1|5002008_5002704_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AVS49824.1|5002687_5003617_+	allose kinase	NA	NA	NA	NA	NA
AVS49825.1|5003889_5005875_+	alkyl/aryl-sulfatase	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	4.2e-149
>prophage 360
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5011120	5013268	5071057		Escherichia_phage(100.0%)	1	NA	NA
AVS49830.1|5011120_5013268_+	formate dehydrogenase N subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 361
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5022552	5024511	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
AVS49841.1|5022552_5024511_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	8.7e-91
>prophage 362
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5030135	5031485	5071057		Moraxella_phage(100.0%)	1	NA	NA
AVS49846.1|5030135_5031485_-	guanine/hypoxanthine permease GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 363
CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5034816	5069783	5071057	integrase,capsid,tail,tRNA	Escherichia_phage(50.0%)	35	5038355:5038369	5060826:5060840
AVS49852.1|5034816_5034963_-|integrase	integrase	integrase	NA	NA	NA	NA
AVS49853.1|5034921_5035203_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49854.1|5035301_5035838_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
AVS49855.1|5036092_5038915_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
5038355:5038369	attL	TTCCTGCCGGATATC	NA	NA	NA	NA
AVS49856.1|5038949_5039306_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AVS49857.1|5039309_5039726_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
AVS49858.1|5040912_5041455_+	hypothetical protein	NA	NA	NA	NA	NA
AVS49859.1|5041676_5042870_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
AVS49860.1|5043122_5044202_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
AVS49861.1|5044254_5045670_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
AVS49862.1|5045752_5046736_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVS49863.1|5046901_5047144_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AVS49864.1|5047277_5048315_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVS49865.1|5048403_5049501_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
AVS49866.1|5049562_5049811_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AVS49867.1|5049928_5050216_-	hypothetical protein	NA	NA	NA	NA	NA
AVS49868.1|5050226_5050931_-	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.0e-57
AVS49869.1|5050940_5051222_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AVS49870.1|5051221_5053594_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.7	2.5e-169
AVS49871.1|5053652_5057051_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.7	0.0e+00
AVS49872.1|5057111_5057783_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.2	2.2e-102
AVS49873.1|5057680_5058418_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	3.7e-143
AVS50118.1|5058472_5059393_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	90.8	2.6e-162
AVS49874.1|5059465_5059633_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	79.2	1.6e-17
AVS49875.1|5059756_5060131_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AVS49876.1|5060147_5060846_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
5060826:5060840	attR	TTCCTGCCGGATATC	NA	NA	NA	NA
AVS49877.1|5060845_5061175_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
AVS49878.1|5061171_5063721_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.6	0.0e+00
AVS49879.1|5063713_5064148_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
AVS49880.1|5064129_5064552_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AVS50119.1|5064567_5065308_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	1.5e-131
AVS49881.1|5065315_5065711_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
AVS49882.1|5065707_5066286_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
AVS49883.1|5066297_5066651_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
AVS49884.1|5068523_5069783_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	98.6	6.8e-222
>prophage 1
CP028195	Escherichia coli strain CFSAN018748 plasmid pGMI14-004_1, complete sequence	68950	12533	59650	68950	transposase	Stx2-converting_phage(30.77%)	40	NA	NA
AVS50268.1|12533_13706_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	1.8e-229
AVS50269.1|13702_14503_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
AVS50311.1|14587_15811_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AVS50270.1|16331_16526_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50312.1|16811_17000_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50313.1|16932_17130_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50271.1|17199_17877_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS50272.1|17876_18224_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AVS50273.1|19817_20147_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	77.2	9.6e-43
AVS50274.1|20146_20824_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
AVS50275.1|20900_21116_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50276.1|21626_21938_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50277.1|22371_23540_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	98.4	7.1e-181
AVS50278.1|23599_23740_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AVS50279.1|24019_24277_+	replication regulatory protein RepA2	NA	NA	NA	NA	NA
AVS50315.1|24298_24427_-	replication protein RepA	NA	NA	NA	NA	NA
AVS50314.1|24510_24585_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVS50280.1|26169_26301_-	replication protein RepA4	NA	NA	NA	NA	NA
AVS50281.1|26511_26781_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50282.1|26777_27059_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AVS50316.1|27378_27933_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.6	4.9e-23
AVS50283.1|30275_30650_-	enterotoxin	NA	D1GID8	Vibrio_virus	79.8	1.1e-50
AVS50284.1|30646_31396_-	cholera enterotoxin subunit A2	NA	A0A023W6A1	Vibrio_virus	80.7	1.1e-118
AVS50285.1|31887_32070_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50286.1|32288_33002_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50287.1|33213_34185_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
AVS50288.1|36001_36217_+	enterotoxin	NA	NA	NA	NA	NA
AVS50289.1|36604_37714_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	8.6e-43
AVS50290.1|37830_39366_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVS50291.1|40628_47984_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50292.1|48114_50058_-	hypothetical protein	NA	A0A285PWH2	Cedratvirus	30.7	1.6e-07
AVS50293.1|50060_50555_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50294.1|50544_51801_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AVS50295.1|51803_53039_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50296.1|53035_53824_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50297.1|53823_54291_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50298.1|54294_54627_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50299.1|54799_55651_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS50317.1|57934_58648_-|transposase	transposase	transposase	NA	NA	NA	NA
AVS50300.1|58951_59650_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	87.3	2.8e-116
>prophage 1
CP028194	Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence	48684	0	47172	48684	plate,capsid,tail,portal,terminase,holin	Vibrio_phage(34.21%)	70	NA	NA
AVS50187.1|1427_1646_+|tail	phage tail protein	tail	A0A067ZJB1	Vibrio_phage	46.2	1.4e-10
AVS50188.1|1635_2637_+	late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.8	1.6e-69
AVS50189.1|2639_3260_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.8e-29
AVS50190.1|3256_3724_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50191.1|3720_4041_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50192.1|4037_5162_+|plate	baseplate J protein	plate	A0A0C5AEG2	Bacteriophage	44.4	3.7e-86
AVS50193.1|5154_5736_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	2.7e-16
AVS50194.1|5766_7656_+|tail	phage tail protein	tail	O22004	Shigella_phage	82.9	3.2e-58
AVS50195.1|7612_8080_+|tail	phage tail protein	tail	U5P083	Shigella_phage	98.1	3.9e-82
AVS50196.1|8051_8654_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	89.0	3.3e-97
AVS50197.1|8653_9082_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	74.1	2.3e-57
AVS50198.1|9109_9640_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	56.5	1.5e-45
AVS50199.1|9656_10217_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.4	4.1e-86
AVS50200.1|10614_11451_+	RepA	NA	NA	NA	NA	NA
AVS50201.1|11730_12102_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50202.1|12094_12382_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50203.1|12405_12669_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	46.2	9.8e-14
AVS50204.1|12913_13261_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVS50205.1|13260_13560_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS50206.1|13593_13878_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50207.1|14145_14526_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50208.1|14589_14862_+	transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	54.9	7.5e-09
AVS50209.1|15497_16133_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50210.1|16167_17310_-	hypothetical protein	NA	B0FED5	Escherichia_phage	89.2	1.0e-51
AVS50211.1|17306_17498_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50212.1|18607_18856_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50213.1|18899_19553_-	ATPase	NA	A0A219YB79	Aeromonas_phage	32.5	9.2e-21
AVS50214.1|19702_20077_-	hypothetical protein	NA	NA	NA	NA	NA
AVS50215.1|20169_20832_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AVS50216.1|21004_21499_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50217.1|21495_22011_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50218.1|22007_22241_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50219.1|22240_22645_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50220.1|22641_22974_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
AVS50221.1|22977_23355_+	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
AVS50222.1|23525_24593_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AVS50223.1|24670_24952_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50224.1|24948_25314_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
AVS50225.1|25310_25502_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50226.1|25498_26182_+	hypothetical protein	NA	Q71T76	Escherichia_phage	67.2	6.1e-84
AVS50227.1|26184_26526_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50254.1|26527_27211_+	hypothetical protein	NA	Q1MVF9	Enterobacteria_phage	87.4	6.1e-108
AVS50228.1|27916_28312_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
AVS50229.1|28298_28595_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
AVS50230.1|28578_29124_+	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	84.0	3.0e-89
AVS50231.1|29120_29399_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.9	4.0e-18
AVS50232.1|30076_30664_+	S-adenosylmethionine-binding protein	NA	G9L699	Escherichia_phage	77.6	3.2e-81
AVS50233.1|30775_31045_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50234.1|31044_31242_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50235.1|31316_31616_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50236.1|31593_31806_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50237.1|32041_32449_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
AVS50238.1|32740_33364_+	nuclease	NA	A0A0E3JS81	Verrucomicrobia_phage	43.2	4.1e-34
AVS50239.1|33363_34737_+	nuclease	NA	NA	NA	NA	NA
AVS50255.1|34777_35473_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
AVS50240.1|36030_36621_+	nuclease	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
AVS50241.1|36620_37172_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
AVS50242.1|37177_39034_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
AVS50243.1|39045_39285_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
AVS50244.1|39281_40856_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
AVS50245.1|40845_41913_+	peptidase S14	NA	A0A067ZG37	Vibrio_phage	46.2	7.4e-76
AVS50246.1|41922_42306_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50247.1|42326_43370_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
AVS50256.1|43445_43763_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50248.1|43762_44107_+	sugar transporter	NA	NA	NA	NA	NA
AVS50249.1|44103_44589_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	1.7e-16
AVS50250.1|44589_44880_+	hypothetical protein	NA	NA	NA	NA	NA
AVS50251.1|44879_46343_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.4	1.7e-144
AVS50252.1|46359_46881_+|tail	phage tail protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.5e-50
AVS50253.1|46890_47172_+	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
