The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	0	14318	4941290		Salmonella_phage(90.0%)	20	NA	NA
AVS09743.1|196_799_-	DUF1367 domain-containing protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
AVS09744.1|838_1144_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AVS09745.1|1133_1373_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AVS09746.1|1527_1794_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AVS14276.1|1892_2450_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	50.5	1.1e-38
AVS09747.1|2807_3281_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	4.3e-68
AVS09748.1|3280_4063_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	92.8	8.6e-66
AVS14277.1|4059_4461_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	99.2	6.4e-73
AVS09749.1|4505_5207_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
AVS09750.1|5203_6109_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AVS09751.1|6200_6575_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AVS09752.1|6540_6777_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
AVS09753.1|6906_7311_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
AVS09754.1|7707_7866_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
AVS09755.1|7887_8238_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	94.8	2.0e-59
AVS09756.1|8362_11290_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.1	0.0e+00
AVS09757.1|11252_12410_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AVS09758.1|12452_12692_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AVS09759.1|12732_12981_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AVS09760.1|13025_14318_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
>prophage 2
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	19668	25427	4941290	tRNA	Bandra_megavirus(33.33%)	5	NA	NA
AVS09765.1|19668_21069_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
AVS09766.1|21675_22767_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
AVS09767.1|22951_24142_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AVS09768.1|24203_24851_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVS09769.1|24878_25427_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
>prophage 3
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	40370	44934	4941290		Bacillus_phage(66.67%)	3	NA	NA
AVS09781.1|40370_42119_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
AVS09782.1|42155_44420_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	23.0	3.0e-10
AVS09783.1|44649_44934_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
>prophage 4
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	49990	51079	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS09788.1|49990_51079_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 5
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	55175	59862	4941290		Tetraselmis_virus(100.0%)	4	NA	NA
AVS09791.1|55175_57458_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AVS09792.1|57529_58489_-	type III secretion system effector SopD2	NA	NA	NA	NA	NA
AVS09793.1|58676_58946_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVS09794.1|59037_59862_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
>prophage 6
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	64156	80882	4941290	tRNA	Escherichia_phage(25.0%)	11	NA	NA
AVS09798.1|64156_64774_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AVS09799.1|64784_67229_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	7.0e-223
AVS09800.1|67466_68759_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
AVS09801.1|69017_70361_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.6	1.6e-80
AVS14280.1|70370_70982_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVS14281.1|71124_75135_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AVS09802.1|75269_75764_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVS09803.1|75692_75968_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09804.1|76310_77279_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
AVS09805.1|77393_79160_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.1	2.7e-22
AVS09806.1|79160_80882_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	3.8e-13
>prophage 7
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	85993	91242	4941290	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AVS09813.1|85993_88270_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVS09814.1|88300_88621_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVS09815.1|88944_89166_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVS09816.1|89295_91242_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
>prophage 8
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	99141	100860	4941290		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVS09822.1|99141_100860_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.2	6.4e-29
>prophage 9
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	104449	107200	4941290		Roseobacter_phage(50.0%)	4	NA	NA
AVS09826.1|104449_105280_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
AVS09827.1|105276_105600_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09828.1|105727_106243_+	lipoprotein	NA	NA	NA	NA	NA
AVS09829.1|106471_107200_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
>prophage 10
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	113999	123169	4941290		Streptococcus_phage(25.0%)	10	NA	NA
AVS09838.1|113999_115130_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.4	1.8e-24
AVS14283.1|115172_115646_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVS09839.1|115719_116565_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVS09840.1|116561_117515_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVS09841.1|117524_118658_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
AVS09842.1|118745_119858_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVS09843.1|120206_120683_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVS09844.1|120779_121682_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AVS09845.1|122445_122736_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09846.1|122905_123169_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 11
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	130740	132746	4941290		Escherichia_phage(50.0%)	2	NA	NA
AVS09853.1|130740_131499_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	3.9e-15
AVS09854.1|131543_132746_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.4e-99
>prophage 12
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	140347	142219	4941290		Planktothrix_phage(100.0%)	1	NA	NA
AVS09862.1|140347_142219_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 13
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	146541	148974	4941290		Citrobacter_phage(100.0%)	1	NA	NA
AVS09867.1|146541_148974_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 14
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	153483	155076	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS09870.1|153483_155076_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 15
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	160062	165371	4941290	protease	Enterobacteria_phage(33.33%)	6	NA	NA
AVS09876.1|160062_160578_-|protease	outer membrane protease	protease	A5LH44	Enterobacteria_phage	34.2	1.1e-16
AVS09877.1|160931_161819_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVS09878.1|162121_162625_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AVS09879.1|163100_163847_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVS09880.1|163992_164652_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVS09881.1|164648_165371_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
>prophage 16
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	168839	174524	4941290		Acinetobacter_phage(33.33%)	5	NA	NA
AVS09884.1|168839_169106_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
AVS09885.1|169390_169651_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVS09886.1|169806_170781_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVS09887.1|170810_172955_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
AVS09888.1|173162_174524_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	3.8e-53
>prophage 17
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	178366	179212	4941290		Micromonas_pusilla_virus(100.0%)	1	NA	NA
AVS09890.1|178366_179212_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	32.3	1.7e-06
>prophage 18
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	184481	186218	4941290		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AVS09896.1|184481_186218_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 19
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	197933	201201	4941290		Streptococcus_phage(50.0%)	2	NA	NA
AVS09912.1|197933_198842_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
AVS09913.1|198933_201201_-	type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	43.0	8.2e-16
>prophage 20
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	208061	211490	4941290		Klosneuvirus(50.0%)	3	NA	NA
AVS09920.1|208061_209351_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	1.3e-18
AVS09921.1|209408_209885_+	kinase inhibitor	NA	NA	NA	NA	NA
AVS09922.1|209969_211490_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
>prophage 21
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	219926	227544	4941290		Planktothrix_phage(33.33%)	8	NA	NA
AVS09929.1|219926_220985_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
AVS09930.1|220987_221677_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVS09931.1|221676_222450_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS14288.1|222616_222766_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVS09932.1|222894_223683_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVS09933.1|223750_225226_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AVS09934.1|225396_226305_+	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AVS09935.1|226527_227544_+	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
>prophage 22
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	231852	237385	4941290		Bacillus_virus(25.0%)	6	NA	NA
AVS09941.1|231852_232629_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
AVS09942.1|232628_233708_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AVS09943.1|233861_234914_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
AVS09944.1|235233_235620_+	hypothetical protein	NA	NA	NA	NA	NA
AVS09945.1|235730_236669_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.4e-25
AVS09946.1|236665_237385_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	1.1e-22
>prophage 23
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	263529	264321	4941290		Kaumoebavirus(100.0%)	1	NA	NA
AVS09966.1|263529_264321_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 24
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	269425	276618	4941290		Staphylococcus_phage(33.33%)	8	NA	NA
AVS09970.1|269425_270136_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	2.2e-07
AVS09971.1|270139_270910_-	ABC transporter permease	NA	NA	NA	NA	NA
AVS09972.1|271038_272172_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AVS09973.1|272184_273078_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVS09974.1|273077_274229_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.9	3.7e-81
AVS09975.1|274514_275255_-	transport protein	NA	NA	NA	NA	NA
AVS09976.1|275256_275592_-	hypothetical protein	NA	NA	NA	NA	NA
AVS09977.1|276051_276618_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
>prophage 25
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	280526	287959	4941290		Acinetobacter_phage(33.33%)	6	NA	NA
AVS09984.1|280526_282008_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
AVS09985.1|282046_283468_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.9	6.0e-57
AVS09986.1|283578_283785_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVS09987.1|284121_284211_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVS09988.1|284210_285890_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AVS09989.1|285910_287959_+	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.4e-27
>prophage 26
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	291229	291907	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS09991.1|291229_291907_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 27
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	302991	313204	4941290	tRNA	Lactobacillus_phage(25.0%)	8	NA	NA
AVS10002.1|302991_304395_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
AVS10003.1|304381_305521_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AVS10004.1|305571_306876_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AVS10005.1|306924_307257_-	lipoprotein	NA	NA	NA	NA	NA
AVS10006.1|307306_308713_-	chitoporin	NA	NA	NA	NA	NA
AVS10007.1|308840_309026_-	hypothetical protein	NA	NA	NA	NA	NA
AVS10008.1|309373_311041_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	95.8	0.0e+00
AVS10009.1|311251_313204_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
>prophage 28
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	317858	319523	4941290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS10014.1|317858_319523_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
>prophage 29
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	324141	325227	4941290		Pseudomonas_phage(100.0%)	1	NA	NA
AVS10018.1|324141_325227_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 30
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	331127	335930	4941290		Planktothrix_phage(50.0%)	4	NA	NA
AVS10024.1|331127_331853_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
AVS10025.1|331969_332905_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVS10026.1|332936_334175_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10027.1|334250_335930_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	35.9	2.3e-76
>prophage 31
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	347540	350123	4941290	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVS10037.1|347540_350123_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.0e-184
>prophage 32
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	358350	360835	4941290		Synechococcus_phage(50.0%)	2	NA	NA
AVS10046.1|358350_359484_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
AVS10047.1|359623_360835_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
>prophage 33
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	364790	366320	4941290		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
AVS10053.1|364790_365579_-	hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
AVS10054.1|365668_366052_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
AVS10055.1|366110_366320_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 34
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	381435	387983	4941290		Morganella_phage(33.33%)	6	NA	NA
AVS10070.1|381435_381864_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
AVS10071.1|381931_382699_-	hydrogenase	NA	NA	NA	NA	NA
AVS10072.1|382698_383256_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVS10073.1|383252_385532_-	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.5	1.3e-45
AVS10074.1|385524_386085_-	molecular chaperone	NA	NA	NA	NA	NA
AVS10075.1|386417_387983_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 35
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	391359	393185	4941290		Streptococcus_phage(50.0%)	2	NA	NA
AVS10079.1|391359_392595_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.3e-60
AVS10080.1|392567_393185_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	2.3e-53
>prophage 36
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	407656	413775	4941290		Klosneuvirus(50.0%)	3	NA	NA
AVS10094.1|407656_408451_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.9e-08
AVS10095.1|408504_409641_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVS10096.1|409890_413775_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	26.8	3.2e-60
>prophage 37
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	421743	422952	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS10105.1|421743_422952_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 38
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	438921	448227	4941290	transposase	Salmonella_phage(40.0%)	9	NA	NA
AVS10119.1|438921_440247_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.7	2.7e-104
AVS10120.1|440462_441317_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS10121.1|441367_441574_-	AcrB/AcrD/AcrF family protein	NA	NA	NA	NA	NA
AVS14301.1|441682_442012_+	ATP-binding protein	NA	NA	NA	NA	NA
AVS10122.1|442211_442457_+	copper-binding protein	NA	NA	NA	NA	NA
AVS10123.1|442881_443244_+	GtrA family protein	NA	I1TED9	Salmonella_phage	97.5	3.3e-60
AVS10124.1|443240_444161_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	95.1	6.6e-166
AVS10125.1|445186_446395_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVS10126.1|447127_448227_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.4e-45
>prophage 39
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	458474	462908	4941290	tRNA	Enterococcus_phage(50.0%)	6	NA	NA
AVS10139.1|458474_459341_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
AVS10140.1|459342_459555_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVS10141.1|459682_460228_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVS10142.1|460220_460658_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10143.1|460654_461479_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AVS10144.1|461522_462908_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 40
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	474180	475329	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS10156.1|474180_475329_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 41
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	482779	484561	4941290		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS10163.1|482779_484561_-	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.0	2.7e-38
>prophage 42
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	489032	490049	4941290		Planktothrix_phage(100.0%)	1	NA	NA
AVS10169.1|489032_490049_-	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 43
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	494902	495589	4941290		Planktothrix_phage(100.0%)	1	NA	NA
AVS10173.1|494902_495589_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.7e-31
>prophage 44
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	498864	504083	4941290		Bacillus_virus(50.0%)	5	NA	NA
AVS10177.1|498864_499542_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.9e-22
AVS10178.1|499688_500606_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVS10179.1|500602_501055_+	NfeD family protein	NA	NA	NA	NA	NA
AVS10180.1|501055_501472_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS10181.1|501581_504083_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	37.2	3.9e-112
>prophage 45
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	513182	524260	4941290	transposase	Acanthamoeba_polyphaga_moumouvirus(20.0%)	14	NA	NA
AVS10188.1|513182_514154_+	acetylesterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
AVS10189.1|514150_515113_-	ferrochelatase	NA	NA	NA	NA	NA
AVS10190.1|515341_515986_-	adenylate kinase	NA	NA	NA	NA	NA
AVS14304.1|515902_516124_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10191.1|516401_518276_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	1.7e-115
AVS10192.1|518386_518992_-	recombination protein RecR	NA	NA	NA	NA	NA
AVS10193.1|518991_519321_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVS10194.1|519366_521295_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AVS10195.1|521408_521960_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
AVS10196.1|522027_522135_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS10197.1|522112_522490_-	DUF454 domain-containing protein	NA	NA	NA	NA	NA
AVS10198.1|522570_523086_+	primosomal replication protein N''	NA	NA	NA	NA	NA
AVS10199.1|523099_523267_+	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AVS10200.1|523336_524260_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
>prophage 46
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	541878	545425	4941290		Bacillus_phage(100.0%)	2	NA	NA
AVS10217.1|541878_543660_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	2.4e-39
AVS10218.1|543652_545425_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	4.7e-51
>prophage 47
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	549825	550521	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS10223.1|549825_550521_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 48
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	553815	558983	4941290	protease	Bacillus_phage(25.0%)	4	NA	NA
AVS10227.1|553815_554088_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
AVS10228.1|554296_556651_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	2.1e-224
AVS10229.1|556836_558108_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
AVS10230.1|558359_558983_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 49
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	579180	582832	4941290	transposase	Salmonella_phage(50.0%)	3	NA	NA
AVS10249.1|579180_580443_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS10250.1|580703_581717_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS10251.1|581722_582832_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 50
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	592354	594017	4941290		Staphylococcus_phage(50.0%)	2	NA	NA
AVS10262.1|592354_592825_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
AVS10263.1|592913_594017_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
>prophage 51
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	598697	603037	4941290	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVS10271.1|598697_599669_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
AVS10272.1|599679_601527_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVS10273.1|601554_601887_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AVS10274.1|601909_603037_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
>prophage 52
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	611008	620929	4941290		Bacillus_phage(60.0%)	7	NA	NA
AVS10281.1|611008_612304_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.7	7.7e-27
AVS10282.1|612373_613063_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AVS10283.1|613277_614480_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	5.7e-08
AVS10284.1|614476_617617_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
AVS10285.1|617789_618962_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVS10286.1|618983_619892_-	fructokinase	NA	NA	NA	NA	NA
AVS10287.1|620017_620929_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	1.2e-103
>prophage 53
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	624621	625734	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS10294.1|624621_625734_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 54
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	640242	642129	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS10309.1|640242_642129_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.2e-52
>prophage 55
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	655545	665257	4941290		Escherichia_phage(33.33%)	6	NA	NA
AVS10322.1|655545_658518_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	3.5e-83
AVS10323.1|658527_660486_-	type III restriction-modification system StyLTI enzyme mod	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
AVS10324.1|660674_661928_-	MFS transporter	NA	NA	NA	NA	NA
AVS10325.1|662220_662415_-	copper chaperone	NA	NA	NA	NA	NA
AVS10326.1|662492_662957_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVS10327.1|662968_665257_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	2.7e-91
>prophage 56
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	672904	673429	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS10334.1|672904_673429_-	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 57
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	686486	690185	4941290		Streptococcus_phage(66.67%)	3	NA	NA
AVS10346.1|686486_687734_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	1.2e-98
AVS10347.1|687745_688849_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AVS10348.1|689132_690185_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 58
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	694958	696098	4941290		Mycobacterium_phage(100.0%)	1	NA	NA
AVS10354.1|694958_696098_-	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.7	1.0e-30
>prophage 59
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	699312	699891	4941290		Caulobacter_phage(100.0%)	1	NA	NA
AVS10358.1|699312_699891_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 60
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	724402	729130	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS10382.1|724402_729130_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	40.0	1.0e-31
>prophage 61
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	750948	753588	4941290		Vibrio_phage(100.0%)	1	NA	NA
AVS10406.1|750948_753588_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	35.7	2.3e-78
>prophage 62
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	760647	764858	4941290		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVS14312.1|760647_761379_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
AVS10413.1|761442_761910_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AVS10414.1|761906_762629_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVS10415.1|762663_763419_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVS10416.1|763490_764858_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
>prophage 63
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	768908	769712	4941290		Indivirus(100.0%)	1	NA	NA
AVS10421.1|768908_769712_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.0	4.6e-38
>prophage 64
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	776488	777520	4941290		Planktothrix_phage(100.0%)	1	NA	NA
AVS10423.1|776488_777520_+	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 65
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	791507	795610	4941290		Saccharomonospora_phage(50.0%)	2	NA	NA
AVS10439.1|791507_794990_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
AVS10440.1|795013_795610_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
>prophage 66
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	804421	805180	4941290		Flavobacterium_phage(100.0%)	1	NA	NA
AVS10449.1|804421_805180_-	ditrans,polycis-undecaprenyl-diphosphate synthase ((2E,6E)-farnesyl-diphosphate specific)	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 67
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	818617	820045	4941290	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS10463.1|818617_820045_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 68
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	824028	824373	4941290		Lake_Baikal_phage(100.0%)	1	NA	NA
AVS10468.1|824028_824373_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 69
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	837741	838539	4941290		Planktothrix_phage(100.0%)	1	NA	NA
AVS10480.1|837741_838539_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 70
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	843732	846207	4941290		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS10483.1|843732_846207_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	7.3e-34
>prophage 71
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	849223	850642	4941290		unidentified_phage(100.0%)	1	NA	NA
AVS10487.1|849223_850642_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.9e-26
>prophage 72
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	868663	878367	4941290		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
AVS10505.1|868663_869590_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
AVS10506.1|869698_870361_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVS10507.1|870418_870955_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AVS10508.1|871160_873551_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVS10509.1|873628_875239_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
AVS10510.1|875440_875788_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10511.1|875894_876755_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AVS10512.1|876775_877570_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVS10513.1|877599_878367_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
>prophage 73
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	894553	895978	4941290		Erysipelothrix_phage(100.0%)	1	NA	NA
AVS10529.1|894553_895978_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 74
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	907069	907633	4941290		Sphingobium_phage(100.0%)	1	NA	NA
AVS10537.1|907069_907633_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 75
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	911890	912934	4941290		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS10542.1|911890_912934_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.6	5.9e-102
>prophage 76
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	944978	946550	4941290		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AVS10571.1|944978_946550_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 77
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	954599	955307	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS10579.1|954599_955307_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	1.4e-22
>prophage 78
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	963082	968514	4941290		Lymphocystis_disease_virus(50.0%)	3	NA	NA
AVS10587.1|963082_965434_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	5.5e-15
AVS10588.1|965334_965583_-	hypothetical protein	NA	NA	NA	NA	NA
AVS10589.1|965607_968514_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
>prophage 79
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	976243	977677	4941290		Enterococcus_phage(50.0%)	2	NA	NA
AVS10597.1|976243_977092_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
AVS10598.1|977197_977677_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
>prophage 80
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	980814	982704	4941290		Catovirus(100.0%)	1	NA	NA
AVS10602.1|980814_982704_-	phosphatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 81
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	990459	996099	4941290		Vibrio_phage(50.0%)	4	NA	NA
AVS10612.1|990459_991977_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
AVS10613.1|992011_993154_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVS10614.1|993265_994483_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVS10615.1|994545_996099_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.8	1.5e-29
>prophage 82
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1001636	1002785	4941290		Halovirus(100.0%)	1	NA	NA
AVS10620.1|1001636_1002785_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 83
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1021790	1024625	4941290	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVS14317.1|1021790_1024625_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 84
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1031123	1032290	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS10644.1|1031123_1032290_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 85
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1036855	1038349	4941290		Tetraselmis_virus(100.0%)	1	NA	NA
AVS10648.1|1036855_1038349_-	DUF229 domain-containing protein	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 86
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1058510	1070820	4941290		Plodia_interpunctella_granulovirus(20.0%)	12	NA	NA
AVS10666.1|1058510_1060616_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	5.2e-33
AVS10667.1|1060996_1061440_+	transcriptional regulator	NA	NA	NA	NA	NA
AVS10668.1|1061456_1061990_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AVS10669.1|1062050_1062395_-	hypothetical protein	NA	NA	NA	NA	NA
AVS10670.1|1062521_1063469_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS10671.1|1063749_1064889_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AVS10672.1|1064974_1066891_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
AVS10673.1|1067239_1067644_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10674.1|1067679_1068393_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10675.1|1068542_1069109_+	acetate uptake transporter	NA	NA	NA	NA	NA
AVS10676.1|1069165_1069756_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVS10677.1|1069866_1070820_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
>prophage 87
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1089571	1090996	4941290		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVS10694.1|1089571_1090996_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.1	2.1e-09
>prophage 88
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1094945	1100109	4941290		Bacillus_phage(33.33%)	3	NA	NA
AVS10702.1|1094945_1096919_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
AVS10703.1|1097091_1098759_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AVS14319.1|1098876_1100109_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	45.2	1.1e-88
>prophage 89
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1106468	1107677	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS10711.1|1106468_1107677_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	6.7e-235
>prophage 90
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1113597	1114920	4941290		Geobacillus_virus(100.0%)	1	NA	NA
AVS10717.1|1113597_1114920_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 91
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1120467	1123366	4941290		Salmonella_phage(50.0%)	3	NA	NA
AVS10722.1|1120467_1120647_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
AVS10723.1|1120757_1121375_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVS10724.1|1121776_1123366_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
>prophage 92
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1127141	1128206	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS10730.1|1127141_1128206_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 93
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1133171	1134451	4941290		Salmonella_phage(50.0%)	2	NA	NA
AVS10736.1|1133171_1133711_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
AVS10737.1|1133713_1134451_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
>prophage 94
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1137713	1139375	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS10740.1|1137713_1139375_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 95
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1148027	1148981	4941290		Sodalis_phage(100.0%)	1	NA	NA
AVS10750.1|1148027_1148981_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	52.5	8.1e-66
>prophage 96
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1170790	1174550	4941290	transposase	Bluetongue_virus(50.0%)	3	NA	NA
AVS10773.1|1170790_1171999_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVS10774.1|1172827_1173202_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10775.1|1173194_1174550_+	replicative DNA helicase	NA	O80281	Escherichia_phage	49.9	3.9e-114
>prophage 97
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1186278	1188174	4941290		Synechococcus_phage(100.0%)	1	NA	NA
AVS10784.1|1186278_1188174_-	RNA polymerase subunit sigma	NA	F4YCU2	Synechococcus_phage	35.6	1.6e-28
>prophage 98
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1206993	1213980	4941290		Burkholderia_phage(50.0%)	8	NA	NA
AVS10806.1|1206993_1207971_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	52.7	1.7e-90
AVS10807.1|1208155_1209451_-	hypothetical protein	NA	NA	NA	NA	NA
AVS10808.1|1209571_1209793_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS10809.1|1209832_1210096_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS10810.1|1210207_1210468_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	5.8e-19
AVS10811.1|1210464_1211202_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AVS10812.1|1211305_1212730_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	8.0e-102
AVS10813.1|1212780_1213980_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.0	1.3e-33
>prophage 99
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1220015	1227436	4941290		Escherichia_phage(33.33%)	5	NA	NA
AVS14324.1|1220015_1223015_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	22.7	5.0e-29
AVS10817.1|1222977_1224045_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	43.9	2.5e-68
AVS10818.1|1224900_1225773_+	restriction endonuclease	NA	NA	NA	NA	NA
AVS10819.1|1226145_1226439_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10820.1|1226524_1227436_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.3	5.5e-48
>prophage 100
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1230966	1231986	4941290		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
AVS10822.1|1230966_1231986_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
>prophage 101
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1239796	1244743	4941290	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
AVS10831.1|1239796_1241308_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
AVS10832.1|1241405_1241888_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVS10833.1|1241887_1244743_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.2e-141
>prophage 102
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1257628	1264177	4941290	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AVS10848.1|1257628_1258564_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
AVS10849.1|1258576_1259038_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVS10850.1|1259114_1259501_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVS10851.1|1259575_1260022_+|transposase	transposase	transposase	NA	NA	NA	NA
AVS10852.1|1260137_1262846_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.2	2.0e-45
AVS10853.1|1263229_1264177_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
>prophage 103
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1267843	1271087	4941290		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVS10856.1|1267843_1269982_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.7	6.9e-267
AVS10857.1|1270102_1270567_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F9T1	Cronobacter_phage	55.8	6.1e-51
AVS10858.1|1270570_1270855_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.3e-32
AVS10859.1|1270844_1271087_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 104
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1283010	1284766	4941290		Klosneuvirus(50.0%)	2	NA	NA
AVS10873.1|1283010_1284009_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
AVS10874.1|1284235_1284766_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 105
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1320463	1321627	4941290		Ralstonia_phage(100.0%)	1	NA	NA
AVS10913.1|1320463_1321627_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.5e-82
>prophage 106
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1326490	1330897	4941290		Lactococcus_phage(50.0%)	3	NA	NA
AVS10921.1|1326490_1328929_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	2.2e-67
AVS10922.1|1328966_1329392_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS10923.1|1329598_1330897_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
>prophage 107
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1336442	1339628	4941290		Wolbachia_phage(50.0%)	2	NA	NA
AVS10930.1|1336442_1338299_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
AVS10931.1|1338308_1339628_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
>prophage 108
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1344530	1345076	4941290		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVS10935.1|1344530_1345076_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 109
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1352800	1353778	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS10941.1|1352800_1353778_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 110
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1357504	1358038	4941290		Morganella_phage(100.0%)	1	NA	NA
AVS10946.1|1357504_1358038_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.2e-47
>prophage 111
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1363104	1365088	4941290		Vibrio_phage(50.0%)	2	NA	NA
AVS10954.1|1363104_1364751_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
AVS10955.1|1364794_1365088_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 112
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1373608	1374817	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS10962.1|1373608_1374817_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 113
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1378978	1380025	4941290		Synechococcus_phage(100.0%)	1	NA	NA
AVS10964.1|1378978_1380025_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	2.8e-11
>prophage 114
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1395355	1399829	4941290		Escherichia_phage(100.0%)	4	NA	NA
AVS10980.1|1395355_1396009_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	1.8e-80
AVS10981.1|1396023_1396797_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	7.9e-104
AVS10982.1|1396789_1397416_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	91.8	1.4e-119
AVS14332.1|1397429_1399829_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.3	0.0e+00
>prophage 115
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1418048	1426419	4941290		Bacillus_phage(25.0%)	8	NA	NA
AVS14334.1|1418048_1419119_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
AVS10995.1|1419126_1419216_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AVS10996.1|1419285_1420788_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AVS10997.1|1421255_1421591_+	hypothetical protein	NA	NA	NA	NA	NA
AVS10998.1|1421710_1422154_+	VOC family protein	NA	NA	NA	NA	NA
AVS10999.1|1422275_1422740_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AVS11000.1|1422997_1423906_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	7.8e-34
AVS11001.1|1424271_1426419_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	24.5	1.0e-31
>prophage 116
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1436045	1438004	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS11012.1|1436045_1438004_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 117
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1444222	1445572	4941290		Moraxella_phage(100.0%)	1	NA	NA
AVS11020.1|1444222_1445572_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 118
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1450457	1452524	4941290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS11026.1|1450457_1452524_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 119
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1474905	1478509	4941290		Enterobacteria_phage(50.0%)	3	NA	NA
AVS11034.1|1474905_1475436_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	77.2	3.9e-54
AVS11035.1|1475602_1475719_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11036.1|1475683_1478509_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
>prophage 120
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1482604	1533659	4941290	tRNA,tail,plate	Burkholderia_phage(32.0%)	53	NA	NA
AVS11044.1|1482604_1483684_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
AVS11045.1|1483715_1485131_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AVS11046.1|1485195_1486179_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVS11047.1|1486353_1486596_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AVS11048.1|1486763_1487762_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVS11049.1|1487849_1489160_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVS11050.1|1489406_1489922_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AVS11051.1|1490021_1490231_-	CsbD family protein	NA	NA	NA	NA	NA
AVS14335.1|1490252_1490366_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11052.1|1490362_1491688_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AVS11053.1|1491866_1492475_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AVS11054.1|1492583_1492952_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AVS11055.1|1493122_1495543_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AVS11056.1|1495641_1496514_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AVS11057.1|1496527_1497025_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AVS11058.1|1497205_1498123_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AVS11059.1|1498286_1499645_-	maltoporin	NA	NA	NA	NA	NA
AVS11060.1|1499733_1500843_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AVS11061.1|1501204_1502395_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AVS11062.1|1502526_1504071_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AVS11063.1|1504085_1504976_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AVS11064.1|1505141_1505552_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AVS11065.1|1505694_1507791_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AVS11066.1|1507790_1508528_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11067.1|1508524_1509163_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AVS11068.1|1509226_1509469_-	outer membrane protein	NA	NA	NA	NA	NA
AVS11069.1|1509912_1511562_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVS11070.1|1511950_1513300_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AVS11071.1|1513430_1513778_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AVS11072.1|1514354_1514642_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
AVS11073.1|1514644_1515250_+	lytic murein transglycosylase	NA	Q5ZQZ1	Pseudomonas_phage	61.0	1.0e-61
AVS11074.1|1515262_1515577_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVS11075.1|1515736_1516192_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11076.1|1516188_1516386_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVS11077.1|1516375_1517803_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.4e-194
AVS11078.1|1517802_1518327_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
AVS11079.1|1518378_1518696_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVS11080.1|1518655_1518784_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVS11081.1|1518880_1521247_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	2.7e-70
AVS11082.1|1521246_1522200_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
AVS11083.1|1522199_1522409_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVS11084.1|1522396_1523440_+	phage protein D	NA	A4JWL3	Burkholderia_virus	45.9	2.9e-77
AVS11085.1|1523449_1524172_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
AVS11086.1|1524499_1524862_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
AVS11087.1|1524858_1525788_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
AVS11088.1|1525787_1527335_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
AVS11089.1|1527498_1527858_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	3.1e-34
AVS11090.1|1527848_1528964_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	1.5e-100
AVS11091.1|1528956_1529589_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
AVS11092.1|1529591_1531037_+	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	38.1	5.0e-75
AVS11093.1|1531039_1531741_+	DUF4376 domain-containing protein	NA	K7PMH7	Enterobacteria_phage	45.9	7.6e-29
AVS11094.1|1531737_1532193_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11095.1|1532930_1533659_+	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
>prophage 121
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1539554	1543238	4941290		Dickeya_phage(100.0%)	1	NA	NA
AVS11103.1|1539554_1543238_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 122
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1557399	1558989	4941290		Prochlorococcus_phage(100.0%)	1	NA	NA
AVS11110.1|1557399_1558989_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	4.9e-68
>prophage 123
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1564473	1566236	4941290		Bacillus_phage(50.0%)	3	NA	NA
AVS11116.1|1564473_1564746_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AVS11117.1|1564932_1565523_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVS11118.1|1565564_1566236_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	1.6e-20
>prophage 124
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1574653	1585104	4941290		Salmonella_phage(33.33%)	6	NA	NA
AVS11128.1|1574653_1575682_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	61.1	1.1e-103
AVS11129.1|1575747_1575951_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11130.1|1576062_1576422_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVS11131.1|1576407_1576734_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11132.1|1576775_1580999_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AVS11133.1|1581075_1585104_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 125
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1589224	1592318	4941290		Tupanvirus(50.0%)	3	NA	NA
AVS11140.1|1589224_1590409_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AVS11141.1|1590985_1591159_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11142.1|1591367_1592318_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
>prophage 126
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1600969	1602814	4941290		Acinetobacter_phage(100.0%)	1	NA	NA
AVS11146.1|1600969_1602814_-	vitamin B12 transporter BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 127
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1618888	1619551	4941290		Synechococcus_phage(100.0%)	1	NA	NA
AVS11160.1|1618888_1619551_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	8.4e-30
>prophage 128
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1643360	1647971	4941290		Erwinia_phage(50.0%)	5	NA	NA
AVS11178.1|1643360_1644692_+	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	28.8	4.2e-44
AVS11179.1|1644758_1645688_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVS11180.1|1645780_1646266_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVS11181.1|1646487_1646727_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVS11182.1|1647125_1647971_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
>prophage 129
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1658805	1660341	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS11195.1|1658805_1660341_-	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 130
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1673404	1677631	4941290		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVS11208.1|1673404_1674103_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVS11209.1|1674099_1675473_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AVS11210.1|1675520_1675724_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11211.1|1675844_1676240_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AVS11212.1|1676251_1677004_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AVS11213.1|1677010_1677631_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 131
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1707612	1710407	4941290		Escherichia_phage(50.0%)	3	NA	NA
AVS11244.1|1707612_1708416_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
AVS11245.1|1708449_1709346_-	sugar kinase	NA	NA	NA	NA	NA
AVS11246.1|1709510_1710407_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
>prophage 132
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1723277	1724486	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS11258.1|1723277_1724486_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 133
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1730184	1731234	4941290		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVS11265.1|1730184_1731234_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 134
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1736591	1739378	4941290		Enterococcus_phage(100.0%)	1	NA	NA
AVS11271.1|1736591_1739378_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 135
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1751824	1752439	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS11279.1|1751824_1752439_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	1.1e-18
>prophage 136
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1763366	1766801	4941290		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVS11288.1|1763366_1764146_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
AVS11289.1|1764148_1764697_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVS11290.1|1764700_1764955_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVS11291.1|1765160_1766801_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
>prophage 137
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1781031	1782861	4941290		Catovirus(100.0%)	1	NA	NA
AVS14343.1|1781031_1782861_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	2.6e-81
>prophage 138
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1787733	1791649	4941290		Bacillus_phage(100.0%)	3	NA	NA
AVS11312.1|1787733_1789896_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
AVS11313.1|1790030_1790747_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVS11314.1|1790746_1791649_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	7.7e-26
>prophage 139
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1810645	1816149	4941290		Enterobacteria_phage(40.0%)	6	NA	NA
AVS11334.1|1810645_1811776_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AVS11335.1|1811780_1812485_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVS11336.1|1812435_1812660_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
AVS11337.1|1812692_1813760_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	6.9e-98
AVS11338.1|1813759_1815022_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	27.5	2.7e-24
AVS11339.1|1815018_1816149_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
>prophage 140
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1820273	1826504	4941290		Indivirus(25.0%)	6	NA	NA
AVS11343.1|1820273_1820603_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVS11344.1|1820746_1822012_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
AVS11345.1|1822020_1822125_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVS11346.1|1822130_1823612_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AVS11347.1|1823651_1825676_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
AVS11348.1|1825775_1826504_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	31.2	3.5e-21
>prophage 141
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1831074	1831416	4941290		Pseudomonas_phage(100.0%)	1	NA	NA
AVS11353.1|1831074_1831416_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	2.2e-05
>prophage 142
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1836776	1838423	4941290		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVS11358.1|1836776_1838423_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.2e-64
>prophage 143
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1853822	1857840	4941290		Staphylococcus_phage(50.0%)	3	NA	NA
AVS11369.1|1853822_1855328_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
AVS11370.1|1855335_1855755_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVS11371.1|1855971_1857840_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
>prophage 144
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1861133	1862126	4941290		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVS11374.1|1861133_1862126_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 145
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1875011	1878400	4941290		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVS11387.1|1875011_1876382_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	2.5e-36
AVS11388.1|1876570_1878400_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	1.5e-129
>prophage 146
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1882808	1890559	4941290		Cyanophage(33.33%)	8	NA	NA
AVS11392.1|1882808_1883849_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.9	1.2e-46
AVS11393.1|1883984_1884944_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AVS11394.1|1884943_1885834_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVS14349.1|1885920_1886694_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AVS11395.1|1886708_1887434_+	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AVS11396.1|1887528_1888194_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVS14350.1|1888206_1889016_-	WG repeat-containing protein	NA	NA	NA	NA	NA
AVS11397.1|1889095_1890559_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	2.0e-63
>prophage 147
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1901589	1909207	4941290		Staphylococcus_phage(33.33%)	7	NA	NA
AVS11405.1|1901589_1901847_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVS11406.1|1901810_1902170_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVS11407.1|1902186_1902327_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVS11408.1|1902987_1904388_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVS11409.1|1904392_1905493_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AVS11410.1|1905690_1906764_+	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
AVS11411.1|1906792_1909207_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
>prophage 148
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1915097	1926312	4941290		Hokovirus(25.0%)	8	NA	NA
AVS11418.1|1915097_1917833_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	2.1e-34
AVS11419.1|1917912_1918953_+	TMAO reductase system protein TorT	NA	NA	NA	NA	NA
AVS14353.1|1918925_1919618_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AVS11420.1|1919747_1920932_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVS11421.1|1920921_1923474_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	4.8e-73
AVS11422.1|1923466_1924099_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVS11423.1|1924288_1925689_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AVS14354.1|1925694_1926312_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.4e-10
>prophage 149
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1933955	1934907	4941290		Cyanophage(50.0%)	2	NA	NA
AVS14355.1|1933955_1934369_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
AVS14356.1|1934478_1934907_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
>prophage 150
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1943410	1948367	4941290		Salmonella_phage(50.0%)	6	NA	NA
AVS11440.1|1943410_1944595_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	2.2e-12
AVS11441.1|1944797_1945658_-	EamA family transporter	NA	NA	NA	NA	NA
AVS11442.1|1945750_1945840_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVS11443.1|1946295_1946487_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11444.1|1946473_1946572_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVS11445.1|1946678_1948367_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	7.1e-57
>prophage 151
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1965083	1969564	4941290		Pseudomonas_phage(50.0%)	5	NA	NA
AVS11464.1|1965083_1965863_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.4	1.5e-38
AVS11465.1|1966047_1966371_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS11466.1|1966354_1966714_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AVS11467.1|1966928_1968122_+	purine ribonucleoside efflux pump NepI	NA	NA	NA	NA	NA
AVS11468.1|1968181_1969564_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.9	2.0e-41
>prophage 152
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1977929	1985301	4941290	transposase	Sodalis_phage(25.0%)	5	NA	NA
AVS11477.1|1977929_1978871_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.8	9.4e-67
AVS11478.1|1978913_1979795_-	EamA family transporter	NA	NA	NA	NA	NA
AVS11479.1|1979807_1981016_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVS11480.1|1981659_1982355_+	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AVS11481.1|1982574_1985301_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.6e-34
>prophage 153
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	1989214	1992082	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS11487.1|1989214_1992082_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	6.6e-95
>prophage 154
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2003355	2004747	4941290		environmental_Halophage(100.0%)	1	NA	NA
AVS11495.1|2003355_2004747_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 155
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2008996	2014022	4941290		Bordetella_phage(33.33%)	4	NA	NA
AVS11499.1|2008996_2011108_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVS11500.1|2011126_2011402_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVS11501.1|2011456_2012080_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AVS11502.1|2012336_2014022_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.7	3.1e-20
>prophage 156
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2020000	2024550	4941290		Xanthomonas_phage(25.0%)	7	NA	NA
AVS14360.1|2020000_2020456_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
AVS11510.1|2020436_2021657_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	5.5e-43
AVS11511.1|2021832_2022498_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVS11512.1|2022715_2022952_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVS11513.1|2022972_2023140_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVS11514.1|2023237_2024047_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	31.8	1.0e-24
AVS11515.1|2024070_2024550_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.5e-28
>prophage 157
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2038910	2048410	4941290		Prochlorococcus_phage(16.67%)	9	NA	NA
AVS11529.1|2038910_2039843_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
AVS11530.1|2040045_2041242_+	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AVS11531.1|2041251_2042277_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	86.5	1.6e-19
AVS11532.1|2042569_2043604_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
AVS11533.1|2043590_2044553_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVS11534.1|2044556_2045840_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AVS11535.1|2045849_2047394_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVS11536.1|2047641_2048073_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVS11537.1|2048158_2048410_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 158
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2052474	2053683	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS11542.1|2052474_2053683_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 159
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2073641	2079443	4941290	tRNA	Tupanvirus(50.0%)	4	NA	NA
AVS11559.1|2073641_2075492_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	5.0e-11
AVS11560.1|2075739_2076621_-	ROK family protein	NA	NA	NA	NA	NA
AVS11561.1|2076789_2078328_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVS14361.1|2078363_2079443_-	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	39.7	2.2e-67
>prophage 160
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2100322	2101318	4941290		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVS11581.1|2100322_2101318_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.8e-13
>prophage 161
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2105384	2106572	4941290		Macacine_betaherpesvirus(50.0%)	2	NA	NA
AVS11586.1|2105384_2105576_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
AVS11587.1|2105801_2106572_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	28.6	7.8e-19
>prophage 162
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2110592	2116934	4941290		Morganella_phage(33.33%)	6	NA	NA
AVS11592.1|2110592_2110805_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AVS11593.1|2111092_2111383_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS11594.1|2111821_2112532_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AVS11595.1|2112581_2113556_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.7	1.2e-16
AVS11596.1|2113785_2114448_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
AVS11597.1|2114600_2116934_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	2.0e-73
>prophage 163
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2134916	2136910	4941290		Planktothrix_phage(50.0%)	2	NA	NA
AVS11613.1|2134916_2135900_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
AVS11614.1|2135896_2136910_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
>prophage 164
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2165338	2166241	4941290		Burkholderia_virus(100.0%)	1	NA	NA
AVS11633.1|2165338_2166241_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 165
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2185383	2187426	4941290		Indivirus(100.0%)	1	NA	NA
AVS11650.1|2185383_2187426_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 166
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2204615	2207944	4941290		Bacillus_phage(66.67%)	4	NA	NA
AVS11664.1|2204615_2204966_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
AVS11665.1|2205113_2205545_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AVS11666.1|2205789_2207271_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AVS11667.1|2207263_2207944_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
>prophage 167
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2215116	2218573	4941290		uncultured_virus(50.0%)	3	NA	NA
AVS11673.1|2215116_2217564_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.3	1.3e-83
AVS11674.1|2217604_2217802_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AVS11675.1|2217835_2218573_-	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 168
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2223667	2230846	4941290		Bacillus_phage(66.67%)	5	NA	NA
AVS11681.1|2223667_2224348_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AVS11682.1|2224344_2225745_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AVS11683.1|2225962_2226397_+	copper-binding protein	NA	NA	NA	NA	NA
AVS11684.1|2227040_2228108_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11685.1|2228104_2230846_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 169
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2236226	2247886	4941290		Dickeya_phage(28.57%)	12	NA	NA
AVS14366.1|2236226_2236892_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	1.3e-57
AVS14367.1|2237061_2237307_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AVS11691.1|2237330_2238974_-	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.5	5.5e-14
AVS11692.1|2239170_2241369_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	7.7e-112
AVS11693.1|2241449_2242076_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AVS11694.1|2242217_2242589_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AVS11695.1|2242610_2242883_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
AVS11696.1|2242869_2243466_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AVS11697.1|2243591_2245067_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AVS11698.1|2245069_2245738_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AVS11699.1|2245730_2246786_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVS11700.1|2247031_2247886_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
>prophage 170
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2253677	2255160	4941290		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVS11707.1|2253677_2254445_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
AVS11708.1|2254446_2255160_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	1.3e-15
>prophage 171
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2258986	2260794	4941290		Planktothrix_phage(50.0%)	2	NA	NA
AVS11713.1|2258986_2260057_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
AVS11714.1|2260053_2260794_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
>prophage 172
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2282433	2284881	4941290		Dickeya_phage(100.0%)	1	NA	NA
AVS11732.1|2282433_2284881_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 173
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2299118	2302232	4941290		Halovirus(50.0%)	2	NA	NA
AVS11743.1|2299118_2300672_+	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.5	4.4e-29
AVS11744.1|2301017_2302232_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.8	6.5e-137
>prophage 174
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2307241	2309635	4941290		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVS11748.1|2307241_2309635_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 175
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2315695	2316610	4941290	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVS11754.1|2315695_2316610_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 176
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2323222	2326985	4941290		Bacillus_phage(66.67%)	3	NA	NA
AVS11761.1|2323222_2323942_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVS11762.1|2323938_2325291_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AVS11763.1|2325365_2326985_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
>prophage 177
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2344025	2344862	4941290		Vibrio_phage(100.0%)	1	NA	NA
AVS11778.1|2344025_2344862_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 178
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2362588	2366585	4941290		Acinetobacter_phage(50.0%)	3	NA	NA
AVS11791.1|2362588_2363152_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
AVS11792.1|2363237_2364455_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVS11793.1|2364497_2366585_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
>prophage 179
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2371024	2372932	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS11802.1|2371024_2372932_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	6.5e-75
>prophage 180
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2378893	2384464	4941290		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AVS11811.1|2378893_2379280_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.1e-20
AVS11812.1|2379279_2379636_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AVS11813.1|2379643_2379931_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVS11814.1|2380056_2380431_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVS11815.1|2380526_2380997_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVS11816.1|2381093_2383208_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AVS11817.1|2383279_2384464_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 181
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2404357	2408677	4941290	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
AVS11857.1|2404357_2405305_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
AVS11858.1|2405320_2405830_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AVS11859.1|2405961_2407086_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVS11860.1|2407057_2407531_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11861.1|2407557_2408100_+	DNA topoisomerase	NA	NA	NA	NA	NA
AVS11862.1|2408104_2408677_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
>prophage 182
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2422758	2426140	4941290		Bacillus_virus(50.0%)	3	NA	NA
AVS11869.1|2422758_2424858_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
AVS11870.1|2425008_2425173_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AVS11871.1|2425255_2426140_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
>prophage 183
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2438225	2439269	4941290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS11884.1|2438225_2439269_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 184
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2457725	2458994	4941290		Oenococcus_phage(100.0%)	1	NA	NA
AVS11902.1|2457725_2458994_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 185
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2465988	2467356	4941290	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS11910.1|2465988_2467356_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
>prophage 186
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2472224	2476259	4941290	protease	Pseudomonas_phage(50.0%)	4	NA	NA
AVS11916.1|2472224_2472725_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
AVS11917.1|2472833_2473625_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVS11918.1|2473759_2474653_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVS11919.1|2474768_2476259_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
>prophage 187
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2481050	2482154	4941290		Salmonella_phage(100.0%)	1	NA	NA
AVS11925.1|2481050_2482154_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 188
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2488920	2503826	4941290		Staphylococcus_phage(28.57%)	17	NA	NA
AVS11929.1|2488920_2489850_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
AVS11930.1|2489943_2492280_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	6.0e-38
AVS11931.1|2492506_2493160_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVS11932.1|2493156_2493885_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVS11933.1|2493959_2494592_-	hypothetical protein	NA	NA	NA	NA	NA
AVS11934.1|2494840_2495113_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVS11935.1|2495109_2495964_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVS11936.1|2496009_2496501_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVS11937.1|2496618_2496906_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVS11938.1|2496928_2498362_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVS11939.1|2498409_2499135_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AVS11940.1|2499141_2499696_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVS11941.1|2499664_2500240_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVS11942.1|2500236_2500803_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
AVS11943.1|2500823_2501810_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AVS11944.1|2501823_2502801_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVS11945.1|2503013_2503826_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
>prophage 189
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2507935	2509426	4941290		Vibrio_phage(50.0%)	2	NA	NA
AVS11951.1|2507935_2508223_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
AVS11952.1|2508454_2509426_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
>prophage 190
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2516148	2519036	4941290	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVS11961.1|2516148_2518083_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
AVS11962.1|2518187_2519036_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
>prophage 191
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2522499	2529156	4941290		Dickeya_phage(50.0%)	4	NA	NA
AVS11966.1|2522499_2523843_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
AVS11967.1|2524458_2524923_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AVS11968.1|2524950_2526453_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVS11969.1|2526477_2529156_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 192
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2534640	2536581	4941290		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVS11974.1|2534640_2536581_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.9e-52
>prophage 193
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2542361	2549010	4941290		Invertebrate_iridovirus(25.0%)	9	NA	NA
AVS11981.1|2542361_2542679_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
AVS11982.1|2542716_2543160_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11983.1|2543139_2543658_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AVS11984.1|2543788_2544424_+	hypothetical protein	NA	NA	NA	NA	NA
AVS11985.1|2544490_2545066_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVS11986.1|2545075_2545666_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AVS11987.1|2545687_2546083_-	YraN family protein	NA	NA	NA	NA	NA
AVS11988.1|2546040_2548083_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVS11989.1|2548146_2549010_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.5e-50
>prophage 194
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2559697	2560843	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS12000.1|2559697_2560843_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	1.6e-47
>prophage 195
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2567476	2638451	4941290	transposase,capsid,lysis,plate,terminase,portal,head,tail,holin,tRNA,integrase	Escherichia_phage(29.41%)	85	2589088:2589111	2637166:2637189
AVS12008.1|2567476_2568685_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVS12009.1|2568681_2570952_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.6e-158
AVS12010.1|2571021_2572386_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AVS12011.1|2572700_2574032_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12012.1|2574057_2575368_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
AVS12013.1|2575480_2575645_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12014.1|2575668_2576370_-	pirin family protein	NA	NA	NA	NA	NA
AVS12015.1|2576474_2577371_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS12016.1|2577409_2577775_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AVS12017.1|2577898_2578885_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AVS12018.1|2578952_2579438_-	DoxX family protein	NA	NA	NA	NA	NA
AVS12019.1|2579592_2579892_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12020.1|2579888_2580287_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12021.1|2580289_2580595_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
AVS12022.1|2580636_2581005_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
AVS12023.1|2581149_2581533_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
AVS12024.1|2581536_2582199_-	DedA family protein	NA	NA	NA	NA	NA
AVS12025.1|2582451_2582652_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12026.1|2582648_2583893_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
AVS12027.1|2584147_2585116_-	hypothetical protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
AVS12028.1|2585385_2586384_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AVS12029.1|2586472_2587165_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
AVS12030.1|2587316_2587814_-	M48 family peptidase	NA	NA	NA	NA	NA
AVS12031.1|2587899_2589036_+	ribosomal RNA large subunit methyltransferase G	NA	NA	NA	NA	NA
2589088:2589111	attL	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
AVS12032.1|2589116_2591135_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AVS12033.1|2591305_2592685_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
AVS12034.1|2592644_2592827_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12035.1|2593114_2594635_+	hypothetical protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
AVS12036.1|2596585_2597233_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVS12037.1|2597464_2598232_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AVS12038.1|2598448_2599471_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	88.8	1.1e-177
AVS14381.1|2599470_2600052_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	93.1	1.3e-98
AVS12039.1|2600173_2600437_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	92.0	6.5e-42
AVS12040.1|2600467_2600977_+	hypothetical protein	NA	A0A0M4QWN1	Salmonella_phage	97.6	2.3e-88
AVS12041.1|2600984_2601212_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	4.3e-34
AVS12042.1|2601198_2601399_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
AVS12043.1|2601468_2601696_+	hypothetical protein	NA	A0A0M3UL87	Salmonella_phage	68.1	8.1e-17
AVS12044.1|2601695_2601914_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12045.1|2601913_2602135_+	hypothetical protein	NA	A0A0M4S5Q7	Salmonella_phage	97.3	1.2e-33
AVS12046.1|2602135_2602408_+	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	78.9	4.7e-35
AVS12047.1|2602404_2602686_+	hypothetical protein	NA	A0A0P0I3U9	Klebsiella_phage	50.0	2.2e-11
AVS12048.1|2602676_2604926_+	replication protein	NA	A0A218M4H2	Erwinia_phage	92.3	0.0e+00
AVS12049.1|2605042_2605483_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	91.2	1.2e-64
AVS12050.1|2605562_2606294_+	hypothetical protein	NA	Q37850	Escherichia_phage	94.7	1.8e-129
AVS12051.1|2606473_2606683_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	94.2	8.2e-32
AVS12052.1|2606756_2607695_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	78.2	1.8e-142
AVS12053.1|2607811_2607994_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12054.1|2607907_2608108_-	hypothetical protein	NA	A0A0M5M1G4	Salmonella_phage	83.7	6.9e-12
AVS12055.1|2608128_2609175_-|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	98.0	1.8e-188
AVS12056.1|2609174_2610944_-	oxidoreductase	NA	Q9T0R3	Escherichia_phage	98.1	0.0e+00
AVS12057.1|2611109_2611964_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	94.0	1.9e-151
AVS12058.1|2612040_2613108_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
AVS12059.1|2613111_2613861_+|terminase	terminase	terminase	O80305	Escherichia_phage	98.4	6.2e-122
AVS12060.1|2613953_2614460_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	99.4	8.6e-91
AVS12061.1|2614459_2614663_+|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	94.0	3.4e-30
AVS12062.1|2614666_2614963_+|holin	holin	holin	O80308	Escherichia_phage	98.0	3.7e-46
AVS12063.1|2614949_2615447_+	lysozyme	NA	S4TUB1	Salmonella_phage	98.2	1.2e-92
AVS12064.1|2615443_2615857_+	protein lysB	NA	O80310	Escherichia_phage	82.5	1.4e-54
AVS12065.1|2615828_2616002_+|lysis	phage lysis protein	lysis	Q6K1H9	Salmonella_virus	94.7	8.9e-24
AVS12066.1|2615964_2616432_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	97.4	2.3e-82
AVS12067.1|2616424_2616874_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	95.3	7.4e-70
AVS12068.1|2616942_2617584_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	97.7	5.9e-113
AVS12069.1|2617580_2617928_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	95.7	8.8e-55
AVS12070.1|2617934_2618843_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	95.7	6.8e-155
AVS12071.1|2618835_2619369_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	92.0	1.2e-95
AVS12072.1|2619376_2621128_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	76.2	1.5e-94
AVS12073.1|2621130_2621655_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVS12074.1|2621785_2622964_+|tail	phage tail protein	tail	Q37844	Escherichia_phage	95.2	9.2e-213
AVS12075.1|2622979_2623501_+|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
AVS12076.1|2623564_2623900_+|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	98.2	5.2e-52
AVS12077.1|2623932_2624052_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
AVS12078.1|2624044_2626486_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	91.5	0.0e+00
AVS12079.1|2626499_2626985_+|tail	phage tail protein	tail	O80317	Escherichia_phage	92.5	4.2e-79
AVS12080.1|2626981_2628151_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.1	6.4e-206
AVS12081.1|2628218_2628437_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AVS12082.1|2628795_2629302_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVS12083.1|2629425_2631408_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AVS12084.1|2631422_2633168_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AVS12085.1|2633403_2633619_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVS12086.1|2633846_2634860_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AVS12087.1|2634763_2635102_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12088.1|2635109_2635721_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVS12089.1|2635827_2636187_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVS12090.1|2636284_2637106_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVS12091.1|2637209_2638451_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
2637166:2637189	attR	GATAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 196
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2643679	2645113	4941290		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVS12095.1|2643679_2645113_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 197
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2649163	2649817	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS12099.1|2649163_2649817_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 198
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2655573	2657414	4941290		Ralstonia_phage(50.0%)	2	NA	NA
AVS12106.1|2655573_2656737_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.8e-88
AVS12107.1|2656742_2657414_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
>prophage 199
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2661814	2663707	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS12113.1|2661814_2663707_+	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 200
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2667022	2670722	4941290		Stx_converting_phage(50.0%)	3	NA	NA
AVS12118.1|2667022_2667415_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
AVS12119.1|2667486_2668353_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS12120.1|2668463_2670722_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.7	2.0e-86
>prophage 201
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2676559	2682264	4941290		Pseudomonas_phage(33.33%)	5	NA	NA
AVS12126.1|2676559_2678731_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
AVS12127.1|2678933_2679128_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12128.1|2679285_2679741_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AVS12129.1|2679785_2681240_-	anion permease	NA	NA	NA	NA	NA
AVS12130.1|2681436_2682264_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 202
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2688205	2693345	4941290		Diadromus_pulchellus_ascovirus(50.0%)	6	NA	NA
AVS12137.1|2688205_2689090_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
AVS12138.1|2689213_2689618_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVS12139.1|2689604_2690015_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12140.1|2690106_2690622_+	RNA helicase	NA	NA	NA	NA	NA
AVS12141.1|2690900_2691395_+	TIGR00645 family protein	NA	NA	NA	NA	NA
AVS12142.1|2691701_2693345_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
>prophage 203
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2708773	2710246	4941290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS12159.1|2708773_2710246_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	6.0e-44
>prophage 204
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2713645	2714524	4941290		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS12162.1|2713645_2714524_+	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	28.9	1.2e-07
>prophage 205
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2735891	2736971	4941290		Geobacillus_virus(100.0%)	1	NA	NA
AVS12183.1|2735891_2736971_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 206
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2754281	2755436	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS12204.1|2754281_2755436_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 207
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2761288	2762761	4941290		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVS12209.1|2761288_2762761_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.2	1.2e-47
>prophage 208
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2770778	2771435	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS12217.1|2770778_2771435_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
>prophage 209
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2782611	2783844	4941290		Catovirus(100.0%)	1	NA	NA
AVS12231.1|2782611_2783844_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 210
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2792113	2797817	4941290		Prochlorococcus_phage(50.0%)	4	NA	NA
AVS12240.1|2792113_2794987_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	2.4e-262
AVS12241.1|2795212_2795359_+	immunoglobulin	NA	NA	NA	NA	NA
AVS12242.1|2795442_2796336_+	transporter	NA	NA	NA	NA	NA
AVS12243.1|2796383_2797817_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	8.8e-32
>prophage 211
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2801801	2812341	4941290	tRNA	Brevibacillus_phage(16.67%)	12	NA	NA
AVS12252.1|2801801_2802698_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	7.9e-31
AVS12253.1|2802721_2803435_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVS12254.1|2803440_2805174_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	3.1e-63
AVS12255.1|2805278_2806376_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AVS12256.1|2806386_2807904_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AVS12257.1|2807979_2808525_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVS12258.1|2808575_2808764_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12259.1|2808789_2809548_+	endopeptidase	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AVS12260.1|2809832_2810639_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AVS14390.1|2811434_2811623_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12261.1|2811573_2811759_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12262.1|2811804_2812341_+	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	5.6e-16
>prophage 212
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2827051	2829585	4941290		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVS12278.1|2827051_2827813_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.9e-19
AVS12279.1|2828166_2829585_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	2.7e-25
>prophage 213
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2840415	2847370	4941290		Moraxella_phage(33.33%)	6	NA	NA
AVS12289.1|2840415_2841129_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
AVS12290.1|2841310_2842006_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVS12291.1|2842688_2843219_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVS12292.1|2843231_2845478_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AVS12293.1|2845693_2846569_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVS12294.1|2846575_2847370_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
>prophage 214
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2852852	2869431	4941290	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AVS12301.1|2852852_2855741_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.8	1.6e-61
AVS12302.1|2855733_2859279_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
AVS12303.1|2859275_2861111_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	1.9e-18
AVS12304.1|2861213_2862545_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVS12305.1|2862777_2864031_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
AVS12306.1|2864530_2865628_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVS12307.1|2865737_2866544_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.1e-15
AVS14391.1|2866595_2867483_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AVS12308.1|2867782_2868226_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVS12309.1|2868225_2869431_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
>prophage 215
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2880974	2881790	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS12321.1|2880974_2881790_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 216
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2886656	2887505	4941290		Vibrio_phage(100.0%)	1	NA	NA
AVS12325.1|2886656_2887505_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 217
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2894925	2900221	4941290		Streptococcus_phage(33.33%)	3	NA	NA
AVS12334.1|2894925_2896068_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
AVS12335.1|2896111_2898868_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
AVS12336.1|2898925_2900221_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.8e-36
>prophage 218
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2912655	2916481	4941290		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
AVS12349.1|2912655_2914293_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
AVS12350.1|2914375_2915674_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
AVS12351.1|2915809_2916481_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	2.3e-14
>prophage 219
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2940592	2942624	4941290		Hokovirus(50.0%)	2	NA	NA
AVS12367.1|2940592_2942032_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.5	3.6e-33
AVS12368.1|2942018_2942624_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
>prophage 220
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2945734	2956161	4941290		Escherichia_phage(50.0%)	12	NA	NA
AVS12374.1|2945734_2946496_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
AVS12375.1|2946489_2947116_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AVS12376.1|2947291_2948425_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AVS12377.1|2948487_2949480_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVS12378.1|2949524_2949761_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12379.1|2949771_2951199_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AVS12380.1|2951198_2951792_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AVS12381.1|2951962_2952367_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVS12382.1|2952385_2953150_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
AVS12383.1|2953346_2954270_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.1	8.2e-116
AVS12384.1|2954263_2955526_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.5	1.5e-131
AVS12385.1|2955522_2956161_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
>prophage 221
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2962127	2967928	4941290		Catovirus(50.0%)	5	NA	NA
AVS12392.1|2962127_2964695_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
AVS12393.1|2964853_2965264_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVS12394.1|2965837_2966506_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12395.1|2966532_2967027_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12396.1|2967271_2967928_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	47.4	5.0e-51
>prophage 222
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	2973418	2975107	4941290		Vibrio_phage(100.0%)	1	NA	NA
AVS12403.1|2973418_2975107_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 223
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3008609	3009431	4941290		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVS12438.1|3008609_3009431_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 224
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3033345	3034311	4941290		Tetraselmis_virus(100.0%)	1	NA	NA
AVS12463.1|3033345_3034311_-	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	3.0e-36
>prophage 225
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3040217	3047471	4941290	tRNA	Pseudomonas_phage(20.0%)	8	NA	NA
AVS14398.1|3040217_3040715_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
AVS12472.1|3040799_3041861_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AVS12473.1|3041977_3042478_+	recombination regulator RecX	NA	NA	NA	NA	NA
AVS12474.1|3042474_3042681_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12475.1|3042713_3045344_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
AVS12476.1|3045578_3045764_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVS12477.1|3045776_3046052_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12478.1|3046904_3047471_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
>prophage 226
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3059307	3064362	4941290		Bacillus_virus(25.0%)	4	NA	NA
AVS12489.1|3059307_3060510_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
AVS12490.1|3060864_3061824_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	1.8e-129
AVS12491.1|3061834_3063979_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.6	2.9e-196
AVS12492.1|3063951_3064362_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
>prophage 227
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3071061	3075069	4941290		Clostridium_phage(50.0%)	4	NA	NA
AVS12506.1|3071061_3071511_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
AVS12507.1|3071532_3072210_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AVS12508.1|3072251_3073652_-	GABA permease	NA	NA	NA	NA	NA
AVS12509.1|3073785_3075069_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
>prophage 228
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3095436	3099093	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS12527.1|3095436_3099093_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	7.9e-45
>prophage 229
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3104815	3106024	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS12533.1|3104815_3106024_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 230
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3112559	3114740	4941290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS12536.1|3112559_3114740_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 231
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3127926	3130448	4941290	transposase	Salmonella_phage(50.0%)	2	NA	NA
AVS12539.1|3127926_3129189_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS14400.1|3129965_3130448_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 232
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3142216	3145458	4941290		Pseudomonas_phage(50.0%)	3	NA	NA
AVS12553.1|3142216_3143437_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
AVS12554.1|3143429_3143948_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVS12555.1|3144387_3145458_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 233
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3152243	3154817	4941290		Enterobacteria_phage(100.0%)	1	NA	NA
AVS12563.1|3152243_3154817_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
>prophage 234
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3160772	3162633	4941290		Prochlorococcus_phage(50.0%)	2	NA	NA
AVS12565.1|3160772_3161228_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AVS12566.1|3161331_3162633_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
>prophage 235
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3167932	3174103	4941290	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
AVS12571.1|3167932_3168352_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AVS12572.1|3168555_3169593_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVS12573.1|3169708_3170398_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AVS12574.1|3170716_3171100_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AVS12575.1|3171161_3171749_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AVS14404.1|3171851_3172751_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS12576.1|3172768_3174103_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
>prophage 236
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3179941	3187787	4941290		Streptococcus_phage(25.0%)	9	NA	NA
AVS12584.1|3179941_3181741_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AVS12585.1|3181757_3182732_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVS12586.1|3183005_3183686_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AVS12587.1|3183682_3184588_+	GTPase Era	NA	NA	NA	NA	NA
AVS12588.1|3184599_3185328_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVS12589.1|3185339_3186071_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVS12590.1|3186070_3186451_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVS12591.1|3186562_3186823_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
AVS12592.1|3186860_3187787_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
>prophage 237
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3196371	3206362	4941290		Bacillus_phage(50.0%)	6	NA	NA
AVS12601.1|3196371_3200259_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	6.1e-128
AVS12602.1|3200952_3202338_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AVS12603.1|3202339_3203104_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVS12604.1|3203100_3204438_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AVS12605.1|3204514_3204853_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVS12606.1|3204901_3206362_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
>prophage 238
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3213577	3214831	4941290		Aeromonas_phage(100.0%)	1	NA	NA
AVS12611.1|3213577_3214831_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 239
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3222250	3232202	4941290	tRNA	Heterosigma_akashiwo_virus(16.67%)	12	NA	NA
AVS12619.1|3222250_3223129_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
AVS12620.1|3223273_3224077_-	inositol monophosphatase	NA	NA	NA	NA	NA
AVS12621.1|3224195_3224927_+|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVS12622.1|3225086_3225581_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AVS12623.1|3225761_3226976_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
AVS12624.1|3227003_3227390_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AVS12625.1|3227418_3227742_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AVS12626.1|3227937_3228453_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVS12627.1|3228465_3230316_+	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.5	3.6e-102
AVS12628.1|3230317_3230653_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVS12629.1|3230664_3230865_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVS12630.1|3230918_3232202_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 240
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3243000	3248249	4941290		Escherichia_phage(66.67%)	5	NA	NA
AVS12638.1|3243000_3245406_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.4	3.0e-141
AVS12639.1|3245402_3246032_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	56.4	5.5e-63
AVS12640.1|3246024_3246834_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVS12641.1|3246833_3247697_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVS12642.1|3247817_3248249_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
>prophage 241
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3267485	3275963	4941290		Escherichia_phage(33.33%)	3	NA	NA
AVS12655.1|3267485_3272825_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	25.8	8.3e-35
AVS12656.1|3272986_3274336_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
AVS12657.1|3274496_3275963_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 242
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3285757	3287260	4941290		Escherichia_phage(100.0%)	3	NA	NA
AVS12666.1|3285757_3286297_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	77.7	1.0e-25
AVS12667.1|3286312_3286831_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	85.4	2.4e-48
AVS12668.1|3287068_3287260_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 243
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3293722	3298997	4941290		Prochlorococcus_phage(25.0%)	6	NA	NA
AVS12673.1|3293722_3294361_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.4	9.6e-31
AVS14407.1|3294360_3295398_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AVS12674.1|3295811_3296438_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVS12675.1|3296525_3297815_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	8.6e-63
AVS12676.1|3297885_3298611_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AVS12677.1|3298637_3298997_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
>prophage 244
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3304580	3305720	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS12682.1|3304580_3305720_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.8	5.5e-45
>prophage 245
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3309058	3309772	4941290		Synechococcus_phage(100.0%)	1	NA	NA
AVS12687.1|3309058_3309772_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 246
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3328395	3329346	4941290		Cyanophage(100.0%)	1	NA	NA
AVS12701.1|3328395_3329346_-	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 247
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3349961	3360980	4941290	transposase	Paenibacillus_phage(16.67%)	12	NA	NA
AVS12724.1|3349961_3350831_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
AVS12725.1|3350932_3351469_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVS12726.1|3351455_3351905_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVS12727.1|3351966_3352542_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVS12728.1|3352636_3353536_+	iron-dependent peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AVS12729.1|3353773_3354565_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AVS12730.1|3354722_3355739_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVS12731.1|3355738_3356572_+	sulfate ABC transporter permease	NA	NA	NA	NA	NA
AVS12732.1|3356571_3357447_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AVS12733.1|3357436_3358534_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	32.7	2.1e-25
AVS12734.1|3358601_3359513_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
AVS12735.1|3359869_3360980_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	4.9e-06
>prophage 248
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3366388	3376238	4941290		Hokovirus(25.0%)	9	NA	NA
AVS12744.1|3366388_3368116_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
AVS12745.1|3368164_3368422_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVS12746.1|3368805_3369777_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
AVS12747.1|3369940_3370702_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVS12748.1|3370933_3371920_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVS12749.1|3371991_3374007_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.9	8.8e-147
AVS12750.1|3374008_3374227_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12751.1|3374223_3375222_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVS12752.1|3375311_3376238_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	1.5e-08
>prophage 249
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3397530	3398451	4941290		Morganella_phage(100.0%)	1	NA	NA
AVS12772.1|3397530_3398451_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 250
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3405980	3474590	4941290	capsid,lysis,terminase,portal,head,tail,tRNA,protease	Salmonella_phage(54.84%)	93	NA	NA
AVS12780.1|3405980_3406919_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
AVS14410.1|3407180_3407384_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	56.7	7.3e-17
AVS12781.1|3407497_3407743_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12782.1|3407852_3408095_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AVS12783.1|3408057_3409131_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	67.6	2.0e-142
AVS12784.1|3409130_3409352_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	54.3	1.6e-14
AVS12785.1|3409642_3410194_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	59.4	8.8e-57
AVS12786.1|3410357_3410642_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12787.1|3410655_3411135_-	hypothetical protein	NA	Q716E9	Shigella_phage	91.2	9.3e-87
AVS12788.1|3411143_3411602_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	89.0	2.6e-70
AVS12789.1|3411602_3412310_-	recombinase	NA	E7C9Q0	Salmonella_phage	96.2	7.9e-135
AVS12790.1|3412317_3412506_-	hypothetical protein	NA	C6ZR38	Salmonella_phage	82.3	1.7e-23
AVS12791.1|3412593_3412788_-	hypothetical protein	NA	M9NZE2	Enterobacteria_phage	38.3	4.7e-05
AVS12792.1|3412992_3413247_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12793.1|3413397_3414516_-	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	71.2	9.5e-66
AVS12794.1|3414592_3415189_-	hypothetical protein	NA	V5URU3	Shigella_phage	50.0	6.2e-48
AVS12795.1|3415191_3415494_-	regulator	NA	B8K1E6	Salmonella_phage	93.0	3.5e-47
AVS12796.1|3416074_3416278_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	98.5	2.0e-27
AVS12797.1|3416421_3417444_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	40.9	6.2e-72
AVS12798.1|3417494_3418181_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	76.7	1.9e-93
AVS12799.1|3418290_3418518_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	80.0	8.7e-27
AVS12800.1|3418626_3418917_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	97.9	4.5e-44
AVS12801.1|3418939_3419212_+	hypothetical protein	NA	G9L679	Escherichia_phage	96.7	3.9e-42
AVS14411.1|3419274_3420162_+	replication protein	NA	G9L680	Escherichia_phage	98.0	9.9e-143
AVS12802.1|3420158_3421535_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	99.8	4.3e-254
AVS12803.1|3421607_3421814_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	97.1	1.2e-30
AVS14412.1|3421828_3422023_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12804.1|3422034_3422298_+	hypothetical protein	NA	I6R992	Salmonella_phage	67.8	2.5e-25
AVS12805.1|3422562_3422859_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	98.0	2.0e-47
AVS12806.1|3422815_3423262_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
AVS12807.1|3423258_3423435_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	96.6	1.9e-26
AVS12808.1|3423437_3423779_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
AVS12809.1|3423771_3423948_+	protein ninF	NA	Q76H71	Enterobacteria_phage	96.6	1.5e-26
AVS12810.1|3423940_3424546_+	recombination protein NinG	NA	G9L693	Escherichia_phage	97.0	8.1e-96
AVS12811.1|3424542_3424767_+	protein ninY	NA	Q76H69	Enterobacteria_phage	98.6	4.1e-37
AVS12812.1|3424763_3424967_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
AVS12813.1|3424947_3425127_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
AVS12814.1|3425123_3425888_+	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	97.6	8.0e-141
AVS12815.1|3426279_3426552_+	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	100.0	1.1e-41
AVS12816.1|3426551_3427049_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	93.3	1.9e-87
AVS12817.1|3427137_3427605_+|lysis	lysis protein	lysis	I6RSQ8	Salmonella_phage	96.8	2.5e-73
AVS12818.1|3427723_3428068_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
AVS12819.1|3428200_3428665_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
AVS12820.1|3428618_3430361_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.6e-141
AVS12821.1|3430360_3431668_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	3.8e-215
AVS12822.1|3431681_3432530_+	peptidase S14	NA	K7PH05	Enterobacteria_phage	87.9	1.3e-131
AVS12823.1|3432539_3433757_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.6	1.0e-198
AVS12824.1|3433800_3433998_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.2e-10
AVS12825.1|3433997_3434324_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
AVS12826.1|3434333_3434672_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
AVS12827.1|3434668_3435118_+	hypothetical protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
AVS12828.1|3435114_3435462_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	97.4	3.2e-57
AVS12829.1|3435518_3436223_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	74.4	4.4e-93
AVS12830.1|3436250_3436622_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
AVS14413.1|3436645_3436924_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
AVS12831.1|3436980_3437316_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
AVS12832.1|3437362_3440677_+|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	96.0	0.0e+00
AVS12833.1|3440722_3441082_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12834.1|3441070_3441295_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12835.1|3441460_3442054_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	3.1e-108
AVS12836.1|3442053_3442638_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.6e-104
AVS12837.1|3442644_3443043_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	2.9e-70
AVS12838.1|3443042_3445754_+|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	94.4	0.0e+00
AVS12839.1|3445762_3446722_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.7	2.8e-183
AVS12840.1|3446732_3447863_+|tail	phage tail protein	tail	S4TSP4	Salmonella_phage	99.2	1.1e-202
AVS12841.1|3448069_3448183_-	virulence protein	NA	S4TND2	Salmonella_phage	83.8	2.1e-10
AVS12842.1|3448210_3449380_-	DUF4102 domain-containing protein	NA	C6ZR22	Salmonella_phage	90.0	2.3e-211
AVS12843.1|3449694_3450636_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
AVS12844.1|3450924_3451680_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AVS12845.1|3451740_3453048_-	long-chain fatty acid transporter	NA	NA	NA	NA	NA
AVS12846.1|3453418_3453703_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AVS12847.1|3453880_3455191_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AVS12848.1|3455190_3457338_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AVS12849.1|3457546_3458032_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AVS12850.1|3458131_3458683_-	endonuclease SmrB	NA	NA	NA	NA	NA
AVS12851.1|3458848_3459781_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS12852.1|3459816_3460902_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
AVS12853.1|3460905_3461730_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AVS12854.1|3461729_3462539_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12855.1|3462538_3463087_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AVS12856.1|3463119_3463395_+	YfcL family protein	NA	NA	NA	NA	NA
AVS12857.1|3463446_3465507_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AVS12858.1|3465606_3466821_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AVS12859.1|3466918_3467575_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVS12860.1|3467641_3468160_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
AVS12861.1|3468159_3468378_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12862.1|3468371_3468554_-	DNA-binding protein	NA	NA	NA	NA	NA
AVS12863.1|3468726_3469101_+	hypothetical protein	NA	NA	NA	NA	NA
AVS12864.1|3469280_3470459_+	MFS transporter	NA	NA	NA	NA	NA
AVS12865.1|3470455_3471457_-	flagella biosynthesis regulator	NA	NA	NA	NA	NA
AVS12866.1|3471560_3472697_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.0e-22
AVS12867.1|3472764_3473778_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AVS12868.1|3473777_3474590_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 251
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3479199	3480717	4941290		Mollivirus(100.0%)	1	NA	NA
AVS12874.1|3479199_3480717_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 252
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3492146	3492920	4941290		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVS14414.1|3492146_3492920_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 253
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3496648	3497668	4941290		Enterobacteria_phage(100.0%)	1	NA	NA
AVS12891.1|3496648_3497668_-	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 254
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3508474	3511746	4941290		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVS12903.1|3508474_3509152_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
AVS12904.1|3509228_3511055_+	SLC13 family permease	NA	NA	NA	NA	NA
AVS12905.1|3511146_3511746_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	1.2e-06
>prophage 255
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3531067	3543097	4941290		Escherichia_phage(50.0%)	3	NA	NA
AVS12923.1|3531067_3539566_+	AIDA autotransporter-like protein ShdA	NA	A0A2L1IV18	Escherichia_phage	26.4	3.5e-43
AVS12924.1|3540273_3542055_+	DUF3520 domain-containing protein	NA	NA	NA	NA	NA
AVS12925.1|3542095_3543097_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-28
>prophage 256
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3555664	3560673	4941290		Tupanvirus(50.0%)	4	NA	NA
AVS12940.1|3555664_3557647_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
AVS12941.1|3557643_3558627_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AVS12942.1|3558629_3559787_-	UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.7e-31
AVS12943.1|3560067_3560673_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
>prophage 257
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3564320	3565526	4941290		Oenococcus_phage(100.0%)	1	NA	NA
AVS14416.1|3564320_3565526_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	3.5e-26
>prophage 258
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3575150	3582351	4941290		Pseudomonas_phage(50.0%)	6	NA	NA
AVS12956.1|3575150_3576221_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AVS12957.1|3576336_3577215_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS12958.1|3577376_3578567_+	MFS transporter	NA	NA	NA	NA	NA
AVS12959.1|3578568_3578823_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AVS12960.1|3578822_3579953_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AVS12961.1|3580065_3582351_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	1.3e-282
>prophage 259
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3585791	3593004	4941290		Oenococcus_phage(33.33%)	4	NA	NA
AVS12965.1|3585791_3586994_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.0	7.8e-58
AVS12966.1|3587093_3587324_-	hypothetical protein	NA	NA	NA	NA	NA
AVS12967.1|3587403_3590040_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.8	1.1e-93
AVS12968.1|3590157_3593004_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	7.1e-41
>prophage 260
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3597171	3602989	4941290		Enterobacteria_phage(33.33%)	5	NA	NA
AVS12972.1|3597171_3598308_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
AVS12973.1|3598422_3599475_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AVS12974.1|3599555_3600617_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	3.1e-18
AVS12975.1|3600619_3601270_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AVS12976.1|3601345_3602989_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	5.7e-11
>prophage 261
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3610071	3610689	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS12985.1|3610071_3610689_+	cytochrome c biogenesis ATP-binding export protein CcmA 1	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	3.7e-11
>prophage 262
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3621184	3629511	4941290		Vibrio_phage(50.0%)	9	NA	NA
AVS12998.1|3621184_3622192_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AVS12999.1|3622219_3622840_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13000.1|3622948_3623233_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVS13001.1|3623357_3625118_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
AVS13002.1|3625269_3625965_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AVS13003.1|3625992_3627183_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.2	5.4e-19
AVS13004.1|3627214_3627409_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13005.1|3627573_3627918_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13006.1|3627921_3629511_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	2.5e-19
>prophage 263
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3635435	3636008	4941290		Clostridioides_phage(100.0%)	1	NA	NA
AVS13012.1|3635435_3636008_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 264
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3646148	3647006	4941290		Catovirus(100.0%)	1	NA	NA
AVS13024.1|3646148_3647006_-	endonuclease	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
>prophage 265
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3651983	3652688	4941290	transposase	Escherichia_phage(100.0%)	1	NA	NA
AVS13028.1|3651983_3652688_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 266
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3659380	3660049	4941290		Cellulophaga_phage(100.0%)	1	NA	NA
AVS13035.1|3659380_3660049_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	5.3e-56
>prophage 267
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3664008	3665529	4941290		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVS13038.1|3664008_3665529_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 268
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3691582	3700753	4941290	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVS13065.1|3691582_3692530_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
AVS13066.1|3692513_3693245_+	ABC transporter permease	NA	NA	NA	NA	NA
AVS13067.1|3693225_3693333_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13068.1|3693392_3694124_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVS13069.1|3694346_3696032_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVS13070.1|3696028_3696748_+	two-component system response regulator YehT	NA	NA	NA	NA	NA
AVS13071.1|3696794_3697262_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVS13072.1|3697318_3697849_-	lipoprotein	NA	NA	NA	NA	NA
AVS13073.1|3698020_3698479_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVS13074.1|3698719_3700753_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 269
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3717951	3720809	4941290		Salmonella_phage(50.0%)	2	NA	NA
AVS13092.1|3717951_3718998_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	75.8	2.4e-148
AVS14420.1|3719447_3720809_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 270
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3731665	3731896	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS13104.1|3731665_3731896_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	64.9	6.1e-20
>prophage 271
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3737905	3744517	4941290		Bacillus_phage(66.67%)	4	NA	NA
AVS13109.1|3737905_3738628_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
AVS13110.1|3738624_3740028_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
AVS13111.1|3740027_3741440_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
AVS13112.1|3741436_3744517_-	multidrug transporter subunit MdtC	NA	S5VTK5	Leptospira_phage	23.2	1.4e-63
>prophage 272
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3754965	3764265	4941290		Catovirus(25.0%)	8	NA	NA
AVS13118.1|3754965_3755607_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
AVS13119.1|3755697_3756279_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AVS13120.1|3756317_3758174_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVS13121.1|3758259_3759840_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AVS13122.1|3760195_3760432_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13123.1|3760514_3761654_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVS13124.1|3761659_3762109_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVS13125.1|3762105_3764265_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
>prophage 273
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3769440	3776146	4941290		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
AVS13132.1|3769440_3770562_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
AVS13133.1|3770564_3771530_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
AVS13134.1|3771532_3772006_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVS13135.1|3772002_3773226_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVS13136.1|3773222_3774665_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	9.4e-50
AVS13137.1|3774775_3776146_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	5.8e-33
>prophage 274
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3781703	3788000	4941290		Enterobacteria_phage(50.0%)	6	NA	NA
AVS13142.1|3781703_3783107_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	2.3e-21
AVS13143.1|3783284_3784178_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVS13144.1|3784554_3785640_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AVS13145.1|3785639_3786539_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
AVS13146.1|3786586_3787465_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.0e-107
AVS13147.1|3787469_3788000_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.5	1.4e-51
>prophage 275
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3793281	3794721	4941290		Hokovirus(100.0%)	1	NA	NA
AVS13152.1|3793281_3794721_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	2.2e-54
>prophage 276
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3797806	3800615	4941290		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVS13155.1|3797806_3799213_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
AVS13156.1|3799448_3800615_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.7	6.3e-113
>prophage 277
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3808058	3808958	4941290		Cellulophaga_phage(100.0%)	1	NA	NA
AVS13165.1|3808058_3808958_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 278
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3817643	3822570	4941290		Escherichia_phage(66.67%)	4	NA	NA
AVS13171.1|3817643_3819920_+	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.0	6.5e-37
AVS13172.1|3819934_3820513_+	thiosulfate reductase electron transporter PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
AVS13173.1|3820509_3821274_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVS13174.1|3821397_3822570_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.2	5.8e-199
>prophage 279
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3842271	3843066	4941290		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVS13199.1|3842271_3843066_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.8	2.1e-11
>prophage 280
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3856577	3857393	4941290		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVS13215.1|3856577_3857393_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	1.6e-09
>prophage 281
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3863415	3863892	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS13223.1|3863415_3863892_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.5	5.1e-37
>prophage 282
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3867177	3870439	4941290		Dichelobacter_phage(50.0%)	3	NA	NA
AVS13227.1|3867177_3867480_-	DUF4102 domain-containing protein	NA	A7X7X0	Dichelobacter_phage	51.9	2.9e-09
AVS13228.1|3867880_3869338_+	FMN/FAD transporter	NA	NA	NA	NA	NA
AVS13229.1|3869974_3870439_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	34.7	1.5e-09
>prophage 283
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3879111	3880574	4941290		Escherichia_phage(50.0%)	2	NA	NA
AVS13234.1|3879111_3879636_-	peptidase	NA	G9L6C4	Escherichia_phage	77.7	1.3e-36
AVS13235.1|3880283_3880574_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	47.4	3.4e-07
>prophage 284
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3887063	3893586	4941290		Vibrio_phage(25.0%)	6	NA	NA
AVS13241.1|3887063_3887291_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.9	2.0e-15
AVS13242.1|3887411_3887672_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS14429.1|3887775_3888036_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVS13243.1|3888129_3889392_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	36.6	5.1e-68
AVS13244.1|3890350_3892024_+	DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	30.7	8.7e-31
AVS13245.1|3892020_3893586_+	type I restriction endonuclease	NA	J7I0U9	Acinetobacter_phage	46.6	1.4e-35
>prophage 285
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3897233	3900577	4941290	transposase	Enterobacteria_phage(66.67%)	4	NA	NA
AVS13248.1|3897233_3898406_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	81.0	2.4e-189
AVS13249.1|3898405_3899206_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	90.9	1.7e-130
AVS13250.1|3899113_3899344_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13251.1|3899629_3900577_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.6	1.4e-54
>prophage 286
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3917302	3917488	4941290		Vibrio_phage(100.0%)	1	NA	NA
AVS13274.1|3917302_3917488_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
>prophage 287
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3925054	3949710	4941290		Bacillus_phage(40.0%)	8	NA	NA
AVS13280.1|3925054_3934546_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AVS13281.1|3934633_3940741_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AVS13282.1|3940931_3941891_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AVS13283.1|3942057_3943860_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.8	2.9e-32
AVS13284.1|3943846_3945649_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
AVS13285.1|3945641_3946922_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AVS13286.1|3946949_3948254_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AVS13287.1|3948447_3949710_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.3	1.1e-73
>prophage 288
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3954788	3958938	4941290	transposase	Bluetongue_virus(50.0%)	3	NA	NA
AVS13292.1|3954788_3955997_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AVS13293.1|3956606_3957428_+	FRG domain-containing protein	NA	NA	NA	NA	NA
AVS13294.1|3957682_3958938_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
>prophage 289
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3967290	3968124	4941290		Pelagibacter_phage(100.0%)	1	NA	NA
AVS13305.1|3967290_3968124_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 290
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3972277	3972817	4941290		Scale_drop_disease_virus(100.0%)	1	NA	NA
AVS13314.1|3972277_3972817_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.0	2.9e-28
>prophage 291
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3981880	3982801	4941290		Morganella_phage(100.0%)	1	NA	NA
AVS13321.1|3981880_3982801_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	1.1e-54
>prophage 292
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	3987459	3987705	4941290		Salmonella_phage(100.0%)	1	NA	NA
AVS13329.1|3987459_3987705_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 293
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4003717	4004668	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS13349.1|4003717_4004668_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A160LKR7	Bacillus_phage	36.5	2.2e-10
>prophage 294
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4018485	4019612	4941290		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVS13363.1|4018485_4019220_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.3e-15
AVS13364.1|4019375_4019612_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 295
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4022886	4023528	4941290		Pseudomonas_phage(100.0%)	1	NA	NA
AVS13368.1|4022886_4023528_+	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	4.2e-26
>prophage 296
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4036692	4036950	4941290		Erwinia_phage(100.0%)	1	NA	NA
AVS13380.1|4036692_4036950_+	outer membrane protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 297
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4043135	4046867	4941290		Planktothrix_phage(50.0%)	4	NA	NA
AVS13384.1|4043135_4043837_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
AVS13385.1|4043836_4045081_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVS13386.1|4045109_4046027_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVS13387.1|4046045_4046867_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
>prophage 298
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4050453	4054163	4941290	transposase	Mycoplasma_phage(33.33%)	3	NA	NA
AVS13391.1|4050453_4051317_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
AVS13392.1|4051300_4052437_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AVS13393.1|4052900_4054163_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 299
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4061844	4063215	4941290		Bodo_saltans_virus(100.0%)	1	NA	NA
AVS13401.1|4061844_4063215_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	4.2e-108
>prophage 300
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4066742	4067993	4941290		Phage_21(100.0%)	1	NA	NA
AVS13406.1|4066742_4067993_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 301
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4072496	4075825	4941290		Enterobacteria_phage(50.0%)	7	NA	NA
AVS13410.1|4072496_4072736_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	84.8	1.2e-31
AVS13411.1|4072916_4073438_-	lipoprotein EnvE	NA	NA	NA	NA	NA
AVS13412.1|4073853_4074066_-	cold-shock protein CspH	NA	NA	NA	NA	NA
AVS13413.1|4074197_4074461_-	virulence factor	NA	NA	NA	NA	NA
AVS13414.1|4074509_4074701_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13415.1|4075036_4075234_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13416.1|4075267_4075825_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
>prophage 302
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4080465	4080996	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS13424.1|4080465_4080996_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 303
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4084802	4086065	4941290	transposase	Salmonella_phage(100.0%)	1	NA	NA
AVS13428.1|4084802_4086065_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 304
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4104395	4107816	4941290		Bacillus_phage(100.0%)	3	NA	NA
AVS13453.1|4104395_4105889_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	1.5e-10
AVS13454.1|4106182_4106380_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13455.1|4106529_4107816_-	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 305
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4117226	4117883	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS13464.1|4117226_4117883_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.8	9.6e-18
>prophage 306
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4122768	4124718	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS13469.1|4122768_4124718_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	2.4e-40
>prophage 307
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4128305	4129532	4941290		Klosneuvirus(100.0%)	1	NA	NA
AVS13475.1|4128305_4129532_+	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 308
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4136230	4137058	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS13483.1|4136230_4137058_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 309
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4143225	4145478	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS13491.1|4143225_4145478_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.6	2.5e-142
>prophage 310
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4155757	4175387	4941290	tRNA	Tupanvirus(22.22%)	19	NA	NA
AVS13504.1|4155757_4157686_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AVS13505.1|4157689_4158232_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AVS13506.1|4158327_4158525_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVS13507.1|4158575_4158932_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVS14437.1|4159052_4159097_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVS13508.1|4159233_4160217_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVS13509.1|4160232_4162620_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVS13510.1|4162624_4162924_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVS13511.1|4163126_4164107_+	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVS13512.1|4164198_4164750_+	glutathione peroxidase	NA	NA	NA	NA	NA
AVS13513.1|4164749_4165499_+	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AVS13514.1|4165575_4166040_+	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AVS13515.1|4166353_4167067_+	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AVS13516.1|4167128_4168571_+	YdiU family protein	NA	NA	NA	NA	NA
AVS13517.1|4168606_4168798_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVS13518.1|4168954_4170001_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.3	1.7e-80
AVS13519.1|4170156_4170990_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVS13520.1|4171326_4173705_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
AVS13521.1|4173746_4175387_-	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
>prophage 311
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4197751	4200961	4941290		Cedratvirus(50.0%)	3	NA	NA
AVS13541.1|4197751_4198498_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
AVS13542.1|4198472_4199744_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVS13543.1|4199740_4200961_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
>prophage 312
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4207901	4209110	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS13552.1|4207901_4209110_-|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 313
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4220152	4224491	4941290		Enterobacteria_phage(50.0%)	3	NA	NA
AVS13561.1|4220152_4220881_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
AVS13562.1|4221059_4221698_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVS13563.1|4221728_4224491_-	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.5	2.7e-29
>prophage 314
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4247153	4254577	4941290		Orpheovirus(20.0%)	8	NA	NA
AVS13591.1|4247153_4247795_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
AVS13592.1|4247836_4248985_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
AVS13593.1|4249274_4250480_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVS13594.1|4250592_4251525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS13595.1|4251521_4252547_-	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AVS13596.1|4252842_4252932_+	YnhF family membrane protein	NA	NA	NA	NA	NA
AVS13597.1|4253014_4253596_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
AVS13598.1|4253722_4254577_-	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
>prophage 315
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4259651	4260173	4941290		Salmonella_phage(100.0%)	1	NA	NA
AVS13606.1|4259651_4260173_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	4.0e-51
>prophage 316
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4267089	4268364	4941290	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVS13615.1|4267089_4268364_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 317
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4290574	4294997	4941290		Bacillus_phage(50.0%)	3	NA	NA
AVS13634.1|4290574_4291876_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.4	2.2e-13
AVS13635.1|4291986_4293693_-	amidohydrolase	NA	NA	NA	NA	NA
AVS13636.1|4293845_4294997_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	1.2e-116
>prophage 318
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4312710	4331993	4941290		Escherichia_phage(40.0%)	19	NA	NA
AVS13655.1|4312710_4313859_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
AVS13656.1|4313858_4314506_-	osmoprotectant import permease OsmW	NA	NA	NA	NA	NA
AVS13657.1|4314515_4315418_-	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AVS13658.1|4315446_4316157_-	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
AVS13659.1|4316461_4317076_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	2.1e-27
AVS13660.1|4317118_4317976_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVS13661.1|4317977_4318595_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
AVS13662.1|4318605_4321041_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.1	4.6e-206
AVS13663.1|4321139_4323578_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
AVS13664.1|4323734_4324043_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AVS13665.1|4324146_4324857_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVS13666.1|4324897_4325458_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVS13667.1|4325493_4325835_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AVS13668.1|4325987_4326314_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
AVS13669.1|4326435_4327650_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	2.0e-45
AVS13670.1|4327660_4328680_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AVS13671.1|4328733_4330113_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.9	1.8e-29
AVS13672.1|4330256_4331723_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	1.9e-42
AVS13673.1|4331789_4331993_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 319
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4341279	4341714	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS13685.1|4341279_4341714_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 320
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4350599	4351718	4941290		Enterobacteria_phage(100.0%)	1	NA	NA
AVS13695.1|4350599_4351718_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 321
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4370749	4371034	4941290		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVS13714.1|4370749_4371034_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	2.6e-20
>prophage 322
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4396443	4397454	4941290		Tupanvirus(100.0%)	1	NA	NA
AVS13736.1|4396443_4397454_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 323
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4403818	4404901	4941290		Enterobacteria_phage(100.0%)	1	NA	NA
AVS13741.1|4403818_4404901_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	71.8	3.3e-140
>prophage 324
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4413063	4414608	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS13747.1|4413063_4414608_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 325
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4422549	4424670	4941290		Salmonella_phage(100.0%)	1	NA	NA
AVS13757.1|4422549_4424670_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 326
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4442266	4444231	4941290	protease	Phage_TP(100.0%)	1	NA	NA
AVS13774.1|4442266_4444231_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 327
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4460333	4467423	4941290		Megavirus(33.33%)	6	NA	NA
AVS13792.1|4460333_4461842_-	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.0	3.2e-32
AVS13793.1|4461890_4463234_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AVS13794.1|4463526_4464450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS13795.1|4464510_4466136_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
AVS13796.1|4466134_4466350_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13797.1|4466304_4467423_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	8.9e-32
>prophage 328
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4470762	4476176	4941290		Escherichia_phage(50.0%)	3	NA	NA
AVS13801.1|4470762_4471293_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	9.1e-19
AVS13802.1|4471409_4472210_-	YdcF family protein	NA	NA	NA	NA	NA
AVS14449.1|4472273_4476176_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.7	5.0e-53
>prophage 329
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4480968	4481958	4941290		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVS13808.1|4480968_4481958_+	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 330
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4487070	4499139	4941290	tRNA	Escherichia_phage(28.57%)	13	NA	NA
AVS13813.1|4487070_4487505_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
AVS13814.1|4487557_4487896_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVS13815.1|4487888_4487999_-	multidrug transporter	NA	NA	NA	NA	NA
AVS13816.1|4488170_4491593_-	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.5	0.0e+00
AVS13817.1|4492037_4492175_+	hypothetical protein	NA	A0A0U2JGI6	Escherichia_phage	97.8	8.0e-20
AVS13818.1|4492269_4493205_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
AVS13819.1|4493248_4494622_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
AVS13820.1|4494650_4494833_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13821.1|4495108_4496092_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AVS13822.1|4496237_4497392_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	2.6e-10
AVS13823.1|4497642_4497822_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13824.1|4497802_4498366_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AVS13825.1|4498623_4499139_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
>prophage 331
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4509352	4510210	4941290		Streptococcus_phage(100.0%)	1	NA	NA
AVS13837.1|4509352_4510210_+	hypothetical protein	NA	D0R0F8	Streptococcus_phage	29.1	6.9e-08
>prophage 332
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4513761	4514631	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS13842.1|4513761_4514631_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.9e-51
>prophage 333
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4518899	4529697	4941290		Escherichia_phage(66.67%)	9	NA	NA
AVS13846.1|4518899_4519676_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.2	2.4e-12
AVS13847.1|4519855_4521160_-	transporter	NA	NA	NA	NA	NA
AVS13848.1|4521304_4522492_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.3	2.1e-47
AVS13849.1|4522736_4523516_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS13850.1|4523840_4524764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVS13851.1|4525124_4527554_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	46.4	3.9e-197
AVS13852.1|4527564_4528182_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.1	4.0e-74
AVS13853.1|4528183_4529041_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.2	3.8e-22
AVS13854.1|4529082_4529697_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	33.3	5.8e-25
>prophage 334
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4546978	4547785	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS13873.1|4546978_4547785_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 335
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4553288	4557467	4941290		Bodo_saltans_virus(50.0%)	3	NA	NA
AVS13879.1|4553288_4555223_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.8	6.5e-06
AVS13880.1|4555248_4555470_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14453.1|4555484_4557467_+	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.6	1.0e-17
>prophage 336
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4563051	4563642	4941290		Staphylococcus_phage(100.0%)	1	NA	NA
AVS13890.1|4563051_4563642_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 337
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4568735	4574074	4941290	protease	Tupanvirus(33.33%)	4	NA	NA
AVS13896.1|4568735_4571333_-	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
AVS13897.1|4571735_4571987_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13898.1|4572028_4573075_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AVS13899.1|4573312_4574074_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
>prophage 338
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4579055	4582013	4941290		Acinetobacter_phage(100.0%)	2	NA	NA
AVS13905.1|4579055_4580651_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.1	2.0e-53
AVS13906.1|4580654_4582013_+	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
>prophage 339
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4593676	4596569	4941290		Lactobacillus_phage(33.33%)	3	NA	NA
AVS13921.1|4593676_4594513_-	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
AVS13922.1|4594560_4595565_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AVS13923.1|4595561_4596569_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	28.9	1.7e-13
>prophage 340
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4604951	4611359	4941290		Serratia_phage(33.33%)	7	NA	NA
AVS13929.1|4604951_4605569_-	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
AVS13930.1|4606231_4606645_+	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVS13931.1|4606776_4607685_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AVS13932.1|4607887_4608901_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVS13933.1|4608991_4609897_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AVS13934.1|4610007_4610466_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13935.1|4610516_4611359_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
>prophage 341
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4615686	4617222	4941290		Escherichia_phage(100.0%)	1	NA	NA
AVS13940.1|4615686_4617222_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 342
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4627559	4633216	4941290		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
AVS14456.1|4627559_4627790_-	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
AVS13948.1|4628056_4629157_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVS13949.1|4629209_4630064_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AVS13950.1|4630101_4630911_-	protein sirB1	NA	NA	NA	NA	NA
AVS13951.1|4630914_4631304_-	protein sirB2	NA	NA	NA	NA	NA
AVS13952.1|4631300_4632134_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVS13953.1|4632133_4633216_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
>prophage 343
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4636563	4639321	4941290		Tupanvirus(50.0%)	2	NA	NA
AVS14457.1|4636563_4637511_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
AVS13957.1|4637635_4639321_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.0e-23
>prophage 344
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4676221	4683534	4941290	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
AVS13995.1|4676221_4677907_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	1.3e-34
AVS13996.1|4677926_4678133_+	hypothetical protein	NA	NA	NA	NA	NA
AVS13997.1|4678111_4678693_-	hypothetical protein	NA	NA	NA	NA	NA
AVS13998.1|4678764_4679460_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVS13999.1|4679517_4681428_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	5.9e-92
AVS14000.1|4681559_4681904_+	RidA family protein	NA	NA	NA	NA	NA
AVS14001.1|4681909_4682089_-	YoaH family protein	NA	NA	NA	NA	NA
AVS14002.1|4682169_4683534_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	4.3e-44
>prophage 345
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4687503	4689063	4941290		Moraxella_phage(100.0%)	1	NA	NA
AVS14006.1|4687503_4689063_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 346
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4696550	4696760	4941290		Morganella_phage(100.0%)	1	NA	NA
AVS14014.1|4696550_4696760_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 347
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4702137	4704186	4941290	tail,protease	Moraxella_phage(100.0%)	1	NA	NA
AVS14022.1|4702137_4704186_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 348
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4711691	4714816	4941290		Escherichia_phage(50.0%)	5	NA	NA
AVS14029.1|4711691_4712342_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	4.2e-58
AVS14030.1|4712359_4712575_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AVS14031.1|4712565_4712730_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14032.1|4713014_4713737_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
AVS14033.1|4714420_4714816_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
>prophage 349
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4720801	4729049	4941290	tail,integrase	Klebsiella_phage(40.0%)	12	4717589:4717601	4730761:4730773
4717589:4717601	attL	CGCGCACAGCGAA	NA	NA	NA	NA
AVS14043.1|4720801_4721068_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	5.2e-07
AVS14044.1|4721236_4721377_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14045.1|4722165_4724586_-	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	72.7	1.5e-55
AVS14046.1|4724704_4724839_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVS14047.1|4724841_4725201_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	45.2	7.3e-20
AVS14462.1|4725397_4725517_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14048.1|4725574_4725928_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVS14049.1|4725944_4726820_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14050.1|4726820_4727195_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVS14051.1|4727332_4727563_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AVS14052.1|4727670_4728327_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVS14053.1|4728350_4729049_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
4730761:4730773	attR	TTCGCTGTGCGCG	NA	NA	NA	NA
>prophage 350
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4736946	4738422	4941290		Cyanophage(100.0%)	1	NA	NA
AVS14061.1|4736946_4738422_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 351
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4742359	4750348	4941290		Bacillus_virus(50.0%)	9	NA	NA
AVS14066.1|4742359_4743679_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
AVS14067.1|4743694_4744654_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AVS14068.1|4744717_4745473_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	2.5e-17
AVS14069.1|4745469_4746255_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AVS14070.1|4746333_4747344_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
AVS14071.1|4747352_4747964_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVS14464.1|4748323_4748998_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14072.1|4749225_4749825_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14073.1|4749826_4750348_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 352
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4754369	4760929	4941290	tRNA	Escherichia_coli_phage(33.33%)	8	NA	NA
AVS14078.1|4754369_4755188_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
AVS14079.1|4755240_4755636_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14080.1|4755676_4756420_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
AVS14081.1|4756416_4757388_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVS14082.1|4757436_4757646_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14083.1|4757623_4758370_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVS14084.1|4758389_4758959_-	VOC family protein	NA	NA	NA	NA	NA
AVS14085.1|4759195_4760929_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
>prophage 353
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4768881	4773016	4941290		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AVS14092.1|4768881_4769271_-	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
AVS14093.1|4769288_4770338_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVS14094.1|4770334_4771201_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AVS14095.1|4771354_4773016_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	5.8e-11
>prophage 354
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4788168	4788834	4941290		Sphingomonas_phage(100.0%)	1	NA	NA
AVS14112.1|4788168_4788834_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 355
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4797096	4797849	4941290		Bacillus_virus(100.0%)	1	NA	NA
AVS14122.1|4797096_4797849_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.0	4.2e-25
>prophage 356
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4801879	4803088	4941290	transposase	Bluetongue_virus(100.0%)	1	NA	NA
AVS14127.1|4801879_4803088_+|transposase	IS4 family transposase ISVsa5	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 357
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4826881	4836590	4941290		Burkholderia_phage(33.33%)	11	NA	NA
AVS14157.1|4826881_4828594_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
AVS14158.1|4828758_4829004_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVS14159.1|4829020_4829938_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVS14160.1|4830107_4831028_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVS14161.1|4831016_4831487_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
AVS14162.1|4831467_4832898_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AVS14163.1|4832971_4833667_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AVS14164.1|4833746_4834058_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14165.1|4834708_4835920_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	55.7	6.3e-108
AVS14467.1|4836178_4836367_-	cold-shock protein	NA	NA	NA	NA	NA
AVS14166.1|4836377_4836590_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 358
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4841249	4842104	4941290		Cronobacter_phage(100.0%)	1	NA	NA
AVS14170.1|4841249_4842104_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 359
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4850048	4850216	4941290		Enterobacteria_phage(100.0%)	1	NA	NA
AVS14177.1|4850048_4850216_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 360
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4856501	4858743	4941290		Klosneuvirus(50.0%)	4	NA	NA
AVS14185.1|4856501_4857422_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
AVS14186.1|4857421_4857727_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVS14187.1|4857777_4857933_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14188.1|4858380_4858743_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
>prophage 361
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4872038	4872785	4941290		Bacillus_phage(100.0%)	1	NA	NA
AVS14204.1|4872038_4872785_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.4e-33
>prophage 362
CP028169	Salmonella enterica strain CFSAN064034 chromosome, complete genome	4941290	4878509	4941278	4941290	capsid,lysis,terminase,head,tail,portal,protease	Salmonella_phage(77.78%)	66	NA	NA
AVS14469.1|4878509_4878878_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	70.2	1.9e-07
AVS14211.1|4878913_4879138_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14212.1|4879527_4880403_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AVS14213.1|4880625_4881306_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	1.7e-81
AVS14214.1|4881925_4882585_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AVS14215.1|4882671_4883001_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVS14216.1|4882997_4883279_-	acylphosphatase	NA	NA	NA	NA	NA
AVS14217.1|4883327_4884107_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVS14218.1|4884132_4884681_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVS14219.1|4884895_4886107_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
AVS14220.1|4886164_4886482_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVS14221.1|4886526_4886943_-	CoA-binding protein	NA	NA	NA	NA	NA
AVS14222.1|4887113_4887776_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AVS14223.1|4887870_4888329_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AVS14224.1|4888364_4890419_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AVS14225.1|4890542_4890989_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AVS14226.1|4891007_4893161_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVS14227.1|4893147_4893753_-	DNA transformation protein	NA	NA	NA	NA	NA
AVS14228.1|4893969_4894479_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVS14470.1|4894835_4895888_+	porin OmpA	NA	NA	NA	NA	NA
AVS14229.1|4895959_4896412_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AVS14230.1|4896597_4898358_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVS14231.1|4898426_4898945_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVS14232.1|4899044_4899212_-	ribosome modulation factor	NA	NA	NA	NA	NA
AVS14233.1|4899467_4900031_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14234.1|4900027_4901668_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AVS14235.1|4901672_4902926_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVS14236.1|4902940_4904848_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	5.4e-53
AVS14237.1|4904860_4906969_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVS14238.1|4907067_4908177_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVS14239.1|4908173_4908716_-	cell division protein ZapC	NA	NA	NA	NA	NA
AVS14240.1|4908881_4909892_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVS14241.1|4910099_4912712_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
AVS14242.1|4913138_4913345_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
AVS14243.1|4913551_4914682_-|tail	phage tail protein	tail	S4TSP4	Salmonella_phage	99.7	1.1e-202
AVS14244.1|4914692_4915652_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
AVS14245.1|4915660_4918381_-|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	99.9	0.0e+00
AVS14246.1|4918380_4918779_-	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	2.9e-70
AVS14247.1|4918785_4919370_-	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	1.6e-104
AVS14248.1|4919369_4919963_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	3.1e-108
AVS14249.1|4920128_4920353_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14250.1|4920341_4920701_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14251.1|4920746_4924037_-|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	70.4	0.0e+00
AVS14252.1|4924100_4924700_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14253.1|4924767_4925064_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	2.9e-46
AVS14254.1|4925075_4925444_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	100.0	2.0e-65
AVS14255.1|4925454_4925898_-	hypothetical protein	NA	S4TNM8	Salmonella_phage	99.3	9.5e-78
AVS14256.1|4925953_4926301_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	100.0	1.7e-58
AVS14257.1|4926297_4926747_-	hypothetical protein	NA	S4TR46	Salmonella_phage	100.0	1.5e-75
AVS14258.1|4926743_4927094_-|head,tail	head-tail adaptor protein	head,tail	S4TND9	Salmonella_phage	100.0	1.7e-58
AVS14259.1|4927102_4927429_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	100.0	2.2e-55
AVS14260.1|4927425_4928469_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	100.0	2.0e-134
AVS14261.1|4928465_4929821_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	100.0	2.8e-261
AVS14262.1|4930025_4931960_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	99.8	0.0e+00
AVS14263.1|4932018_4933680_-|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	99.8	0.0e+00
AVS14264.1|4933676_4934171_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
AVS14265.1|4934276_4934645_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	100.0	3.1e-66
AVS14266.1|4934637_4935231_-	hypothetical protein	NA	S4TR53	Salmonella_phage	75.6	7.4e-86
AVS14267.1|4935212_4936670_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	92.2	2.6e-273
AVS14268.1|4936684_4937413_-	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	77.7	1.4e-97
AVS14269.1|4937618_4938086_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	100.0	1.5e-78
AVS14270.1|4938483_4939026_-	lysozyme	NA	H6WRZ4	Salmonella_phage	100.0	1.6e-103
AVS14271.1|4939028_4939343_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	100.0	2.4e-51
AVS14272.1|4939736_4940534_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	6.8e-151
AVS14273.1|4940523_4940670_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVS14274.1|4940666_4941278_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
>prophage 1
CP028170	Salmonella enterica strain CFSAN064034 plasmid pGMI17-002_1, complete sequence	177712	2281	46857	177712	integrase,transposase	Escherichia_phage(30.77%)	46	44589:44604	49499:49514
AVS14476.1|2281_2986_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS14668.1|3129_3684_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVS14669.1|3814_4645_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AVS14477.1|5276_5981_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS14478.1|6087_6948_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AVS14479.1|6960_7503_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVS14480.1|8696_9401_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVS14481.1|11722_12055_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVS14482.1|12101_12977_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVS14483.1|13232_14495_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS14484.1|15058_15616_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AVS14670.1|15849_16404_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
AVS14485.1|16473_17262_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AVS14486.1|17321_18146_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
AVS14487.1|18845_19706_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVS14488.1|20217_20466_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14489.1|20656_21013_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14490.1|20958_21543_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVS14491.1|21542_22781_-	MFS transporter	NA	NA	NA	NA	NA
AVS14492.1|22777_23683_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVS14493.1|24050_25313_+|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AVS14494.1|25592_26231_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVS14495.1|26320_26698_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AVS14496.1|26918_27596_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.2e-129
AVS14497.1|27642_28947_-|integrase	integrase	integrase	NA	NA	NA	NA
AVS14498.1|28985_29693_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AVS14499.1|29689_29926_-	mercury resistance protein	NA	NA	NA	NA	NA
AVS14500.1|29922_30285_-	transcriptional regulator	NA	NA	NA	NA	NA
AVS14501.1|30302_31997_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AVS14671.1|32048_32471_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AVS14502.1|32506_32782_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AVS14503.1|32795_33146_-	mercuric transporter	NA	NA	NA	NA	NA
AVS14504.1|33217_33652_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AVS14505.1|33730_34735_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVS14506.1|35967_36369_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14507.1|36482_37208_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14508.1|37182_37386_-	hypothetical protein	NA	NA	NA	NA	NA
AVS14509.1|37340_41594_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AVS14510.1|41565_42006_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14511.1|42301_43412_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	1.8e-45
AVS14512.1|43399_43840_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14513.1|43855_44458_-	hypothetical protein	NA	NA	NA	NA	NA
44589:44604	attL	TAATTATGATAATTAC	NA	NA	NA	NA
AVS14514.1|44688_45009_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14515.1|45027_45315_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14516.1|45307_45844_+	hypothetical protein	NA	NA	NA	NA	NA
AVS14517.1|45846_46857_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
49499:49514	attR	TAATTATGATAATTAC	NA	NA	NA	NA
