The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	54944	107878	3993838	terminase,head,integrase,capsid	Acinetobacter_phage(89.29%)	75	54186:54206	108047:108067
54186:54206	attL	GTGCGCCCTGCGGGACTCGAA	NA	NA	NA	NA
AVN04552.1|54944_55154_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	3.7e-32
AVN04387.1|55150_55597_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	92.3	3.9e-79
AVN06183.1|55603_55849_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.8	3.3e-40
AVN06924.1|55850_56825_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	81.8	1.7e-143
AVN04511.1|56821_57943_-	AAA domain protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	4.4e-212
AVN06069.1|57954_58278_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	99.1	1.5e-56
AVN04452.1|58280_58721_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	96.6	2.4e-73
AVN04187.1|59157_59361_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVN07009.1|59499_60003_-	putative membrane protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVN04082.1|60004_61012_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVN06401.1|61063_61279_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVN07219.1|61293_62058_-	helix-turn-helix family protein	NA	A0A0P0J076	Acinetobacter_phage	98.0	1.7e-143
AVN06024.1|62527_62749_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	88.6	6.5e-27
AVN05398.1|62804_63080_+	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	96.7	6.3e-40
AVN04372.1|63076_63388_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	62.0	2.2e-25
AVN04627.1|63468_64239_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
AVN04155.1|64235_65339_+	bacteriophage replication O family protein	NA	A0A0P0IKQ2	Acinetobacter_phage	56.1	1.4e-29
AVN04992.1|65335_65641_+	hypothetical protein	NA	NA	NA	NA	NA
AVN04936.1|65790_66657_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	43.7	1.4e-72
AVN06065.1|66668_67067_+	HNH endonuclease family protein	NA	K7P7B7	Enterobacteria_phage	48.5	1.5e-26
AVN05509.1|67063_67246_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05423.1|67232_67634_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07053.1|67630_68038_+	hypothetical protein	NA	A0A0R6PIZ9	Moraxella_phage	51.8	4.0e-22
AVN05427.1|68047_68332_+	hypothetical protein	NA	NA	NA	NA	NA
AVN04673.1|68353_68917_+	hypothetical protein	NA	A0A1B1P9I8	Acinetobacter_phage	52.5	3.2e-46
AVN05434.1|69097_69328_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07510.1|69513_70056_+	D12 class N6 adenine-specific DNA methyltransferase family protein	NA	Q8W6S4	Burkholderia_virus	69.7	9.2e-67
AVN05009.1|70139_70283_+	DNA adenine methylase domain protein	NA	A0A2H4J7L8	uncultured_Caudovirales_phage	51.1	1.5e-05
AVN07086.1|70269_70533_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04168.1|70759_71227_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	76.8	9.7e-65
AVN04782.1|71195_71732_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	91.0	6.5e-97
AVN05828.1|71895_72366_+	hypothetical protein	NA	A0A0D4DC15	Acinetobacter_phage	85.3	2.4e-71
AVN05867.1|72355_73783_+|terminase	terminase-like family protein	terminase	A0A0D4DCE6	Acinetobacter_phage	98.3	6.5e-269
AVN04616.1|73779_75225_+	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.3	1.1e-276
AVN05744.1|75231_76335_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0D4DBL9	Acinetobacter_phage	98.1	4.0e-202
AVN05807.1|76493_76772_+	hypothetical protein	NA	A0A0P0I8B5	Acinetobacter_phage	98.9	9.6e-44
AVN06659.1|76870_77113_+	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	2.1e-39
AVN05153.1|77330_77522_+	putative phage protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVN04366.1|77635_78403_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AVN04205.1|78430_79387_+|capsid	putative major capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AVN04024.1|79453_80119_+	stress-responsive nuclear envelope family protein	NA	A0A0D4DBW4	Acinetobacter_phage	68.8	1.5e-71
AVN05690.1|80123_80513_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AVN06168.1|80514_80883_+	putative glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AVN05311.1|80920_81595_+	hypothetical protein	NA	NA	NA	NA	NA
AVN04128.1|81629_81800_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05192.1|81810_82218_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AVN06258.1|82189_82558_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AVN05223.1|82559_82958_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	91.7	6.1e-68
AVN06030.1|82959_83178_+	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVN06527.1|83273_83627_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	95.7	6.6e-58
AVN05636.1|83626_84775_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	80.2	6.8e-152
AVN04132.1|84871_85789_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.4	7.8e-167
AVN06160.1|85860_86370_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	86.0	2.2e-62
AVN07609.1|86741_87863_+	hypothetical protein	NA	NA	NA	NA	NA
AVN04489.1|87862_88390_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06042.1|88498_89005_+	hypothetical protein	NA	A0A0P0I8L3	Acinetobacter_phage	34.1	1.6e-12
AVN05802.1|89173_89332_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07405.1|89485_94672_+	tape measure domain protein	NA	J7I4Q7	Acinetobacter_phage	66.3	0.0e+00
AVN04078.1|94746_95499_+	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	35.6	3.4e-35
AVN07586.1|95959_96358_+	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	96.2	3.5e-71
AVN04884.1|96357_96864_+	hypothetical protein	NA	A0A0P0IKN4	Acinetobacter_phage	99.4	3.1e-93
AVN04767.1|96860_97223_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	100.0	2.3e-66
AVN05176.1|97215_100662_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.1	0.0e+00
AVN07008.1|100729_101119_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AVN05445.1|101347_101659_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07772.1|101860_101989_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05043.1|102063_102537_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06174.1|102556_102787_-	arc-like DNA binding domain protein	NA	NA	NA	NA	NA
AVN04296.1|102982_103882_+	BRO family, N-terminal domain protein	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
AVN05639.1|104046_104160_+	putative membrane protein	NA	A0A0P0HSS3	Acinetobacter_phage	97.3	4.3e-11
AVN04820.1|104220_104763_+	putative Peptidoglycan domain protein	NA	J7I0Y1	Acinetobacter_phage	88.9	1.2e-90
AVN07557.1|104968_105235_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05932.1|105354_105861_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07209.1|105901_106306_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07759.1|106633_107878_-|integrase	phage integrase family protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	3.6e-82
108047:108067	attR	GTGCGCCCTGCGGGACTCGAA	NA	NA	NA	NA
>prophage 2
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	553395	581610	3993838		Acinetobacter_phage(97.3%)	37	NA	NA
AVN05860.1|553395_553950_-	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	2.7e-98
AVN06417.1|554206_555706_+	xanthine dehydrogenase, small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
AVN04207.1|555707_558083_+	xanthine dehydrogenase, molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.4	0.0e+00
AVN06713.1|558089_559073_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	95.7	9.2e-182
AVN04592.1|559083_559779_-	smr domain protein	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	9.9e-122
AVN07555.1|559788_560595_-	indole-3-glycerol phosphate synthase family protein	NA	A0A0P0IR83	Acinetobacter_phage	98.5	1.9e-145
AVN05977.1|560604_561654_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
AVN05607.1|562009_564742_+	tonB dependent receptor family protein	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
AVN04587.1|564821_567521_+	hypothetical protein	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
AVN06921.1|567616_568201_-	glutamine amidotransferase of anthranilate synthase/aminodeoxychorismate synthase family protein	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	1.7e-111
AVN05601.1|568315_568585_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
AVN04182.1|568797_569007_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	92.8	4.1e-31
AVN05312.1|569003_569453_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	93.1	6.0e-80
AVN04823.1|569456_569702_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVN04219.1|569703_570780_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.1	5.1e-141
AVN07250.1|570776_571898_-	AAA domain protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
AVN06313.1|571908_572232_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	79.4	1.5e-43
AVN04860.1|572224_572515_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	6.0e-49
AVN07129.1|572514_572955_-	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	95.2	8.3e-74
AVN06663.1|573389_573593_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVN07312.1|573731_574235_-	putative membrane protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVN04315.1|574236_575244_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVN07256.1|575295_575511_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVN04193.1|575525_576290_-	helix-turn-helix domain protein	NA	J7I4M9	Acinetobacter_phage	99.2	5.5e-142
AVN06056.1|576368_576554_+	hypothetical protein	NA	J7HXD2	Acinetobacter_phage	100.0	4.9e-28
AVN05181.1|576620_576920_+	hypothetical protein	NA	J7I452	Acinetobacter_phage	99.0	4.8e-49
AVN05137.1|576980_577253_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	97.8	2.2e-40
AVN05370.1|577249_577546_+	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	99.0	2.3e-48
AVN05959.1|577759_577903_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	100.0	4.3e-16
AVN07749.1|577895_578825_+	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	99.0	1.1e-171
AVN05961.1|578817_579567_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	97.2	6.4e-135
AVN05307.1|579563_579698_+	putative membrane protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
AVN04582.1|579684_580107_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
AVN07160.1|580096_580519_+	hypothetical protein	NA	A0A1X9SFD6	Acinetobacter_phage	100.0	1.1e-83
AVN05241.1|580511_580736_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVN04329.1|580735_581137_+	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVN04291.1|581133_581610_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 3
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	585567	621336	3993838	terminase,tail,head,integrase,transposase,coat	Acinetobacter_phage(87.88%)	43	587554:587569	625248:625263
AVN05199.1|585567_586023_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
AVN07024.1|586215_586518_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	92.0	8.8e-51
AVN04237.1|586486_587128_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AVN07353.1|587186_587702_+	ribosomal L9, C-terminal domain protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
587554:587569	attL	ATCTTGAGTTAAAGCA	NA	NA	NA	NA
AVN06962.1|587982_588954_+|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	84.7	1.1e-150
AVN07220.1|588993_590334_+	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AVN05745.1|590343_591450_+|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AVN06555.1|591446_591677_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06746.1|591692_591845_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06284.1|591896_592211_+	phage family protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AVN07372.1|592297_593089_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AVN07591.1|593102_594053_+|coat	putative coat protein	coat	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AVN06810.1|594097_594412_+	heH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.0	1.2e-47
AVN04783.1|594435_594816_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AVN04711.1|594816_595185_+	putative glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AVN04083.1|595253_595451_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06725.1|595458_595752_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05902.1|595908_596214_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	70.0	7.1e-32
AVN07245.1|596266_596554_+	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	85.3	4.6e-41
AVN07014.1|596555_596954_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	96.2	6.5e-70
AVN04551.1|596955_597174_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
AVN07113.1|597282_597804_+	bacterial SH3 domain protein	NA	NA	NA	NA	NA
AVN05914.1|597900_598254_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
AVN05938.1|598253_599432_+|tail	putative tail fiber	tail	A0A0D4DCQ4	Acinetobacter_phage	65.8	1.3e-102
AVN06063.1|599484_600402_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVN04957.1|600470_600986_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AVN04065.1|601488_601788_+	hypothetical protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AVN05988.1|601796_602255_+	helix-turn-helix domain protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AVN04198.1|602359_603040_+	putative lipoprotein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVN04048.1|603041_603305_+	putative membrane protein	NA	NA	NA	NA	NA
AVN07223.1|603432_607743_+	tape measure domain protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
AVN07247.1|607833_608421_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05979.1|608513_608912_+	putative bacteriophage protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
AVN04931.1|608911_609418_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
AVN06322.1|609414_609777_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
AVN06484.1|609769_613195_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
AVN05668.1|613262_613652_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
AVN05948.1|613693_614239_+	putative Peptidoglycan domain protein	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
AVN05300.1|614720_616310_+	tonB-dependent Receptor Plug domain protein	NA	NA	NA	NA	NA
AVN07529.1|616363_617296_+|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVN05854.1|617535_619182_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05495.1|619492_619981_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05585.1|620070_621336_-|integrase	phage integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.4	6.1e-69
625248:625263	attR	TGCTTTAACTCAAGAT	NA	NA	NA	NA
>prophage 4
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	686941	745032	3993838	transposase	Escherichia_phage(60.0%)	55	NA	NA
AVN04463.1|686941_687874_+|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVN06421.1|687913_688444_+	amino acid permease family protein	NA	NA	NA	NA	NA
AVN05146.1|688525_689986_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AVN03967.1|690115_691186_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVN07290.1|691201_692020_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AVN06431.1|692222_693770_-	galactarate dehydratase	NA	NA	NA	NA	NA
AVN05550.1|693840_695199_-	putative glucarate transporter	NA	NA	NA	NA	NA
AVN06478.1|695484_696816_+	glucarate dehydratase	NA	NA	NA	NA	NA
AVN04389.1|696978_697890_+	5-dehydro-4-deoxyglucarate dehydratase	NA	NA	NA	NA	NA
AVN07499.1|697920_699507_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AVN04029.1|699749_700463_+	FCD domain protein	NA	NA	NA	NA	NA
AVN06111.1|700527_702279_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
AVN05706.1|702312_702702_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05544.1|702742_703279_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06152.1|703335_704556_-	outer membrane porin, OprD family protein	NA	NA	NA	NA	NA
AVN07530.1|704667_705807_-	acyl-CoA dehydrogenase, N-terminal domain protein	NA	NA	NA	NA	NA
AVN04228.1|705881_707753_-	AMP-binding enzyme family protein	NA	NA	NA	NA	NA
AVN04453.1|707849_709301_-	acyl-CoA reductase family protein	NA	NA	NA	NA	NA
AVN06657.1|709338_710172_-	hydroxycinnamoyl-CoA hydratase-lyase	NA	NA	NA	NA	NA
AVN04997.1|710425_711658_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AVN07409.1|711728_712187_+	repressor protein	NA	NA	NA	NA	NA
AVN06398.1|712305_712986_+	FCD domain protein	NA	NA	NA	NA	NA
AVN06476.1|713029_713974_-	2Fe-2S iron-sulfur cluster binding domain protein	NA	NA	NA	NA	NA
AVN04486.1|713986_715063_-	rieske domain protein	NA	NA	NA	NA	NA
AVN05912.1|715296_716484_-	outer membrane porin, OprD family protein	NA	NA	NA	NA	NA
AVN07144.1|716496_717465_-	formylglycine-generating sulfatase enzyme family protein	NA	NA	NA	NA	NA
AVN07357.1|717475_718219_-	type I phosphodiesterase / nucleotide pyrophosphatase family protein	NA	NA	NA	NA	NA
AVN05212.1|718452_719160_-	sulfatase family protein	NA	NA	NA	NA	NA
AVN04926.1|719537_720884_+	sugar (and other) transporter family protein	NA	NA	NA	NA	NA
AVN04529.1|720915_722196_+	outer membrane porin, OprD family protein	NA	NA	NA	NA	NA
AVN05184.1|722255_723926_-	FAD dependent oxidoreductase family protein	NA	NA	NA	NA	NA
AVN05200.1|723954_724848_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06099.1|724920_725775_-	NADH(P)-binding family protein	NA	NA	NA	NA	NA
AVN05925.1|725819_727307_-	flavin-binding monooxygenase-like family protein	NA	NA	NA	NA	NA
AVN05657.1|727506_728457_+	helix-turn-helix domain protein	NA	NA	NA	NA	NA
AVN03939.1|728500_729109_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
AVN06655.1|729105_730005_-	hydrolyase, tartrate alpha subunit/fumarate, Fe-S type domain protein	NA	NA	NA	NA	NA
AVN05539.1|730054_731353_-	vacuole effluxer Atg22 like family protein	NA	NA	NA	NA	NA
AVN04321.1|731590_732511_+	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVN03950.1|732569_733445_-	methyltransferase, TIGR00027 family protein	NA	NA	NA	NA	NA
AVN04188.1|733556_734168_-	putative flavin-binding monooxygenase	NA	NA	NA	NA	NA
AVN06632.1|734394_734526_-|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
AVN04280.1|734571_735186_+	putative p12 protein	NA	NA	NA	NA	NA
AVN06658.1|735656_736472_-	phosphotransferase enzyme family protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AVN05845.1|736517_737129_-	putative p12 protein	NA	NA	NA	NA	NA
AVN05863.1|737174_737306_+|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
AVN05239.1|737631_738183_-	putative sigma-70 region 2	NA	NA	NA	NA	NA
AVN04032.1|738660_739011_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06975.1|739247_739523_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
AVN04036.1|740322_740769_-|transposase	transposase DDE domain protein	transposase	NA	NA	NA	NA
AVN06604.1|740843_741413_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06754.1|741719_742580_+	aminoglycoside 3-N-acetyltransferase family protein	NA	NA	NA	NA	NA
AVN07745.1|742592_743135_+	AAA domain protein	NA	NA	NA	NA	NA
AVN04604.1|744258_744855_-	putative p12 protein	NA	NA	NA	NA	NA
AVN04654.1|744900_745032_+|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
>prophage 5
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	1775784	1782779	3993838	transposase,integrase	Acinetobacter_phage(84.62%)	15	1771425:1771438	1784188:1784201
1771425:1771438	attL	TTCCCCATTATTTT	NA	NA	NA	NA
AVN05154.1|1775784_1776261_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVN06097.1|1776257_1776659_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVN05073.1|1776658_1776883_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVN06503.1|1776875_1777298_-	hypothetical protein	NA	A0A1X9SFD6	Acinetobacter_phage	100.0	1.1e-83
AVN07045.1|1777287_1777548_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	98.8	4.4e-43
AVN07562.1|1777663_1778596_+|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVN04658.1|1778635_1779292_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	35.3	3.1e-08
AVN05433.1|1779288_1779429_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07696.1|1779519_1779720_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06573.1|1779720_1780086_+	putative phage-like protein	NA	A0A1B1P9I4	Acinetobacter_phage	83.3	3.5e-54
AVN05344.1|1780091_1780379_+	hypothetical protein	NA	A0A0P0J0F2	Acinetobacter_phage	86.7	1.2e-36
AVN04775.1|1780399_1780762_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	50.7	1.1e-12
AVN05417.1|1780800_1781241_+	methyltransferase domain protein	NA	A0A0N7IRF6	Acinetobacter_phage	74.1	1.0e-60
AVN06561.1|1781241_1781511_+	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
AVN07769.1|1781516_1782779_-|integrase	phage integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	98.8	1.4e-246
1784188:1784201	attR	TTCCCCATTATTTT	NA	NA	NA	NA
>prophage 6
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	2108965	2167576	3993838	terminase,head,integrase,transposase,coat	Acinetobacter_phage(86.21%)	79	2150995:2151020	2152278:2152303
AVN04203.1|2108965_2110204_+|head	poly A polymerase head domain protein	head	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
AVN06600.1|2110253_2111429_-	PDZ domain protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
AVN05837.1|2111622_2112381_+	NIF3 family protein	NA	NA	NA	NA	NA
AVN06245.1|2112526_2113153_+	superoxide dismutase	NA	NA	NA	NA	NA
AVN04478.1|2113772_2114216_+	hypothetical protein	NA	NA	NA	NA	NA
AVN06625.1|2114225_2114426_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05748.1|2114537_2115983_-	secretory lipase family protein	NA	NA	NA	NA	NA
AVN05005.1|2116093_2116972_-	4-hydroxybenzoate polyprenyl transferase	NA	NA	NA	NA	NA
AVN05130.1|2116968_2117478_-	chorismate lyase family protein	NA	NA	NA	NA	NA
AVN04114.1|2117603_2119013_-	glutamine synthetase, type I	NA	NA	NA	NA	NA
AVN07186.1|2119753_2121295_+	H+ symporter family protein	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
AVN07716.1|2121291_2123094_+	metallopeptidase M24 family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
AVN06410.1|2123631_2124564_-|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVN04153.1|2124571_2128615_-	tape measure domain protein	NA	A0A0D4DC37	Acinetobacter_phage	96.9	0.0e+00
AVN07274.1|2128986_2129508_-	putative lipoprotein	NA	A0A0P0I8L3	Acinetobacter_phage	67.8	7.8e-63
AVN05511.1|2129594_2129831_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06794.1|2130039_2130984_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	98.4	4.1e-102
AVN06982.1|2131040_2131961_-	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	7.6e-21
AVN04956.1|2132038_2132209_-	hicB family protein	NA	NA	NA	NA	NA
AVN06552.1|2132324_2132636_+	arc-like DNA binding domain protein	NA	NA	NA	NA	NA
AVN06720.1|2132649_2133393_-	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	98.8	2.3e-132
AVN07007.1|2133495_2133816_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	97.2	1.7e-52
AVN05649.1|2133920_2134379_-	helix-turn-helix domain protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
AVN04010.1|2134387_2134687_-	hypothetical protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
AVN06991.1|2135189_2135705_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
AVN07275.1|2135774_2136692_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVN07542.1|2136744_2137893_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	80.2	2.8e-158
AVN05894.1|2137892_2138246_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	94.9	5.6e-57
AVN04003.1|2138341_2138560_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVN07587.1|2138561_2138960_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	90.9	1.8e-67
AVN06108.1|2138961_2139249_-	hypothetical protein	NA	A0A0P0IDX0	Acinetobacter_phage	87.4	1.1e-42
AVN06596.1|2139301_2139607_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	70.0	7.1e-32
AVN07335.1|2139763_2140057_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07610.1|2140064_2140262_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06466.1|2140330_2140699_-	putative glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
AVN04264.1|2140699_2141080_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
AVN05452.1|2141083_2141419_-	heH/LEM domain protein	NA	A0A0N7IRE4	Acinetobacter_phage	99.1	6.1e-53
AVN05017.1|2141463_2142414_-|coat	putative coat protein	coat	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
AVN07063.1|2142427_2143219_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
AVN05226.1|2143305_2143620_-	phage family protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
AVN06141.1|2143671_2143824_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06517.1|2143839_2144070_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07332.1|2144066_2145173_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
AVN04554.1|2145182_2146523_-	hypothetical protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
AVN07461.1|2146562_2147534_-|terminase	terminase-like family protein	terminase	A0A1B1P9C9	Acinetobacter_phage	84.7	1.1e-150
AVN05498.1|2147814_2148330_-	ribosomal L9, C-terminal domain protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
AVN04149.1|2148388_2149030_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
AVN06736.1|2148998_2149301_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	92.0	8.8e-51
AVN05906.1|2149493_2149949_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
2150995:2151020	attL	TGAACCGTACCGGGTTTGTCGGAGAC	NA	NA	NA	NA
AVN05519.1|2151033_2151936_-|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	52.6	2.3e-78
AVN06953.1|2151935_2152253_-|transposase	transposase family protein	transposase	Q6H9S4	Enterobacteria_phage	45.1	1.6e-18
AVN06648.1|2152370_2152601_-	hypothetical protein	NA	NA	NA	NA	NA
2152278:2152303	attR	GTCTCCGACAAACCCGGTACGGTTCA	NA	NA	NA	NA
AVN05251.1|2153471_2153591_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05547.1|2153764_2154316_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06200.1|2154529_2154748_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06323.1|2154993_2155248_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05754.1|2155219_2155696_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
AVN05335.1|2155692_2156094_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.9	3.1e-67
AVN06662.1|2156093_2156495_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	96.2	8.1e-36
AVN04967.1|2156487_2156826_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
AVN06433.1|2156822_2157623_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
AVN05870.1|2157625_2158507_-	bacteriophage replication O family protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
AVN07057.1|2158499_2158724_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
AVN04962.1|2158795_2159068_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
AVN07423.1|2159129_2159318_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	90.3	1.3e-23
AVN04430.1|2159460_2159649_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06834.1|2159753_2160506_+	cro/C1-type HTH DNA-binding domain protein	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
AVN05375.1|2160520_2160736_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
AVN06868.1|2160787_2161795_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
AVN06650.1|2161796_2162300_+	putative membrane protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
AVN05940.1|2162438_2162642_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
AVN04266.1|2163084_2163528_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
AVN04520.1|2163527_2163818_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
AVN04659.1|2163810_2164134_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
AVN06280.1|2164145_2165267_+	AAA domain protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
AVN04031.1|2165263_2166196_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
AVN06331.1|2166197_2166449_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
AVN07268.1|2166449_2166857_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
AVN05960.1|2166883_2167576_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.6e-55
>prophage 7
CP027123	Acinetobacter baumannii strain AR_0056 chromosome, complete genome	3993838	2284887	2364541	3993838	terminase,holin,head,integrase,capsid,transposase	Acinetobacter_phage(83.61%)	93	2320036:2320051	2364717:2364732
AVN05602.1|2284887_2286954_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
AVN07105.1|2287071_2288694_-|holin	transporter, betaine/carnitine/choline transporter family protein	holin	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
AVN06535.1|2288958_2289582_+	transcriptional repressor BetI	NA	NA	NA	NA	NA
AVN05773.1|2289574_2291047_+	betaine aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVN04521.1|2291142_2292801_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
AVN07258.1|2293311_2294952_+	malate dehydrogenase	NA	NA	NA	NA	NA
AVN05158.1|2295139_2295514_+	putative membrane protein	NA	NA	NA	NA	NA
AVN07658.1|2295730_2296609_+	homocysteine S-methyltransferase family protein	NA	NA	NA	NA	NA
AVN06109.1|2296614_2297949_+	transporter, basic amino acid/polyamine antiporter family protein	NA	NA	NA	NA	NA
AVN07677.1|2298004_2299882_-	PGAP1-like family protein	NA	NA	NA	NA	NA
AVN05485.1|2300041_2300746_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06739.1|2301066_2301342_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05234.1|2301344_2301785_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07674.1|2301813_2302410_-	heme oxygenase family protein	NA	NA	NA	NA	NA
AVN05869.1|2302445_2303366_-	tonB family C-terminal domain protein	NA	NA	NA	NA	NA
AVN06103.1|2303376_2304834_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07376.1|2304946_2305738_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04889.1|2305931_2309021_-	secretin and TonB N terminus short domain protein	NA	NA	NA	NA	NA
AVN06309.1|2309244_2310261_-	fecR family protein	NA	NA	NA	NA	NA
AVN06046.1|2310261_2310831_-	RNA polymerase sigma factor, sigma-70 family protein	NA	NA	NA	NA	NA
AVN07445.1|2310919_2311810_-	lysR substrate binding domain protein	NA	NA	NA	NA	NA
AVN04303.1|2311997_2312942_+	dihydrodipicolinate synthetase family protein	NA	NA	NA	NA	NA
AVN06938.1|2313114_2314500_+	hypothetical protein	NA	NA	NA	NA	NA
AVN07616.1|2314577_2315204_+	outer membrane porin, OprD family protein	NA	NA	NA	NA	NA
AVN04435.1|2315257_2316190_+|transposase	transposase DDE domain protein	transposase	Q1MVF0	Enterobacteria_phage	40.9	6.1e-58
AVN05326.1|2316197_2317139_-	BRO family, N-terminal domain protein	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.4e-149
AVN06319.1|2317334_2317565_+	arc-like DNA binding domain protein	NA	NA	NA	NA	NA
AVN05281.1|2317584_2318058_-	hypothetical protein	NA	NA	NA	NA	NA
AVN06053.1|2318132_2318261_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07731.1|2318462_2318774_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04334.1|2319002_2319392_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	98.4	5.6e-66
AVN05484.1|2319459_2322906_-	hypothetical protein	NA	A0A0D4DBG7	Acinetobacter_phage	97.8	0.0e+00
2320036:2320051	attL	CCCGCCATCTCCACCA	NA	NA	NA	NA
AVN04943.1|2322898_2323261_-	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	98.3	4.4e-65
AVN05737.1|2323257_2323764_-	hypothetical protein	NA	A0A0D4DCA4	Acinetobacter_phage	99.4	2.7e-92
AVN04656.1|2323763_2324162_-	hypothetical protein	NA	A0A0P0IY66	Acinetobacter_phage	95.5	1.0e-70
AVN05814.1|2324313_2324472_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04611.1|2324790_2329125_-	tape measure domain protein	NA	A0A0D4DC37	Acinetobacter_phage	71.0	0.0e+00
AVN06406.1|2329252_2329516_-	putative membrane protein	NA	NA	NA	NA	NA
AVN05348.1|2329517_2330198_-	putative lipoprotein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
AVN04915.1|2330296_2330701_-	hypothetical protein	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
AVN06839.1|2330793_2330952_-	ycfA-like family protein	NA	A0A0D4DC32	Acinetobacter_phage	100.0	1.3e-24
AVN04371.1|2331301_2331817_-	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	97.9	1.4e-77
AVN05937.1|2331886_2332804_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.0	1.0e-166
AVN05248.1|2332856_2334005_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	80.2	2.8e-158
AVN07714.1|2334004_2334358_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	95.7	6.6e-58
AVN07101.1|2334453_2334672_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	94.4	4.3e-31
AVN06185.1|2334673_2335072_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	91.7	6.1e-68
AVN04172.1|2335073_2335442_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	93.4	5.1e-61
AVN07633.1|2335413_2335821_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.1	9.1e-51
AVN04345.1|2335831_2336002_-	hypothetical protein	NA	NA	NA	NA	NA
AVN05628.1|2336036_2336711_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04822.1|2336748_2337117_-	putative glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	98.4	6.5e-64
AVN05647.1|2337118_2337508_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	100.0	6.6e-67
AVN04414.1|2337512_2338178_-	stress-responsive nuclear envelope family protein	NA	A0A0D4DBW4	Acinetobacter_phage	68.8	1.5e-71
AVN06210.1|2338244_2339201_-|capsid	putative major capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	99.7	6.0e-178
AVN07331.1|2339228_2339996_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
AVN07000.1|2340109_2340301_-	putative phage protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
AVN05214.1|2340518_2340644_-	hypothetical protein	NA	A0A0P0IY55	Acinetobacter_phage	100.0	1.2e-17
AVN07432.1|2340791_2341109_+|transposase	transposase family protein	transposase	Q6H9S4	Enterobacteria_phage	45.1	1.6e-18
AVN03980.1|2341108_2342011_+|integrase	integrase core domain protein	integrase	A0A0N7C1X7	Escherichia_phage	52.6	2.3e-78
AVN06068.1|2342171_2342450_-	hypothetical protein	NA	A0A0P0I8B5	Acinetobacter_phage	98.9	9.6e-44
AVN05708.1|2342608_2343712_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	A0A0D4DBL9	Acinetobacter_phage	98.1	4.0e-202
AVN06681.1|2343718_2345164_-	hypothetical protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.3	1.1e-276
AVN05365.1|2345160_2346588_-|terminase	terminase-like family protein	terminase	A0A0D4DCE6	Acinetobacter_phage	98.3	6.5e-269
AVN05654.1|2346577_2347048_-	hypothetical protein	NA	A0A0D4DC15	Acinetobacter_phage	85.3	2.4e-71
AVN04862.1|2347106_2347748_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	98.6	5.2e-125
AVN07645.1|2347716_2348145_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	66.2	3.5e-45
AVN05916.1|2348157_2348349_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
AVN05142.1|2348538_2348877_-	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.1	5.4e-57
AVN04484.1|2348842_2348965_+	hypothetical protein	NA	NA	NA	NA	NA
AVN05597.1|2349384_2349873_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	4.8e-91
AVN05577.1|2349881_2350277_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
AVN04420.1|2350276_2350501_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
AVN06939.1|2350493_2350916_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	8.4e-84
AVN06409.1|2350905_2351328_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
AVN06554.1|2351324_2352074_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.6	6.2e-138
AVN07366.1|2352066_2353017_-	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	1.6e-98
AVN05788.1|2353013_2354060_-	DNA methylase family protein	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
AVN04524.1|2354056_2354347_-	hypothetical protein	NA	NA	NA	NA	NA
AVN07064.1|2354402_2354702_-	hypothetical protein	NA	J7I452	Acinetobacter_phage	97.0	6.9e-48
AVN07035.1|2355083_2355746_+	helix-turn-helix domain protein	NA	A0A0P0IYD9	Acinetobacter_phage	100.0	2.3e-120
AVN04133.1|2355766_2355982_+	hypothetical protein	NA	A0A0P0I8I5	Acinetobacter_phage	100.0	2.5e-31
AVN05703.1|2356114_2358382_+	eco57I restriction-modification methylase family protein	NA	J7I0U9	Acinetobacter_phage	100.0	0.0e+00
AVN05080.1|2358577_2359018_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	99.3	6.8e-76
AVN06988.1|2359020_2359344_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	98.1	5.7e-56
AVN06248.1|2359354_2360476_+	AAA domain protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.5	6.3e-211
AVN05428.1|2360472_2361549_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	75.4	4.6e-142
AVN04647.1|2361550_2361796_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
AVN07720.1|2361799_2362249_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	97.2	3.4e-83
AVN04996.1|2362245_2362530_+	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	92.6	1.8e-42
AVN06750.1|2362582_2362711_+	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	68.6	1.8e-05
AVN05941.1|2362721_2363390_-	hypothetical protein	NA	NA	NA	NA	NA
AVN04216.1|2363389_2364541_-|integrase	phage integrase family protein	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.3	1.6e-132
2364717:2364732	attR	TGGTGGAGATGGCGGG	NA	NA	NA	NA
>prophage 1
CP027122	Acinetobacter baumannii strain AR_0056 plasmid unnamed1, complete sequence	113706	11225	47972	113706	integrase,transposase	Pseudomonas_phage(43.48%)	44	5818:5838	23167:23187
5818:5838	attL	AAAGATCAGTCAGTACTGACT	NA	NA	NA	NA
AVN03811.1|11225_11813_-|integrase	phage integrase family protein	integrase	A0A0A8WF93	Clostridium_phage	29.7	2.3e-07
AVN03879.1|12177_12642_-	hypothetical protein	NA	NA	NA	NA	NA
AVN03871.1|13243_13444_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03843.1|13603_15661_+	von Willebrand factor type A domain protein	NA	A0A2H4P735	Pseudomonas_phage	44.2	3.6e-71
AVN03821.1|15800_17000_+	AAA domain family protein	NA	L7TKP0	Rhizobium_phage	40.5	3.7e-76
AVN03927.1|17029_17713_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03911.1|17788_18478_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03926.1|18509_21965_+	DNA polymerase III, alpha subunit	NA	L7TNG6	Rhizobium_phage	42.3	2.4e-253
AVN03841.1|22049_23156_+	hypothetical protein	NA	A0A2H4P749	Pseudomonas_phage	30.9	7.8e-12
AVN03834.1|23306_24194_+	putative regulator	NA	A0A2H4P7I7	Pseudomonas_phage	40.5	1.1e-40
23167:23187	attR	AAAGATCAGTCAGTACTGACT	NA	NA	NA	NA
AVN03873.1|24250_25315_+	5'-3' exonuclease, C-terminal SAM fold family protein	NA	J9Q7S6	Salmonella_phage	36.6	7.7e-49
AVN03888.1|25325_26822_+	intein C-terminal splicing region domain protein	NA	A0A2H4P740	Pseudomonas_phage	29.4	3.0e-51
AVN03846.1|26894_27248_+	hypothetical protein	NA	A0A2H4P744	Pseudomonas_phage	37.9	1.3e-08
AVN03868.1|27244_27643_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03875.1|27642_28080_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03907.1|28187_28595_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03858.1|28591_28957_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03866.1|28991_29240_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03928.1|29272_29638_+	cell Wall Hydrolase family protein	NA	A0A0U2UVF2	Pseudomonas_phage	33.1	8.5e-08
AVN03828.1|29699_30794_+	calcineurin-like phosphoesterase superfamily domain protein	NA	A0A2H4P756	Pseudomonas_phage	38.7	5.2e-69
AVN03851.1|30793_32746_+	recF/RecN/SMC N terminal domain protein	NA	L7TNH6	Rhizobium_phage	39.7	1.3e-118
AVN03826.1|32846_33479_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03860.1|33482_34076_+	hypothetical protein	NA	A0A2H4P7J7	Pseudomonas_phage	46.5	1.1e-33
AVN03804.1|34173_34764_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03824.1|34904_35078_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03904.1|35123_37298_+	ribonucleoside-diphosphate reductase, alpha subunit	NA	A0A2H4P767	Pseudomonas_phage	50.8	1.2e-192
AVN03908.1|37269_37872_-	putative p12 protein	NA	NA	NA	NA	NA
AVN03869.1|37917_38049_+|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
AVN03900.1|38486_39191_-|transposase	transposase IS66 family protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVN03912.1|39167_39293_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVN03902.1|39274_40159_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
AVN03862.1|40214_41690_-	miro-like family protein	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AVN03832.1|42139_42271_-|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
AVN03856.1|42316_42928_+	putative p12 protein	NA	NA	NA	NA	NA
AVN03886.1|43027_43219_+	kanR domain protein	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	4.7e-26
AVN03829.1|43186_43783_-	putative p12 protein	NA	NA	NA	NA	NA
AVN03876.1|43828_43960_+|transposase	putative transposase protein	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-16
AVN03918.1|43965_44253_+	ribonucleoside-diphosphate reductase domain protein	NA	NA	NA	NA	NA
AVN03809.1|44332_45325_+	ribonucleotide reductase, small chain family protein	NA	A0A2H4P762	Pseudomonas_phage	37.7	4.8e-53
AVN03813.1|45351_45771_-	death-on-curing family protein	NA	NA	NA	NA	NA
AVN03814.1|45770_46133_-	hypothetical protein	NA	NA	NA	NA	NA
AVN03914.1|46363_47224_+	thymidylate synthase complementing family protein	NA	W6ASM9	Erwinia_phage	48.4	6.6e-75
AVN03810.1|47220_47514_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03898.1|47513_47972_+	dUTP diphosphatase family protein	NA	Q2NP83	Xanthomonas_phage	51.7	4.2e-36
>prophage 2
CP027122	Acinetobacter baumannii strain AR_0056 plasmid unnamed1, complete sequence	113706	73249	113456	113706	tail,capsid,terminase	Salmonella_phage(40.91%)	33	NA	NA
AVN03874.1|73249_74965_-	DEAD/DEAH box helicase family protein	NA	L7TNS5	Rhizobium_phage	45.7	1.5e-123
AVN03853.1|74995_75676_+	parB-like nuclease domain protein	NA	L7TL04	Rhizobium_phage	40.9	1.8e-43
AVN03891.1|75687_76209_+	phage family protein	NA	A0A2I7QK91	Vibrio_phage	39.4	4.2e-24
AVN03887.1|76216_76858_+	parB-like nuclease domain protein	NA	J9Q6L1	Salmonella_phage	42.8	4.3e-31
AVN03836.1|76893_77511_+	ABC transporter family protein	NA	J9Q807	Salmonella_phage	61.2	1.6e-62
AVN03812.1|77521_77875_+	thioredoxin domain protein	NA	NA	NA	NA	NA
AVN03819.1|77918_78869_+	putative aBC transporter ATP-binding protein	NA	A0A2H4P6X5	Pseudomonas_phage	44.1	3.5e-61
AVN03808.1|78858_79185_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03817.1|79386_79683_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03827.1|79802_80393_+	winged helix-turn-helix DNA-binding family protein	NA	J9Q6D4	Salmonella_phage	26.2	6.2e-08
AVN03895.1|80395_81640_+|terminase	terminase-like family protein	terminase	J9Q7Y2	Salmonella_phage	60.1	1.3e-148
AVN03867.1|81679_83380_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	52.4	1.4e-153
AVN03848.1|83429_84281_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	32.0	6.4e-30
AVN03861.1|84451_85354_+|capsid	phage capsid family protein	capsid	A0A2H4P701	Pseudomonas_phage	55.0	1.9e-88
AVN03897.1|85476_85974_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	27.0	2.9e-06
AVN03833.1|85973_86747_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03859.1|86746_87223_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03820.1|87999_88443_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03920.1|88512_89040_+	hypothetical protein	NA	A0A2H4P707	Pseudomonas_phage	55.2	2.5e-48
AVN03805.1|89128_89452_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03913.1|89643_89787_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03925.1|89803_95548_+|tail	putative phage tail protein	tail	G8C7Q6	Escherichia_phage	38.3	1.6e-07
AVN03852.1|95922_96633_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	52.2	3.1e-70
AVN03823.1|96598_97378_+	nlpC/P60 family protein	NA	J9Q7R4	Salmonella_phage	38.2	4.2e-44
AVN03877.1|97367_97988_+|tail	putative phage tail protein	tail	C7BGD3	Burkholderia_phage	29.6	3.9e-13
AVN03857.1|97956_109632_+|tail	phage tail family protein	tail	A0A0R6PH26	Moraxella_phage	36.2	1.2e-158
AVN03863.1|109631_110189_+	hypothetical protein	NA	A0A172Q083	Acinetobacter_phage	40.4	5.1e-28
AVN03800.1|110306_110438_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03864.1|110488_110665_-	hypothetical protein	NA	NA	NA	NA	NA
AVN03893.1|110872_111190_+	putative membrane protein	NA	I3PUY0	Vibrio_phage	34.1	1.6e-07
AVN03865.1|111189_111759_+	hypothetical protein	NA	A0A0B5KZH1	Acinetobacter_phage	100.0	1.3e-111
AVN03807.1|111762_111921_+	hypothetical protein	NA	NA	NA	NA	NA
AVN03837.1|112607_113456_+	initiator Replication family protein	NA	A0A218MNI2	uncultured_virus	26.2	9.2e-13
