The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	1418965	1426852	5217996	integrase	Escherichia_phage(33.33%)	8	1424072:1424097	1439454:1439479
AVR36715.1|1418965_1419424_-	Guanine deaminase	NA	S4VYZ2	Pandoravirus	38.5	4.6e-11
AVR36716.1|1419555_1420464_+	HTH-type transcriptional regulator cynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	3.9e-09
AVR36717.1|1420494_1421307_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	57.5	8.8e-05
AVR36718.1|1421719_1422202_-	hypothetical protein	NA	NA	NA	NA	NA
AVR36719.1|1422320_1423658_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.9	4.8e-16
1424072:1424097	attL	GTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AVR36720.1|1424291_1425458_+|integrase	integrase family protein	integrase	A0A2R2Z2Y0	Escherichia_phage	86.6	7.8e-204
AVR36721.1|1425570_1425942_+	hypothetical protein	NA	NA	NA	NA	NA
AVR36722.1|1426474_1426852_-	Insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	93.6	1.9e-63
1439454:1439479	attR	GTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 2
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	1666868	1673762	5217996	protease	Planktothrix_phage(33.33%)	6	NA	NA
AVR36930.1|1666868_1667711_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.5e-10
AVR36931.1|1667721_1668495_+	dipeptide transport ATP-binding protein DppD	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AVR36932.1|1668736_1669633_-	putative lipid kinase	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
AVR36933.1|1669875_1671237_-|protease	putative protease	protease	Q6DW11	Phage_TP	94.0	7.4e-206
AVR36934.1|1671555_1672278_-	Transcriptional regulatory protein baeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AVR36935.1|1672274_1673762_-	Signal transduction histidine-protein kinase baeS	NA	W8CYF6	Bacillus_phage	28.3	6.5e-30
>prophage 3
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	1790292	1825606	5217996	capsid,tail,portal,integrase,protease,terminase,head	Salmonella_phage(13.89%)	43	1790118:1790177	1830048:1830116
1790118:1790177	attL	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCG	NA	NA	NA	NA
AVR37026.1|1790292_1791285_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
AVR37027.1|1791286_1791514_-	hypothetical protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
AVR37028.1|1791821_1792022_-	hypothetical protein	NA	NA	NA	NA	NA
AVR37029.1|1792011_1792452_-	phage protein	NA	S4TSR6	Salmonella_phage	65.7	5.4e-33
AVR37030.1|1792735_1793521_-	ParB family chromosome partitioning protein	NA	C7BGF1	Burkholderia_phage	52.9	2.6e-62
AVR37031.1|1793520_1793820_-	hypothetical protein	NA	NA	NA	NA	NA
AVR37032.1|1794367_1795027_-	lambda repressor-like protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
AVR37033.1|1795119_1795317_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AVR37034.1|1795342_1795804_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AVR37035.1|1795999_1796287_-	hypothetical protein	NA	NA	NA	NA	NA
AVR37036.1|1796276_1797164_+	PaaX family transcriptional regulator	NA	U5P0A0	Shigella_phage	67.0	1.5e-77
AVR37037.1|1797160_1797970_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	69.7	7.0e-111
AVR37038.1|1797979_1798357_+	crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	6.7e-48
AVR37039.1|1798369_1799350_+	phage protein	NA	A0A291AWV9	Escherichia_phage	66.6	5.4e-134
AVR37040.1|1799363_1799942_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
AVR37041.1|1800417_1800891_-	phage protein	NA	NA	NA	NA	NA
AVR37042.1|1801440_1801836_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
AVR37043.1|1801822_1802104_+	membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
AVR37044.1|1802103_1802733_+	chitinase	NA	F1C591	Cronobacter_phage	73.9	1.0e-85
AVR37045.1|1802735_1803011_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	1.3e-24
AVR37046.1|1803152_1803413_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	58.0	9.6e-22
AVR37047.1|1804201_1804426_-	hypothetical protein	NA	NA	NA	NA	NA
AVR37048.1|1804645_1804879_+	hypothetical protein	NA	NA	NA	NA	NA
AVR37049.1|1805374_1805872_+|terminase	phage terminase small subunit	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
AVR37050.1|1805875_1807627_+|terminase	terminase	terminase	A0A1P8DTK0	Proteus_phage	72.0	1.2e-251
AVR37051.1|1807623_1807785_+	membrane protein	NA	NA	NA	NA	NA
AVR37052.1|1807774_1809001_+|portal	putative phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	7.1e-208
AVR37053.1|1808993_1809593_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
AVR37054.1|1809602_1810841_+|capsid	HK97 family phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.4	1.8e-158
AVR37055.1|1810918_1811236_+	hypothetical protein	NA	A0A1W6JNZ5	Morganella_phage	51.0	1.1e-22
AVR37056.1|1811244_1811583_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
AVR37057.1|1811579_1812029_+	HK97 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AVR37058.1|1812025_1812373_+	hypothetical protein	NA	K7PKL6	Enterobacterial_phage	61.1	1.5e-30
AVR37059.1|1812434_1813139_+|tail	tail protein	tail	K7PHL2	Enterobacterial_phage	66.5	5.5e-80
AVR37060.1|1813208_1813574_+|tail	phage tail assembly chaperone	tail	Q9MCS5	Enterobacteria_phage	52.9	4.8e-27
AVR37061.1|1813576_1813882_+	hypothetical protein	NA	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
AVR37062.1|1813956_1814478_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	2.2e-09
AVR37063.1|1814540_1818122_+|tail	lambda family phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	61.7	8.6e-254
AVR37064.1|1818142_1818616_+	membrane protein	NA	A0A286S298	Klebsiella_phage	62.1	6.4e-56
AVR37065.1|1818602_1819079_+	ArsR family transcriptional regulator	NA	A0A286S2B1	Klebsiella_phage	64.6	5.3e-50
AVR37066.1|1819091_1819472_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.2e-57
AVR37067.1|1819468_1822546_+	kinase	NA	A0A286S259	Klebsiella_phage	61.7	0.0e+00
AVR37068.1|1822669_1825606_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	68.0	3.6e-40
1830048:1830116	attR	CCGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACTATTC	NA	NA	NA	NA
>prophage 4
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	2655495	2666381	5217996		Escherichia_phage(87.5%)	9	NA	NA
AVR37860.1|2655495_2658603_+	Beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.2	0.0e+00
AVR37861.1|2658657_2659923_+	putative proton/sugar symporter, LacY	NA	NA	NA	NA	NA
AVR37862.1|2659953_2661042_-	RecF/RecN/SMC N-terminal domain-containing protein	NA	A0A077SLJ9	Escherichia_phage	96.7	1.9e-204
AVR37863.1|2661128_2661410_-	putative K+ transporting ATPase, KdpC subunit	NA	A0A077SK33	Escherichia_phage	96.5	1.4e-39
AVR37864.1|2661685_2662546_+	Beta-lactamase OKP-B	NA	A0A077SL40	Escherichia_phage	88.8	2.4e-141
AVR37865.1|2662566_2663328_-	putative HTH-type transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
AVR37866.1|2663588_2664491_+	putative oxidoreductase	NA	A0A077SLF7	Escherichia_phage	96.7	4.1e-152
AVR37867.1|2664502_2665768_+	Hrp pili protein HrpA	NA	A0A077SLJ7	Escherichia_phage	92.4	1.3e-217
AVR37868.1|2665760_2666381_+	Putative aldolase class 2 protein	NA	A0A077SK32	Escherichia_phage	95.6	3.1e-111
>prophage 5
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	3322360	3331822	5217996	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AVR38467.1|3322360_3324082_+	ATP-binding/permease protein cydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.3e-13
AVR38468.1|3324121_3324826_+|tRNA	Leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AVR38469.1|3325176_3325395_+	Translation initiation factor IF-1	NA	NA	NA	NA	NA
AVR38470.1|3325518_3327798_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
AVR38471.1|3327828_3328146_-|protease	ATP-dependent Clp protease adapter protein ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AVR38472.1|3328471_3328693_+	DNA replication inhibitor	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AVR38473.1|3328769_3330710_-	Macrolide export ATP-binding/permease protein MacB 1	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
AVR38474.1|3330706_3331822_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
CP023478	Klebsiella quasipneumoniae strain KPC142 chromosome, complete genome	5217996	4500033	4508575	5217996	capsid,integrase	Enterobacteria_phage(85.71%)	10	4497604:4497626	4508637:4508659
4497604:4497626	attL	GGTGCATGGTTTTGCATGCGTTT	NA	NA	NA	NA
AVR39520.1|4500033_4501305_-|integrase	phage integrase	integrase	B7SYF8	Stenotrophomonas_phage	40.2	1.1e-73
AVR39521.1|4501647_4502343_-	hypothetical protein	NA	NA	NA	NA	NA
AVR39522.1|4502732_4505075_-	nucleoside triphosphatase, D5 family	NA	Q7M2A8	Enterobacteria_phage	83.2	0.0e+00
AVR39523.1|4505089_4505410_-	P4 phage protein	NA	NA	NA	NA	NA
AVR39524.1|4505406_4505634_-	bacteriophage protein	NA	NA	NA	NA	NA
AVR39525.1|4505630_4506188_-	CI repressor	NA	Q7M2A7	Enterobacteria_phage	63.9	8.7e-28
AVR39526.1|4506184_4506451_-	phage transcriptional regulator, AlpA	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AVR39527.1|4507011_4507749_+|capsid	phage capsid and scaffold protein	capsid	Q7M2A2	Enterobacteria_phage	60.9	4.5e-72
AVR39528.1|4507745_4507991_+	phage transcriptional activator, Ogr/delta	NA	Q7M294	Enterobacteria_phage	56.8	1.2e-18
AVR39529.1|4508008_4508575_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.7e-58
4508637:4508659	attR	GGTGCATGGTTTTGCATGCGTTT	NA	NA	NA	NA
>prophage 1
CP023479	Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence	189707	3517	45675	189707	integrase,transposase	Salmonella_phage(28.57%)	48	4488:4547	31457:32514
AVR40130.1|3517_3730_+|transposase	transposase	transposase	U5P429	Shigella_phage	56.1	1.6e-14
AVR40131.1|3867_4404_-	putative plasmid transfer protein	NA	NA	NA	NA	NA
4488:4547	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCTTCCCG	NA	NA	NA	NA
AVR40132.1|4519_5488_+|transposase	putative transposase for transposon Tn903	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
AVR40133.1|5758_7594_+	peptidase	NA	NA	NA	NA	NA
AVR40134.1|7642_7927_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40135.1|7939_8203_+|transposase	transposase	transposase	NA	NA	NA	NA
AVR40136.1|8538_9060_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	46.6	2.8e-36
AVR40137.1|9170_9899_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40138.1|10291_11791_-	putative protein kinase	NA	NA	NA	NA	NA
AVR40139.1|11818_13552_-	phosphatase 2C family protein	NA	NA	NA	NA	NA
AVR40140.1|13551_14592_-	TerY3	NA	NA	NA	NA	NA
AVR40141.1|14684_15323_-	von Willebrand factor type A domain protein	NA	NA	NA	NA	NA
AVR40142.1|15323_15965_-	Tellurium resistance protein TerX	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AVR40143.1|15989_16628_-	tellurite resistance protein TerY	NA	NA	NA	NA	NA
AVR40144.1|17993_18257_+|transposase	transposase	transposase	NA	NA	NA	NA
AVR40145.1|18592_19114_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	46.6	2.8e-36
AVR40146.1|19388_19601_+	hypothetical protein	NA	U5P429	Shigella_phage	56.1	1.6e-14
AVR40147.1|19752_20052_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40148.1|20111_20954_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	50.5	5.7e-15
AVR40149.1|21039_21273_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40150.1|21258_22191_+	Insertion element IS630 putative 39 kDa protein	NA	NA	NA	NA	NA
AVR40151.1|22757_23012_-	hemolysin expression modulating protein	NA	NA	NA	NA	NA
AVR40152.1|23190_24327_+|integrase	site-specific recombinase, phage integrase family	integrase	NA	NA	NA	NA
AVR40153.1|24388_24706_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40154.1|24835_25510_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	8.6e-123
AVR40155.1|25509_25803_-|transposase	transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.9e-42
AVR40156.1|26303_27005_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40157.1|27046_28018_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
AVR40158.1|28060_28468_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40159.1|28477_28942_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40160.1|28989_29232_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40161.1|29218_29695_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40162.1|29856_30141_+|transposase	ISEc14 transposase A	transposase	NA	NA	NA	NA
AVR40163.1|30515_31484_-|transposase	putative transposase for transposon Tn903	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
AVR40164.1|31567_32143_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40165.1|32391_33039_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	5.1e-80
31457:32514	attR	CGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCTGTTTTTCCGTCAGATTGCCAGAACTACCACTGGTTAGAGGTGAAAAAACTATGGCCGTCAATCTTCGTCGCGCGTTACCCCATCAGGACACGCCTTTCTTTCGGGGACTTCATATTGTTGTCGCCGTTCTGGTTCTGGCTCAGATTATCAATTCGAATATGACGGAAACTGAGTCTCTGGGACAGTTTTCGTTGACAGGTATGGTGACTTTTCTGCACATCATTTCCGGGTTTGGTCTGTTGCTTTGTGGTGTGGTTATGCTGTTCTGGATGCTGGCTCAGCGTGGTGCCCGGTATTATTTCTCATACCTGTATCTGGATTTTCAGGGCGTCACCGACGATTTCAGGACGCTGCGTCAGTTTCGCCTGCCCGAAGCACATGCCGGAGGTATGGCTGCCATCGTTCAGGGACTGGGGGTGCTGTCATTACTCGGTGTGGCGGCTGTCGGCGGACTCTGGTTCATTCTGAATATGATGTACGGTCCCGATTCGGTCCTGGTACATGACGTTCTACATTTGCATAAGTTTCTGACGGTCTTTATTGAGACCTATTTCTGGGCCCATGGTGCGATGGGGATCCTTCATTTGCTCCTGACAATTCGGTTGCAACAGTTGAATAAGGAATGACACAGCCAGAGCGCAGCAGGTGCAGGCTCACTATCCGGAATCTGCTCTGCGTGGCGAAGGTCTGTAAGGTATTTGATGAAAATGGGGCATAAAGCCATCCTACTGGTATGGCCGCATTATGTGATGTAACAGAGAGACTGTTCAAAATCACGCAATTGCGAACATGTCCAAGCCTTGCCGATCGCTACAGCGGACGCAAGAAAATTAACATGGACTGTCAGCACGCATAAATCAGGCAAAAACATAAGCTAGATTCTGAGCGGATATGGGAAGGCCTTGAGACGGTATTCAACAGGACTGAGGCCTTTCAATTTAAGGCTGATCCGGCGGTTGTTGTAATAATCGATATAGTTCGTAACCGCTACTTTTAA	NA	NA	NA	NA
AVR40166.1|33257_33767_-|transposase	IS3 family transposase orfA	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	59.0	8.1e-49
AVR40167.1|34461_34650_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40168.1|34831_35302_-	RES domain protein	NA	NA	NA	NA	NA
AVR40169.1|35298_35742_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40170.1|35907_36324_-	protein impB	NA	I6RSM4	Salmonella_phage	57.6	4.3e-32
AVR40171.1|36711_37707_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40172.1|39619_39958_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40173.1|41496_41766_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40174.1|42357_42807_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40175.1|42820_43609_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40176.1|44554_44818_+|transposase	transposase	transposase	NA	NA	NA	NA
AVR40177.1|44850_45675_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
>prophage 2
CP023479	Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence	189707	67996	112122	189707	integrase,transposase	Enterobacteria_phage(25.0%)	41	69860:69877	97345:97362
AVR40200.1|67996_68473_-|transposase	putative transposase-related protein	transposase	S5WIU1	Leptospira_phage	48.3	6.3e-35
AVR40201.1|68876_69551_-|transposase	transposase	transposase	Q1MVF0	Enterobacteria_phage	92.0	2.2e-118
69860:69877	attL	GATTTATTCAACAAAGCC	NA	NA	NA	NA
AVR40202.1|70037_70205_+|integrase	integrase	integrase	NA	NA	NA	NA
AVR40203.1|70489_71617_+	regulator	NA	NA	NA	NA	NA
AVR40204.1|71613_72207_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40205.1|72203_73052_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AVR40206.1|73051_73972_+	putative glutathione ABC transporter, permease protein GsiC	NA	NA	NA	NA	NA
AVR40207.1|73981_75589_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR40208.1|75633_76581_+	Acetamidase/Formamidase family protein	NA	A0A1V0S8X7	Catovirus	23.0	2.3e-12
AVR40209.1|76588_78322_+	putative phosphonate C-P lyase system protein PhnK	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AVR40210.1|79016_79394_+	Insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	99.2	8.4e-67
AVR40211.1|79614_80868_-	Lactose permease	NA	NA	NA	NA	NA
AVR40212.1|80919_83994_-	Beta-galactosidase 2	NA	L0N6M2	Herpes_simplex_virus	96.3	0.0e+00
AVR40213.1|84115_85198_-	Lactose operon repressor	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
AVR40214.1|85420_85636_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40215.1|85658_86669_+	putative alginate lyase	NA	NA	NA	NA	NA
AVR40216.1|87072_88077_+|transposase	putative transposase	transposase	NA	NA	NA	NA
AVR40217.1|88732_88900_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40218.1|88947_89241_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
AVR40219.1|89339_90107_-	iron-dicitrate transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AVR40220.1|90107_91064_-	Fe(3+) dicitrate transport system permease protein FecD	NA	NA	NA	NA	NA
AVR40221.1|91060_92059_-	Fe(3+) dicitrate transport system permease protein FecC	NA	NA	NA	NA	NA
AVR40222.1|92055_92958_-	Fe(3+) dicitrate-binding periplasmic protein	NA	NA	NA	NA	NA
AVR40223.1|93002_95327_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
AVR40224.1|95413_96367_-	Protein FecR	NA	NA	NA	NA	NA
AVR40225.1|96363_96885_-	putative RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AVR40226.1|97360_97465_-	TnpA	NA	U5N3F9	Enterobacteria_phage	93.5	1.5e-10
97345:97362	attR	GGCTTTGTTGAATAAATC	NA	NA	NA	NA
AVR40227.1|97518_98736_-	Creatinase	NA	NA	NA	NA	NA
AVR40228.1|98822_99776_-	LysR substrate-binding domain protein	NA	Q6JIH3	Burkholderia_virus	25.0	3.3e-11
AVR40229.1|99931_100780_+	ABC-type amino acid transport/signal transduction system protein	NA	NA	NA	NA	NA
AVR40230.1|100803_101475_+	ABC transporter, permease protein	NA	NA	NA	NA	NA
AVR40231.1|101471_102134_+	Amino acid ABC transporter	NA	NA	NA	NA	NA
AVR40232.1|102138_102957_+	amino acid ABC transporter	NA	G9BWD6	Planktothrix_phage	39.6	1.4e-29
AVR40233.1|102953_103919_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AVR40234.1|104174_104789_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40235.1|104969_105806_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVR40236.1|107618_108065_-	lipoprotein	NA	NA	NA	NA	NA
AVR40237.1|108482_109322_-	Sea24	NA	NA	NA	NA	NA
AVR40238.1|109321_109495_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40239.1|110045_110690_+	hypothetical protein	NA	NA	NA	NA	NA
AVR40240.1|110718_112122_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP023479	Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence	189707	122659	157645	189707	integrase,tRNA,transposase	Escherichia_phage(33.33%)	40	117323:117338	153712:153727
117323:117338	attL	CGCCTTGCCGAACAGG	NA	NA	NA	NA
AVR40254.1|122659_123736_-|transposase	putative transposase	transposase	NA	NA	NA	NA
AVR40255.1|123954_124362_-|integrase	integrase	integrase	Q716C2	Shigella_phage	95.8	2.5e-64
AVR40256.1|124788_125757_-|transposase	putative transposase for transposon Tn903	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
AVR40257.1|126539_127520_+	Transposase InsH for insertion sequence element IS5Y	NA	A0A077SK28	Escherichia_phage	99.1	2.3e-185
AVR40258.1|127985_128621_-|transposase	transposase	transposase	Q38213	Escherichia_phage	52.8	2.1e-33
AVR40259.1|128728_129598_-	transcriptional regulator	NA	NA	NA	NA	NA
AVR40260.1|129591_130602_-	Phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.8e-15
AVR40261.1|130610_131450_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AVR40262.1|131446_132310_-	putative phosphite transport system-binding protein PtxB	NA	NA	NA	NA	NA
AVR40263.1|132306_133134_-	Phosphite import ATP-binding protein PxtA	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AVR40264.1|133475_133796_+|transposase	transposase	transposase	Q38213	Escherichia_phage	52.9	3.2e-27
AVR40265.1|134104_134809_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVR40266.1|134896_135223_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40267.1|135477_135834_-	cupin	NA	NA	NA	NA	NA
AVR40268.1|135823_136225_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40269.1|136221_136488_-	DNA polymerase	NA	NA	NA	NA	NA
AVR40270.1|136670_137105_+|transposase	transposase Tn3 family protein	transposase	A0A1B0V7H9	Salmonella_phage	58.3	1.0e-39
AVR40271.1|137151_137856_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVR40272.1|138875_139250_+	camphor resistance protein CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
AVR40273.1|139449_140154_-|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR40274.1|140319_141501_+	sodium:proton antiporter	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.8e-123
AVR40275.1|141854_142187_-	small multidrug resistance protein SugE	NA	NA	NA	NA	NA
AVR40276.1|142318_142570_-	DNA invertase	NA	Q1MVP4	Enterobacteria_phage	43.4	5.8e-08
AVR40277.1|142635_143340_+|transposase	transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVR40278.1|143655_144123_-	hypothetical protein	NA	NA	NA	NA	NA
AVR40279.1|144119_145628_-	putative retA reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
AVR40280.1|146066_146459_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.3e-30
AVR40281.1|146458_147730_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.3e-155
AVR40282.1|147896_148148_+	putative plasmid stability protein	NA	NA	NA	NA	NA
AVR40283.1|148144_148432_+	Putative RelE-like toxin protein	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.7e-19
AVR40284.1|148855_149233_+	Insertion element IS1 protein InsB	NA	Q71TF0	Escherichia_phage	93.6	1.9e-63
AVR40285.1|149453_150851_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	3.4e-20
AVR40286.1|151003_151771_-|tRNA	tryptophanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AVR40287.1|151767_152145_-	Insertion element iso-IS1d protein InsB	NA	Q71TF0	Escherichia_phage	100.0	1.3e-67
AVR40288.1|152230_153769_-|transposase	putative transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
153712:153727	attR	CCTGTTCGGCAAGGCG	NA	NA	NA	NA
AVR40289.1|153818_154166_-|transposase	putative transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
AVR40290.1|154162_154561_-|transposase	putative transposase	transposase	B6DZU5	Stx2-converting_phage	92.5	6.6e-62
AVR40291.1|154917_155352_-	putative copper-binding protein PcoE	NA	NA	NA	NA	NA
AVR40292.1|155567_156968_-	putative sensor protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
AVR40293.1|156964_157645_-	Transcriptional regulatory protein PcoR	NA	W8CYM9	Bacillus_phage	34.8	3.9e-30
