The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	93813	103044	3819771		unidentified_phage(16.67%)	7	NA	NA
AVR08578.1|93813_95358_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	3.3e-24
AVR08579.1|95393_95921_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVR08580.1|95917_96601_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
AVR08581.1|96665_97481_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	4.4e-36
AVR08582.1|97656_99666_-	chloride transporter	NA	S4VT78	Pandoravirus	35.2	1.7e-52
AVR08583.1|99697_100828_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
AVR08584.1|101091_103044_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.5	1.2e-148
>prophage 2
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	364898	415988	3819771	protease,plate,tRNA,tail	Pseudomonas_phage(33.33%)	43	NA	NA
AVR08810.1|364898_366197_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AVR08811.1|366265_367348_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
AVR08812.1|367373_368231_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVR08813.1|368310_368619_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AVR08814.1|368632_369229_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AVR08815.1|369484_370273_+	dioxygenase	NA	NA	NA	NA	NA
AVR08816.1|370429_372031_-	APC family permease	NA	NA	NA	NA	NA
AVR08817.1|372465_372669_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
AVR08818.1|372655_372769_-	branched-chain amino acid ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AVR08819.1|372846_374109_-	Hsp70 family protein	NA	NA	NA	NA	NA
AVR08820.1|374325_374931_-	nitroreductase	NA	NA	NA	NA	NA
AVR08821.1|375242_376526_-	MFS transporter	NA	NA	NA	NA	NA
AVR08822.1|376684_377332_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVR08823.1|377652_378258_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
AVR08824.1|378318_379215_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR08825.1|379346_380483_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AVR11683.1|381172_381622_-	water stress/hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
AVR08826.1|381981_382104_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AVR08827.1|382281_384432_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	25.7	1.3e-47
AVR08828.1|384403_384631_-	hypothetical protein	NA	NA	NA	NA	NA
AVR08829.1|385475_385724_+	hypothetical protein	NA	NA	NA	NA	NA
AVR08830.1|385825_386047_+	PTS fructose transporter subunit IIABC	NA	NA	NA	NA	NA
AVR08831.1|386698_387967_+	MFP transporter	NA	NA	NA	NA	NA
AVR08832.1|387981_390237_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	5.8e-38
AVR08833.1|390233_391682_+	TolC family protein	NA	NA	NA	NA	NA
AVR08834.1|391878_392844_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVR08835.1|392855_393821_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AVR08836.1|394106_398012_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR08837.1|398008_398998_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
AVR08838.1|399002_399938_+	OmpA family protein	NA	NA	NA	NA	NA
AVR08839.1|400137_401268_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AVR08840.1|401353_404017_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.2	1.8e-91
AVR08841.1|404050_405151_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR11684.1|405114_406941_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR08842.1|407033_407546_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR08843.1|407573_408077_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR08844.1|408149_409640_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR08845.1|409656_410175_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR08846.1|410211_410901_-	hypothetical protein	NA	NA	NA	NA	NA
AVR08847.1|411274_411889_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR08848.1|411997_413344_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR08849.1|413340_414126_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVR08850.1|415469_415988_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
>prophage 3
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	708840	717093	3819771	integrase	Ralstonia_phage(33.33%)	8	699111:699126	721031:721046
699111:699126	attL	CCTGATCGCGGCGGCG	NA	NA	NA	NA
AVR09106.1|708840_709746_+	hypothetical protein	NA	Q6UAZ2	Ralstonia_phage	36.1	4.9e-28
AVR09107.1|709742_711131_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AVR09108.1|711597_712377_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	42.6	1.3e-37
AVR09109.1|712457_713312_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	45.5	5.4e-61
AVR09110.1|713326_713686_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	51.9	3.1e-18
AVR11708.1|713693_714011_+	XRE family transcriptional regulator	NA	A0A088CD40	Shigella_phage	55.3	1.4e-14
AVR09111.1|714450_715692_+	hypothetical protein	NA	NA	NA	NA	NA
AVR09112.1|716064_717093_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	41.3	1.2e-46
721031:721046	attR	CGCCGCCGCGATCAGG	NA	NA	NA	NA
>prophage 4
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	1633868	1644741	3819771	protease	Streptococcus_phage(16.67%)	10	NA	NA
AVR09875.1|1633868_1635983_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	1.2e-56
AVR09876.1|1636246_1636762_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	1.5e-13
AVR09877.1|1636957_1637173_-	hypothetical protein	NA	NA	NA	NA	NA
AVR09878.1|1637433_1638012_-	pseudouridine synthase	NA	NA	NA	NA	NA
AVR09879.1|1638276_1639536_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
AVR09880.1|1639508_1639685_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVR09881.1|1639697_1641284_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
AVR09882.1|1641395_1641599_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
AVR09883.1|1642129_1642444_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
AVR09884.1|1642440_1644741_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	5.1e-167
>prophage 5
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	1872378	1920500	3819771	integrase,portal,tail,tRNA,transposase,capsid,terminase,head	Pseudomonas_phage(25.0%)	48	1912914:1912932	1926700:1926718
AVR10075.1|1872378_1873599_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	3.0e-238
AVR10076.1|1873896_1874790_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AVR10077.1|1874832_1875723_-	sulfurtransferase	NA	NA	NA	NA	NA
AVR10078.1|1876047_1879572_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	36.0	1.3e-182
AVR10079.1|1879609_1881400_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	28.3	6.8e-50
AVR10080.1|1881453_1882545_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AVR10081.1|1882861_1884004_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
AVR10082.1|1884003_1885302_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AVR10083.1|1885298_1886546_+	glycosyltransferase	NA	NA	NA	NA	NA
AVR10084.1|1886631_1887807_+	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
AVR10085.1|1888082_1888847_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVR10086.1|1889280_1889664_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10087.1|1889904_1890462_-	FUSC family protein	NA	NA	NA	NA	NA
AVR10088.1|1890784_1892047_-	MFS transporter	NA	NA	NA	NA	NA
AVR11813.1|1892043_1893036_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
AVR10089.1|1893625_1894078_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AVR10090.1|1894534_1895428_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
AVR10091.1|1897825_1898290_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10092.1|1898384_1898714_-	cold-shock protein	NA	NA	NA	NA	NA
AVR11814.1|1899252_1899546_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10093.1|1900258_1900471_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10094.1|1900467_1901181_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
AVR10095.1|1901240_1902629_+	pectinacetylesterase	NA	NA	NA	NA	NA
AVR10096.1|1902814_1904203_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	52.4	1.1e-26
AVR10097.1|1905214_1905667_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10098.1|1906170_1907430_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
AVR10099.1|1907908_1908226_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
AVR10100.1|1908215_1909505_-|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	45.7	3.2e-89
AVR10101.1|1909504_1909684_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10102.1|1909696_1911592_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	44.8	8.9e-133
AVR10103.1|1911642_1913163_-|terminase	phage terminase	terminase	B5WZR8	Pseudomonas_phage	79.2	9.1e-229
1912914:1912932	attL	GCGCTTCCGGGCCGACGAG	NA	NA	NA	NA
AVR10104.1|1913144_1913585_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	59.7	2.7e-40
AVR10105.1|1913687_1913978_-	HNH endonuclease	NA	NA	NA	NA	NA
AVR10106.1|1913974_1914277_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10107.1|1914947_1915496_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10108.1|1915495_1915723_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10109.1|1915719_1916013_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10110.1|1915948_1916227_-	hypothetical protein	NA	Q3HQY6	Burkholderia_phage	67.1	3.3e-20
AVR10111.1|1916219_1916471_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10112.1|1916463_1916646_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10113.1|1916642_1916867_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10114.1|1916844_1917048_-	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	51.0	2.9e-05
AVR10115.1|1917031_1917217_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10116.1|1917206_1917512_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10117.1|1917508_1917874_-	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	46.4	4.7e-06
AVR10118.1|1917875_1918106_-	DNA-binding protein	NA	NA	NA	NA	NA
AVR10119.1|1918321_1919014_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10120.1|1919258_1920500_-|integrase	site-specific integrase	integrase	Q6J1Q2	Burkholderia_virus	44.0	1.2e-80
1926700:1926718	attR	GCGCTTCCGGGCCGACGAG	NA	NA	NA	NA
>prophage 6
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	2102190	2143647	3819771	integrase	Ralstonia_phage(48.65%)	53	2102032:2102049	2144533:2144550
2102032:2102049	attL	CCGGTCCCCGGCACCACG	NA	NA	NA	NA
AVR10263.1|2102190_2103189_+|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	39.9	3.8e-58
AVR10264.1|2103185_2103398_-	DNA-binding protein	NA	NA	NA	NA	NA
AVR10265.1|2103409_2103622_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11831.1|2103618_2104038_-	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	88.5	7.4e-72
AVR10266.1|2104675_2105011_-	hypothetical protein	NA	A9YWU9	Burkholderia_phage	88.6	8.0e-29
AVR10267.1|2105428_2106772_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	64.7	3.6e-11
AVR10268.1|2106798_2107068_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11832.1|2107587_2108268_-	YqaJ-like viral recombinase	NA	A0A0U2BXF3	Paracoccus_phage	37.6	6.0e-31
AVR10269.1|2108260_2109115_-	hypothetical protein	NA	A0A2H4J6I3	uncultured_Caudovirales_phage	67.3	3.3e-58
AVR10270.1|2110438_2110645_-	hypothetical protein	NA	Q3HQW6	Burkholderia_phage	50.7	8.2e-08
AVR10271.1|2110646_2111057_-	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	66.7	3.2e-11
AVR10272.1|2111053_2111257_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10273.1|2111278_2112370_-	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	49.0	2.7e-25
AVR10274.1|2112423_2113158_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	83.5	4.2e-54
AVR10275.1|2113296_2113437_-	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	71.7	7.2e-08
AVR10276.1|2113572_2113902_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10277.1|2113864_2114065_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10278.1|2114197_2114380_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10279.1|2114466_2114865_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVR10280.1|2114956_2115169_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10281.1|2115173_2115458_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10282.1|2115779_2116055_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11833.1|2116296_2116767_+	hypothetical protein	NA	A0A2D1GMW7	Marinobacter_phage	48.7	3.3e-36
AVR10283.1|2116809_2117742_+	hypothetical protein	NA	V5URT9	Shigella_phage	62.0	1.1e-48
AVR10284.1|2117743_2118490_+	hypothetical protein	NA	U6C6D0	Ralstonia_phage	48.8	1.3e-50
AVR10285.1|2118486_2118822_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10286.1|2119095_2119599_+	hypothetical protein	NA	G9BW80	Planktothrix_phage	25.9	1.2e-07
AVR10287.1|2120171_2120540_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10288.1|2120552_2120951_+	hypothetical protein	NA	Q716B1	Shigella_phage	68.3	1.5e-37
AVR10289.1|2120947_2121283_+	hypothetical protein	NA	U6C720	Ralstonia_phage	50.5	1.9e-09
AVR10290.1|2121510_2121690_+	hypothetical protein	NA	A0A1B1IP43	uncultured_Mediterranean_phage	73.7	8.6e-14
AVR10291.1|2121710_2122136_+	hypothetical protein	NA	A0A1B1SDV5	Weissella_phage	40.5	9.0e-09
AVR10292.1|2122053_2123553_+	DNA packaging protein	NA	U6C7Z1	Ralstonia_phage	83.4	6.6e-256
AVR10293.1|2123549_2123945_+	hypothetical protein	NA	F8TVM8	EBPR_siphovirus	50.7	1.7e-09
AVR10294.1|2123941_2126056_+	hypothetical protein	NA	U6C855	Ralstonia_phage	75.1	9.2e-296
AVR10295.1|2126169_2127117_+	hypothetical protein	NA	U6C6Y4	Ralstonia_phage	67.2	2.6e-101
AVR10296.1|2127165_2128419_+	hypothetical protein	NA	U6C6F9	Ralstonia_phage	83.2	6.6e-201
AVR10297.1|2128429_2129071_+	hypothetical protein	NA	U6C692	Ralstonia_phage	55.7	1.3e-48
AVR10298.1|2129152_2129365_+	hypothetical protein	NA	U6C7Z3	Ralstonia_phage	60.4	5.3e-10
AVR10299.1|2129361_2129853_+	hypothetical protein	NA	U6C857	Ralstonia_phage	79.3	3.8e-67
AVR10300.1|2129862_2130495_+	hypothetical protein	NA	U6C6Y6	Ralstonia_phage	76.4	3.1e-82
AVR10301.1|2130552_2130840_+	hypothetical protein	NA	U6C6G3	Ralstonia_phage	71.6	2.5e-31
AVR10302.1|2130841_2132299_+	hypothetical protein	NA	U6C697	Ralstonia_phage	77.2	5.6e-228
AVR10303.1|2132295_2133258_+	hypothetical protein	NA	U6C7Z5	Ralstonia_phage	32.8	1.6e-05
AVR10304.1|2133261_2133606_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10305.1|2133752_2134610_+	SET domain-containing protein-lysine N-methyltransferase	NA	U6C6Z0	Ralstonia_phage	69.7	8.9e-56
AVR10306.1|2134606_2135476_+	hypothetical protein	NA	U6C6G7	Ralstonia_phage	54.4	1.4e-64
AVR10307.1|2135487_2136945_+	hypothetical protein	NA	U6C6A1	Ralstonia_phage	40.0	8.8e-88
AVR10308.1|2136948_2140338_+	lytic transglycosylase domain-containing protein	NA	U6C7Z7	Ralstonia_phage	44.3	2.8e-246
AVR10309.1|2140341_2142591_+	hypothetical protein	NA	U6C860	Ralstonia_phage	45.6	3.7e-53
AVR11834.1|2142614_2142806_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10310.1|2142802_2143168_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10311.1|2143164_2143647_+	hypothetical protein	NA	Q775E1	Bordetella_phage	46.8	2.3e-37
2144533:2144550	attR	CCGGTCCCCGGCACCACG	NA	NA	NA	NA
>prophage 7
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	2974952	3040560	3819771	integrase,plate,protease,portal,tail,transposase,capsid,terminase,head	uncultured_Caudovirales_phage(25.0%)	75	3008395:3008412	3043816:3043833
AVR10952.1|2974952_2976224_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.8	5.4e-134
AVR10953.1|2976384_2977038_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.0	1.1e-53
AVR10954.1|2977177_2978527_-	trigger factor	NA	NA	NA	NA	NA
AVR10955.1|2978739_2978940_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10956.1|2978963_2980127_+	glycerate kinase	NA	NA	NA	NA	NA
AVR10957.1|2980218_2980668_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVR10958.1|2980987_2981977_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AVR11914.1|2982060_2983209_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVR10959.1|2983541_2984603_+	porin	NA	NA	NA	NA	NA
AVR10960.1|2984626_2985820_+	MFS transporter	NA	NA	NA	NA	NA
AVR11915.1|2985954_2986977_+	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	32.7	1.4e-39
AVR10961.1|2987180_2987804_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.6	6.3e-19
AVR10962.1|2988041_2988668_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
AVR10963.1|2988706_2989165_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10964.1|2989180_2989582_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10965.1|2989643_2990075_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	1.2e-13
AVR10966.1|2990071_2990581_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.6e-20
AVR11916.1|2991171_2992371_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	3.5e-42
AVR10967.1|2992524_2992902_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11917.1|2993303_2993612_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	61.2	1.9e-24
AVR10968.1|2994271_2995327_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AVR10969.1|2995450_2998108_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10970.1|2998662_2999334_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	83.3	1.6e-113
AVR11918.1|2999413_2999881_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	62.3	2.0e-49
AVR10971.1|2999877_3000159_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10972.1|3000218_3000644_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	5.4e-14
AVR10973.1|3000640_3001150_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.9	6.1e-20
AVR10974.1|3001491_3002094_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10975.1|3002100_3002823_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	44.8	1.1e-30
AVR10976.1|3002858_3003647_-	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	96.2	2.6e-150
AVR10977.1|3003790_3004339_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	88.4	1.4e-75
AVR10978.1|3004338_3004836_-	glycosyl hydrolase	NA	A4JX20	Burkholderia_virus	80.6	1.5e-68
AVR10979.1|3004828_3005023_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10980.1|3005098_3006151_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	43.6	6.6e-77
AVR10981.1|3006160_3006367_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	2.0e-14
AVR10982.1|3006341_3007223_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	38.2	9.2e-32
AVR10983.1|3007231_3009637_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.9	4.0e-69
3008395:3008412	attL	CCGTGAGCGCCGCCTTGA	NA	NA	NA	NA
AVR10984.1|3009724_3010027_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.9e-05
AVR10985.1|3010870_3011212_+	hypothetical protein	NA	NA	NA	NA	NA
AVR10986.1|3011882_3012386_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.9	3.3e-42
AVR10987.1|3012396_3013566_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.2	6.9e-160
AVR10988.1|3013629_3014316_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	58.6	1.5e-58
AVR10989.1|3014329_3016135_-|tail	phage tail protein	tail	A4JWS9	Burkholderia_virus	68.8	9.0e-151
AVR10990.1|3016122_3016698_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	48.4	3.5e-32
AVR10991.1|3016690_3017584_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	8.4e-49
AVR10992.1|3017580_3017925_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	3.6e-24
AVR10993.1|3017921_3018119_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10994.1|3018184_3018865_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	9.0e-19
AVR10995.1|3018867_3019401_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	6.2e-23
AVR10996.1|3019390_3019921_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.2	2.4e-11
AVR10997.1|3019922_3020213_-	hypothetical protein	NA	NA	NA	NA	NA
AVR10998.1|3020216_3021242_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.2e-109
AVR10999.1|3021275_3021620_-|head	head decoration protein	head	NA	NA	NA	NA
AVR11000.1|3021646_3022747_-	peptidase S14	NA	A0A2H4JDI2	uncultured_Caudovirales_phage	36.9	1.8e-48
AVR11001.1|3022743_3024237_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.0	8.3e-134
AVR11002.1|3024233_3024440_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11003.1|3024450_3026439_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.6	3.0e-179
AVR11004.1|3026401_3026971_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVR11005.1|3027064_3027253_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11006.1|3028118_3028706_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11007.1|3028923_3031416_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.5	3.2e-98
AVR11008.1|3031534_3032005_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11919.1|3032135_3032315_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11920.1|3032909_3033242_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11009.1|3033255_3033783_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	4.4e-29
AVR11921.1|3033872_3034100_-	hypothetical protein	NA	B5WZX6	Pseudomonas_phage	49.0	7.1e-05
AVR11010.1|3034249_3034735_+	transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	40.2	9.9e-12
AVR11011.1|3035218_3035488_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11012.1|3035542_3035878_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11013.1|3035874_3036480_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11014.1|3036476_3036926_+	ACP synthase	NA	NA	NA	NA	NA
AVR11015.1|3036925_3038245_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
AVR11016.1|3038358_3038688_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11922.1|3039238_3039541_+	hypothetical protein	NA	NA	NA	NA	NA
AVR11017.1|3039537_3040560_-|integrase	integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	46.0	1.3e-66
3043816:3043833	attR	CCGTGAGCGCCGCCTTGA	NA	NA	NA	NA
>prophage 8
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	3539606	3548254	3819771		Acanthocystis_turfacea_chlorella_virus(16.67%)	8	NA	NA
AVR11963.1|3539606_3540449_+	alpha/beta hydrolase	NA	A7K906	Acanthocystis_turfacea_chlorella_virus	24.6	3.8e-11
AVR11419.1|3540784_3541708_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
AVR11420.1|3541835_3543128_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AVR11421.1|3543222_3544125_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
AVR11422.1|3544459_3544777_-	competence protein ComE	NA	NA	NA	NA	NA
AVR11423.1|3544848_3545841_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
AVR11424.1|3545898_3546885_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
AVR11425.1|3546853_3548254_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.1e-79
>prophage 9
CP020390	Burkholderia thailandensis strain FDAARGOS_237 chromosome 1, complete sequence	3819771	3656231	3665173	3819771	transposase	Staphylococcus_phage(28.57%)	10	NA	NA
AVR11514.1|3656231_3657368_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.9	4.3e-42
AVR11515.1|3657382_3658012_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.2	2.4e-26
AVR11516.1|3658055_3658439_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	43.6	9.9e-07
AVR11517.1|3658435_3658663_-	transcriptional regulator	NA	NA	NA	NA	NA
AVR11971.1|3658801_3659029_+	helicase	NA	NA	NA	NA	NA
AVR11518.1|3660059_3661319_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.4	1.5e-43
AVR11972.1|3661595_3662003_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	38.2	3.1e-14
AVR11519.1|3661999_3662629_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	1.5e-31
AVR11520.1|3662649_3662886_-	hypothetical protein	NA	NA	NA	NA	NA
AVR11521.1|3664036_3665173_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.0	3.7e-49
>prophage 1
CP020389	Burkholderia thailandensis strain FDAARGOS_237 chromosome 2, complete sequence	2853041	817870	844876	2853041	holin,terminase,portal,integrase,transposase	Burkholderia_virus(81.82%)	28	816196:816221	839770:839795
816196:816221	attL	TGGTGGGCCCGGCGGGTTTCGAACCC	NA	NA	NA	NA
AVR08330.1|817870_818545_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	88.3	2.1e-121
AVR06737.1|818630_819272_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	88.7	1.6e-105
AVR06738.1|819287_819692_+	hypothetical protein	NA	NA	NA	NA	NA
AVR06739.1|819791_819995_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
AVR06740.1|820091_821027_-	hypothetical protein	NA	A4JX22	Burkholderia_virus	55.9	2.2e-76
AVR06741.1|821088_821559_-	lysozyme	NA	A4JX21	Burkholderia_virus	79.4	5.4e-55
AVR06742.1|821657_821870_-|holin	holin	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
AVR06743.1|821912_822656_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	73.7	8.1e-106
AVR06744.1|822655_822964_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	70.6	8.4e-41
AVR06745.1|826049_827309_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	100.0	5.6e-240
AVR06746.1|827313_827499_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	100.0	2.0e-21
AVR06747.1|827495_829208_-|terminase	terminase large subunit	terminase	Q8W6U9	Burkholderia_virus	100.0	0.0e+00
AVR06748.1|829217_829703_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	99.4	2.9e-88
AVR06749.1|829848_830205_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	98.3	1.4e-63
AVR06750.1|830263_830521_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
AVR06751.1|830517_830904_+	XRE family transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.0e-64
AVR06752.1|830908_831394_+	hypothetical protein	NA	A4JX63	Burkholderia_virus	92.9	5.2e-21
AVR08331.1|832172_833282_+	hypothetical protein	NA	NA	NA	NA	NA
AVR06753.1|834184_835296_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AVR08332.1|836435_836717_+	hypothetical protein	NA	NA	NA	NA	NA
AVR06754.1|836867_837515_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	92.5	5.4e-106
AVR06755.1|837523_837784_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	88.4	1.3e-39
AVR08333.1|837759_838026_-	hypothetical protein	NA	Q8W6N6	Burkholderia_virus	93.2	1.9e-41
AVR06756.1|838793_839744_+|integrase	site-specific integrase	integrase	Q774Z5	Bordetella_phage	58.1	1.1e-99
AVR06757.1|839969_842012_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
839770:839795	attR	TGGTGGGCCCGGCGGGTTTCGAACCC	NA	NA	NA	NA
AVR06758.1|842070_842409_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AVR06759.1|842455_844333_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.3	8.4e-67
AVR06760.1|844429_844876_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	2.6e-22
>prophage 2
CP020389	Burkholderia thailandensis strain FDAARGOS_237 chromosome 2, complete sequence	2853041	1398569	1479501	2853041	plate,transposase,holin	Ralstonia_phage(42.86%)	60	NA	NA
AVR07216.1|1398569_1399088_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR07217.1|1399089_1400970_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR08382.1|1400966_1402016_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR07218.1|1402034_1403105_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07219.1|1403160_1404189_+	fimbrial protein	NA	NA	NA	NA	NA
AVR07220.1|1404221_1405580_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
AVR07221.1|1405472_1408925_-	RHS repeat protein	NA	NA	NA	NA	NA
AVR07222.1|1408937_1409207_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07223.1|1409281_1411957_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
AVR07224.1|1412024_1412594_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07225.1|1412763_1416672_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR07226.1|1416686_1417988_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AVR08383.1|1417984_1419334_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR07227.1|1419339_1419882_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR07228.1|1420009_1420492_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AVR07229.1|1420692_1422192_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR07230.1|1422225_1422765_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR07231.1|1423108_1424785_-	hypothetical protein	NA	NA	NA	NA	NA
AVR08384.1|1424787_1425444_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVR07232.1|1425507_1426080_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVR08385.1|1426072_1428706_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVR07233.1|1428928_1429669_-	pilus assembly protein	NA	NA	NA	NA	NA
AVR07234.1|1429735_1430290_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVR07235.1|1431071_1431470_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07236.1|1431442_1431649_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07237.1|1431684_1433172_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AVR07238.1|1433247_1435731_-	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	9.0e-08
AVR07239.1|1436587_1436785_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07240.1|1437279_1438821_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07241.1|1439830_1441897_+	FUSC family protein	NA	NA	NA	NA	NA
AVR07242.1|1441893_1442118_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AVR07243.1|1442119_1443019_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AVR07244.1|1443012_1444437_+	TolC family protein	NA	NA	NA	NA	NA
AVR07245.1|1444436_1445636_+	transcriptional regulator CynR	NA	NA	NA	NA	NA
AVR07246.1|1445768_1446014_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AVR07247.1|1446641_1446965_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07248.1|1447526_1448450_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR07249.1|1449089_1450232_+	porin	NA	NA	NA	NA	NA
AVR07250.1|1450706_1451063_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AVR07251.1|1451872_1452565_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07252.1|1453037_1453364_+	thioredoxin	NA	NA	NA	NA	NA
AVR07253.1|1453383_1453803_+	YjbQ family protein	NA	NA	NA	NA	NA
AVR07254.1|1454217_1454481_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVR07255.1|1454490_1456029_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AVR07256.1|1456167_1456893_-	DUF3274 domain-containing protein	NA	NA	NA	NA	NA
AVR07257.1|1457190_1457454_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVR07258.1|1457463_1459002_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AVR07259.1|1459140_1460631_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	1.0e-06
AVR07260.1|1461466_1461730_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AVR07261.1|1461739_1463275_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
AVR07262.1|1463413_1465654_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.9	4.0e-23
AVR08386.1|1465667_1468439_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	2.3e-89
AVR07263.1|1468769_1469075_-	H-NS histone family protein	NA	NA	NA	NA	NA
AVR07264.1|1469234_1470305_+|transposase	IS5/IS1182 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.4	3.6e-62
AVR07265.1|1470853_1471885_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR07266.1|1471881_1472736_-	ABC transporter permease	NA	NA	NA	NA	NA
AVR07267.1|1472722_1473640_-	ABC transporter permease	NA	NA	NA	NA	NA
AVR07268.1|1474103_1474556_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVR07269.1|1474574_1475591_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVR07270.1|1477305_1479501_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 3
CP020389	Burkholderia thailandensis strain FDAARGOS_237 chromosome 2, complete sequence	2853041	2033014	2040457	2853041	integrase,transposase	Burkholderia_virus(25.0%)	10	2023845:2023860	2045583:2045598
2023845:2023860	attL	TCCGCCTCGTCCGAAT	NA	NA	NA	NA
AVR07702.1|2033014_2033590_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.0	2.3e-23
AVR07703.1|2033660_2034776_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	80.4	8.6e-176
AVR07704.1|2034785_2035520_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	50.9	3.0e-52
AVR07705.1|2035516_2036044_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	66.1	6.2e-60
AVR07706.1|2036323_2036503_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	74.6	1.2e-18
AVR08430.1|2036546_2036963_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0A8JBA5	Ralstonia_phage	58.9	1.2e-26
AVR07707.1|2036872_2037151_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07708.1|2037309_2038578_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.8e-43
AVR07709.1|2038768_2039266_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07710.1|2039884_2040457_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	65.9	1.7e-55
2045583:2045598	attR	TCCGCCTCGTCCGAAT	NA	NA	NA	NA
>prophage 4
CP020389	Burkholderia thailandensis strain FDAARGOS_237 chromosome 2, complete sequence	2853041	2168900	2239441	2853041	plate,holin	Vibrio_phage(25.0%)	56	NA	NA
AVR07788.1|2168900_2169668_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
AVR07789.1|2169706_2170708_-	HpnL family protein	NA	NA	NA	NA	NA
AVR07790.1|2170704_2171478_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
AVR07791.1|2171474_2172170_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AVR07792.1|2172532_2174047_+	succinate CoA transferase	NA	NA	NA	NA	NA
AVR07793.1|2175667_2176612_+	hypothetical protein	NA	NA	NA	NA	NA
AVR08442.1|2176645_2177197_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR07794.1|2177193_2178705_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR07795.1|2178848_2179376_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR07796.1|2179454_2179886_+	type VI secretion protein	NA	NA	NA	NA	NA
AVR07797.1|2179899_2181762_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR07798.1|2181758_2182748_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVR07799.1|2182750_2185594_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
AVR07800.1|2185584_2187876_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVR07801.1|2188044_2190333_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AVR07802.1|2190336_2192553_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AVR07803.1|2192552_2193623_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07804.1|2193625_2194342_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
AVR07805.1|2194381_2194771_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AVR07806.1|2194776_2195370_+	type VI secretion system-associated lipoprotein	NA	NA	NA	NA	NA
AVR07807.1|2195366_2196728_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR07808.1|2196753_2198538_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07809.1|2198534_2202029_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AVR07810.1|2202087_2202447_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07811.1|2202469_2202895_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07812.1|2203115_2203487_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07813.1|2203663_2203780_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07814.1|2204059_2204959_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVR07815.1|2205238_2206507_+	glycosyltransferase	NA	NA	NA	NA	NA
AVR07816.1|2206503_2208075_+	MFS transporter	NA	NA	NA	NA	NA
AVR07817.1|2208207_2209173_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVR07818.1|2209225_2210788_+	RND transporter	NA	NA	NA	NA	NA
AVR08443.1|2210982_2212251_+	hemolysin secretion protein D	NA	NA	NA	NA	NA
AVR08444.1|2212443_2212647_-	hypothetical protein	NA	NA	NA	NA	NA
AVR07819.1|2212702_2214376_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	3.0e-55
AVR07820.1|2214494_2216066_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
AVR07821.1|2216252_2217269_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AVR07822.1|2217420_2217618_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07823.1|2217614_2218814_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.1e-11
AVR07824.1|2218999_2220025_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AVR07825.1|2220182_2220422_+	hypothetical protein	NA	NA	NA	NA	NA
AVR07826.1|2220433_2221708_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
AVR07827.1|2221779_2222751_+	membrane dipeptidase	NA	NA	NA	NA	NA
AVR07828.1|2222898_2223432_+	4-vinyl reductase	NA	NA	NA	NA	NA
AVR07829.1|2223492_2225556_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR07830.1|2225558_2227484_+	DUF3483 domain-containing protein	NA	NA	NA	NA	NA
AVR07831.1|2227488_2228670_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AVR07832.1|2228666_2229452_+	drug:proton antiporter	NA	NA	NA	NA	NA
AVR08445.1|2229503_2230745_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AVR07833.1|2230765_2231905_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR07834.1|2232014_2232878_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR07835.1|2233057_2234713_+	APC family permease	NA	NA	NA	NA	NA
AVR07836.1|2234799_2235675_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AVR07837.1|2235818_2236718_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR07838.1|2236853_2238407_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
AVR08446.1|2238442_2239441_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
