The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	17225	114286	3428385	head,plate,protease,capsid,tRNA,terminase,portal,tail,integrase,holin	Burkholderia_phage(75.93%)	103	48897:48944	86737:86784
AVR20525.1|17225_18698_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
AVR20526.1|18702_20193_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AVR20527.1|20263_20563_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	NA	NA	NA	NA
AVR20528.1|20927_21971_+	rod shape-determining protein	NA	NA	NA	NA	NA
AVR20529.1|22096_23140_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AVR20530.1|23136_23649_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AVR20531.1|23751_26079_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AVR20532.1|26090_27239_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AVR20533.1|27281_28055_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AVR20534.1|28051_28837_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
AVR20535.1|29062_29515_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	31.4	2.0e-14
AVR20536.1|29534_30167_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	33.6	1.9e-07
AVR20537.1|30241_30976_-	7-cyano-7-deazaguanine synthase	NA	A0A1B0Z0B4	Vibrio_phage	43.5	2.1e-50
AVR20538.1|31439_32141_-	two-component system response regulator	NA	NA	NA	NA	NA
AVR20539.1|32141_34595_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AVR20540.1|34584_35175_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
AVR20541.1|35171_36575_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AVR20542.1|36764_37622_-|protease	protease HtpX	protease	NA	NA	NA	NA
AVR20543.1|37719_38361_-	LysE family translocator	NA	NA	NA	NA	NA
AVR20544.1|38482_39466_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	1.6e-08
AVR23499.1|39500_40004_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	32.1	1.1e-13
AVR23500.1|40235_41528_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.6	5.7e-22
AVR20545.1|41565_41946_+	thioredoxin	NA	NA	NA	NA	NA
AVR20546.1|42150_44748_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	24.7	3.4e-18
AVR20547.1|44892_45942_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR20548.1|46365_47379_+	3-phosphoglycerate dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	23.2	1.1e-09
AVR20549.1|47398_48265_-	Patatin	NA	NA	NA	NA	NA
AVR20550.1|48273_48678_-	PaaI family thioesterase	NA	NA	NA	NA	NA
48897:48944	attL	GGACTCTTAATCCGTAGGTCGAGTGTTCGAGTCACTCACGCCCCACCA	NA	NA	NA	NA
AVR20551.1|49127_49652_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	64.2	3.4e-58
AVR20552.1|49554_50367_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	47.3	7.1e-47
AVR23501.1|50384_51488_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	60.1	4.0e-93
AVR20553.1|52368_53010_+	hypothetical protein	NA	NA	NA	NA	NA
AVR20554.1|53504_54248_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AVR20555.1|54718_54958_-	hypothetical protein	NA	NA	NA	NA	NA
AVR20556.1|55186_55432_-	hypothetical protein	NA	NA	NA	NA	NA
AVR20557.1|55624_56674_-|portal	phage portal protein	portal	E5E3S7	Burkholderia_phage	93.1	1.2e-190
AVR20558.1|56673_58425_-	oxidoreductase	NA	E5E3S6	Burkholderia_phage	92.3	0.0e+00
AVR20559.1|58574_59396_+|capsid	phage capsid protein	capsid	E5E3S5	Burkholderia_phage	96.0	3.9e-141
AVR20560.1|59433_60453_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	86.4	8.4e-170
AVR20561.1|60449_61136_+|terminase	terminase	terminase	E5E3S3	Burkholderia_phage	93.4	1.6e-116
AVR20562.1|61240_61717_+|head	phage head protein	head	E5E3S2	Burkholderia_phage	91.8	1.5e-76
AVR20563.1|61716_61959_+	hypothetical protein	NA	E5E3S1	Burkholderia_phage	72.5	1.1e-24
AVR20564.1|61958_62171_+|tail	phage tail protein	tail	E5E3S0	Burkholderia_phage	94.3	3.7e-32
AVR20565.1|62173_62548_+	hypothetical protein	NA	E5E3R9	Burkholderia_phage	96.8	5.0e-56
AVR20566.1|62547_62868_+|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	92.5	3.7e-47
AVR20567.1|62860_63661_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	90.6	6.4e-133
AVR20568.1|63657_64149_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	70.6	2.6e-52
AVR20569.1|64145_64556_+|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	96.3	2.1e-71
AVR20570.1|64555_65005_+	phage virion morphogenesis protein	NA	E5E3R3	Burkholderia_phage	89.3	3.5e-64
AVR20571.1|65421_66126_+|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	81.9	1.1e-96
AVR20572.1|66122_66500_+	hypothetical protein	NA	E5E3R0	Burkholderia_phage	89.6	3.5e-57
AVR20573.1|66496_67402_+|plate	baseplate assembly protein	plate	E5E3Q9	Burkholderia_phage	94.7	4.2e-157
AVR20574.1|67394_67949_+|tail	phage tail protein I	tail	E5E3Q8	Burkholderia_phage	92.9	1.2e-93
AVR20575.1|67951_69562_+|tail	phage tail protein	tail	E5E3Q7	Burkholderia_phage	99.3	7.8e-263
AVR20576.1|69572_70409_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	89.3	7.6e-145
AVR23502.1|70452_70638_-	hypothetical protein	NA	NA	NA	NA	NA
AVR20577.1|70977_71160_+	Com family DNA-binding transcriptional regulator	NA	E5E3Q5	Burkholderia_phage	81.4	5.3e-11
AVR20578.1|71319_71448_+	DNA methylase	NA	E5E3Q4	Burkholderia_phage	87.2	9.5e-15
AVR20579.1|71632_72805_+|tail	phage tail protein	tail	A0A1S5NNH8	Burkholderia_phage	92.3	2.2e-214
AVR20580.1|72834_73344_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	94.1	3.6e-89
AVR20581.1|73377_73689_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	97.1	5.7e-45
AVR20582.1|73685_73808_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	90.0	1.0e-13
AVR20583.1|73804_76567_+	hypothetical protein	NA	E5E3P9	Burkholderia_phage	79.5	0.0e+00
AVR20584.1|76579_77008_+	oxidoreductase	NA	E5E3P8	Burkholderia_phage	95.8	2.2e-71
AVR20585.1|77004_78153_+	late control protein D	NA	E5E3P7	Burkholderia_phage	96.6	1.6e-193
AVR20586.1|78619_79000_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVR20587.1|79005_79497_-	XRE family transcriptional regulator	NA	E5E3U2	Burkholderia_phage	42.0	6.7e-24
AVR23503.1|79614_79800_+	hypothetical protein	NA	K4NZX7	Burkholderia_phage	49.2	6.9e-06
AVR23504.1|79815_80010_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	58.7	2.7e-13
AVR20588.1|80035_80227_+	hypothetical protein	NA	E5E3T9	Burkholderia_phage	57.8	1.2e-10
AVR20589.1|80254_80503_+	transcriptional regulator	NA	E5E3P1	Burkholderia_phage	89.0	1.0e-36
AVR20590.1|80591_80786_+	hypothetical protein	NA	E5E3P0	Burkholderia_phage	98.4	1.0e-28
AVR20591.1|80789_80993_+	hypothetical protein	NA	E5E3N9	Burkholderia_phage	92.5	2.5e-25
AVR20592.1|81036_81231_+	hypothetical protein	NA	E5E3N8	Burkholderia_phage	95.3	1.8e-25
AVR23505.1|81235_81595_+	hypothetical protein	NA	E5E3N7	Burkholderia_phage	97.5	1.3e-56
AVR20593.1|81591_81852_+	hypothetical protein	NA	E5E3N6	Burkholderia_phage	91.9	1.7e-34
AVR20594.1|81854_84650_+	hypothetical protein	NA	E5E3N5	Burkholderia_phage	96.7	0.0e+00
AVR23506.1|85268_85538_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AVR20595.1|85538_86618_+|integrase	integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	31.5	3.6e-30
AVR20596.1|86932_88126_-	heptosyltransferase	NA	NA	NA	NA	NA
86737:86784	attR	GGACTCTTAATCCGTAGGTCGAGTGTTCGAGTCACTCACGCCCCACCA	NA	NA	NA	NA
AVR23507.1|88706_89777_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
AVR20597.1|89763_90588_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVR20598.1|91002_91911_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
AVR20599.1|91977_93432_-	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
AVR20600.1|93456_94695_-	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
AVR20601.1|94904_95960_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR20602.1|96051_97143_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	5.0e-27
AVR20603.1|97139_98867_+	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVR20604.1|98913_100044_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
AVR20605.1|100113_101502_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AVR20606.1|101620_102346_-	phosphonate utilization associated transcriptional regulator	NA	NA	NA	NA	NA
AVR20607.1|102482_104147_-	L-lactate permease	NA	NA	NA	NA	NA
AVR20608.1|104519_104831_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
AVR20609.1|104915_106517_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AVR23508.1|106833_107784_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
AVR20610.1|107801_108899_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	41.9	7.2e-18
AVR20611.1|108836_109154_+	hypothetical protein	NA	NA	NA	NA	NA
AVR20612.1|109277_109691_+	VOC family virulence protein	NA	NA	NA	NA	NA
AVR20613.1|109715_110270_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23509.1|110460_110805_-	hypothetical protein	NA	NA	NA	NA	NA
AVR20614.1|111261_111804_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVR20615.1|112204_112453_+	DUF2795 domain-containing protein	NA	NA	NA	NA	NA
AVR20616.1|112891_114286_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 2
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	487363	511831	3428385	protease,transposase,plate	uncultured_Caudovirales_phage(60.0%)	19	NA	NA
AVR20941.1|487363_487885_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.0	7.4e-21
AVR20942.1|488673_488877_+	hypothetical protein	NA	NA	NA	NA	NA
AVR20943.1|488989_489790_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR20944.1|490111_493291_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.1	4.6e-57
AVR20945.1|493347_497991_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.3	4.2e-43
AVR20946.1|498106_498295_+	hypothetical protein	NA	NA	NA	NA	NA
AVR20947.1|499212_499638_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVR20948.1|499630_499795_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	75.0	3.8e-16
AVR20949.1|499835_501095_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.0e-44
AVR20950.1|501825_502608_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AVR20951.1|502604_503951_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AVR20952.1|504053_504665_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AVR20953.1|505040_505673_+	hypothetical protein	NA	NA	NA	NA	NA
AVR20954.1|505708_506224_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AVR20955.1|506239_507730_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AVR20956.1|507801_508305_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AVR20957.1|508367_508853_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AVR20958.1|508931_510767_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AVR20959.1|510730_511831_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	824818	833786	3428385		Hokovirus(16.67%)	7	NA	NA
AVR21222.1|824818_826765_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	51.2	2.7e-148
AVR21223.1|827027_828158_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.4	2.6e-23
AVR21224.1|828161_830024_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	38.0	2.6e-60
AVR21225.1|830127_830943_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	4.4e-36
AVR21226.1|830989_831676_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.9	3.3e-13
AVR21227.1|831672_832212_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AVR21228.1|832247_833786_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.7	6.1e-23
>prophage 4
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	1202376	1210641	3428385		Bacillus_phage(16.67%)	8	NA	NA
AVR21563.1|1202376_1203777_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.7	2.3e-77
AVR21564.1|1203769_1204735_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	1.2e-16
AVR21565.1|1204783_1205776_+	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	6.9e-28
AVR21566.1|1205851_1206208_+	competence protein ComE	NA	NA	NA	NA	NA
AVR21567.1|1206416_1207319_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.2	1.8e-51
AVR21568.1|1207400_1208744_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AVR21569.1|1208787_1209711_+	deacetylase	NA	A0A2K9KZC4	Tupanvirus	33.6	2.5e-40
AVR21570.1|1209732_1210641_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.8	6.2e-15
>prophage 5
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	2261883	2353465	3428385	head,plate,protease,capsid,tRNA,tail,portal,terminase,holin	uncultured_Caudovirales_phage(24.39%)	95	NA	NA
AVR22467.1|2261883_2263293_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AVR22468.1|2263571_2264498_+	esterase	NA	A0A1V0SKV5	Klosneuvirus	27.2	2.2e-07
AVR22469.1|2264594_2265269_-	peptidoglycan endopeptidase	NA	A0A0A8WF62	Clostridium_phage	38.7	7.3e-21
AVR22470.1|2265396_2267019_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	6.7e-20
AVR22471.1|2267015_2268113_-	ABC transporter permease	NA	NA	NA	NA	NA
AVR22472.1|2268188_2269232_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AVR22473.1|2269298_2271182_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVR22474.1|2271359_2271689_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22475.1|2271951_2272284_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AVR22476.1|2272284_2272893_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AVR22477.1|2272892_2274899_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AVR22478.1|2274902_2275790_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AVR22479.1|2276055_2277585_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
AVR22480.1|2278424_2279675_-	aspartate kinase	NA	NA	NA	NA	NA
AVR22481.1|2280017_2281424_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AVR22482.1|2281470_2282442_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AVR22483.1|2282544_2283426_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
AVR22484.1|2283469_2284867_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.8	2.2e-40
AVR23645.1|2285156_2285822_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AVR22485.1|2285863_2286439_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	39.3	8.1e-13
AVR22486.1|2286527_2287019_+	cyclophilin	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	9.7e-07
AVR22487.1|2287042_2287843_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AVR22488.1|2287877_2288651_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
AVR22489.1|2288827_2289652_-	RNA methyltransferase	NA	NA	NA	NA	NA
AVR22490.1|2289928_2290732_+	inositol monophosphatase	NA	NA	NA	NA	NA
AVR23646.1|2291009_2293295_-	NTPase	NA	NA	NA	NA	NA
AVR22491.1|2294157_2294346_-	hypothetical protein	NA	Q8W6R8	Burkholderia_virus	69.5	4.4e-16
AVR22492.1|2294405_2294648_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AVR22493.1|2296263_2297553_-	ATP-binding protein	NA	NA	NA	NA	NA
AVR23647.1|2298003_2299692_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22494.1|2299700_2300414_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22495.1|2300581_2301484_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AVR22496.1|2301578_2302070_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	78.5	2.3e-72
AVR22497.1|2302169_2302577_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	41.4	3.4e-13
AVR22498.1|2302581_2303085_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	42.4	8.4e-22
AVR22499.1|2303432_2304047_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22500.1|2304059_2304770_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	39.0	1.9e-32
AVR22501.1|2304810_2305599_-	restriction endonuclease subunit M	NA	Q8W6S4	Burkholderia_virus	92.0	5.0e-146
AVR22502.1|2305768_2306263_-	DUF2514 domain-containing protein	NA	C7BGD9	Burkholderia_phage	55.8	4.5e-36
AVR22503.1|2306259_2306754_-	glycoside hydrolase	NA	Q6J1Q5	Burkholderia_virus	86.6	4.0e-77
AVR22504.1|2306756_2307041_-|holin	holin	holin	C7BGD7	Burkholderia_phage	95.7	5.9e-41
AVR22505.1|2307115_2308168_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	49.9	4.5e-86
AVR22506.1|2308178_2308385_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	2.6e-14
AVR22507.1|2308359_2309241_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.2	2.7e-31
AVR22508.1|2309251_2311669_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.1	2.6e-60
AVR22509.1|2311724_2312054_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVR22510.1|2312137_2312641_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	6.0e-44
AVR22511.1|2312651_2313821_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.7	7.6e-159
AVR22512.1|2313902_2314346_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVR22513.1|2314342_2315422_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	53.4	1.3e-64
AVR22514.1|2315418_2315985_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	48.0	2.8e-34
AVR22515.1|2315977_2316871_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	37.5	1.2e-47
AVR22516.1|2316867_2317212_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	8.0e-24
AVR22517.1|2317208_2317406_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22518.1|2318311_2318995_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	32.0	4.1e-19
AVR22519.1|2318991_2319519_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	40.2	1.1e-24
AVR22520.1|2319511_2320039_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	31.0	7.4e-21
AVR22521.1|2320044_2320335_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22522.1|2320336_2321332_-|capsid	minor capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.2	8.3e-114
AVR22523.1|2321404_2321749_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	56.3	2.0e-19
AVR22524.1|2321773_2322847_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.7	2.4e-50
AVR22525.1|2322843_2324334_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.8	1.2e-137
AVR22526.1|2324330_2324537_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22527.1|2324546_2326661_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.6	5.8e-181
AVR22528.1|2326710_2327013_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22529.1|2327157_2327352_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22530.1|2327492_2327801_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22531.1|2328565_2329153_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22532.1|2329374_2331882_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.1	1.5e-98
AVR23648.1|2332040_2332424_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22533.1|2332425_2332953_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	48.0	3.9e-30
AVR23649.1|2333082_2333355_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22534.1|2333766_2333976_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22535.1|2334046_2334475_+	transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	62.2	5.8e-16
AVR23650.1|2334918_2335137_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22536.1|2335187_2335553_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AVR22537.1|2335552_2336149_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22538.1|2336145_2337180_+	chromosome partitioning protein ParB	NA	Q6UYL1	Burkholderia_phage	34.1	5.2e-26
AVR22539.1|2337281_2337596_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23651.1|2337990_2338233_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	62.7	1.9e-19
AVR22540.1|2338517_2339366_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23652.1|2339607_2339922_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22541.1|2340229_2341504_-	DUF4102 domain-containing protein	NA	C7BGE7	Burkholderia_phage	58.4	2.9e-151
AVR22542.1|2341663_2344351_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.6	1.8e-25
AVR22543.1|2344331_2345594_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22544.1|2345573_2346131_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AVR22545.1|2346163_2347390_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AVR23653.1|2347440_2347686_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22546.1|2347615_2347879_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22547.1|2347994_2348771_-	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	27.5	1.6e-11
AVR22548.1|2348775_2349921_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
AVR22549.1|2350032_2350938_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AVR22550.1|2350984_2351587_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVR22551.1|2351591_2352794_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AVR22552.1|2352802_2353465_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 6
CP020397	Burkholderia multivorans strain FDAARGOS_246 chromosome 1, complete sequence	3428385	2644502	2680869	3428385	head,plate,protease,capsid,tail,portal,integrase,holin	uncultured_Caudovirales_phage(44.0%)	45	2634327:2634344	2685840:2685857
2634327:2634344	attL	GAACGCCGCATACAGGCT	NA	NA	NA	NA
AVR22801.1|2644502_2645294_-	restriction endonuclease subunit M	NA	C7BGE1	Burkholderia_phage	89.4	8.8e-143
AVR22802.1|2645463_2645958_-	DUF2514 domain-containing protein	NA	C7BGD9	Burkholderia_phage	51.9	4.7e-33
AVR22803.1|2645954_2646449_-	glycoside hydrolase	NA	Q6J1Q5	Burkholderia_virus	89.0	1.3e-78
AVR22804.1|2646451_2646736_-|holin	holin	holin	C7BGD7	Burkholderia_phage	94.7	1.0e-40
AVR22805.1|2646808_2647861_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	49.0	1.1e-84
AVR22806.1|2647871_2648078_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	2.6e-14
AVR22807.1|2648052_2648934_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.2	2.7e-31
AVR22808.1|2648945_2651363_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.7	7.5e-60
AVR22809.1|2651418_2651748_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVR22810.1|2651830_2652334_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	48.1	5.1e-43
AVR22811.1|2652344_2653514_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	2.6e-159
AVR22812.1|2653610_2654129_-|tail	phage tail protein	tail	A0A068Q7U2	Ralstonia_phage	57.3	3.4e-34
AVR22813.1|2654333_2655638_-	hypothetical protein	NA	E5E3Q7	Burkholderia_phage	71.1	6.1e-48
AVR22814.1|2655634_2656204_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	44.8	1.7e-31
AVR22815.1|2656193_2657087_-|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	37.7	5.4e-48
AVR22816.1|2657083_2657428_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	2.7e-24
AVR22817.1|2657424_2657622_-	hypothetical protein	NA	NA	NA	NA	NA
AVR23671.1|2657708_2658434_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22818.1|2658557_2659238_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	30.7	2.6e-18
AVR22819.1|2659234_2659762_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	40.3	2.5e-24
AVR22820.1|2659754_2660282_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	31.6	1.5e-21
AVR22821.1|2660287_2660578_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22822.1|2660579_2661575_-|capsid	minor capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.6	5.2e-116
AVR22823.1|2661648_2661993_-|head	head decoration protein	head	NA	NA	NA	NA
AVR22824.1|2662017_2663091_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.9	2.2e-51
AVR22825.1|2663087_2664578_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.6	6.1e-137
AVR22826.1|2664574_2664781_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22827.1|2666954_2667257_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22828.1|2667401_2667596_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22829.1|2667667_2667994_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22830.1|2668526_2669300_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22831.1|2669522_2672030_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.6	1.2e-95
AVR23672.1|2672290_2672674_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22832.1|2672660_2673206_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.2	3.4e-29
AVR22833.1|2673291_2673513_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	57.4	4.6e-09
AVR22834.1|2674108_2674363_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22835.1|2674511_2674730_+	hypothetical protein	NA	NA	NA	NA	NA
AVR23673.1|2674779_2675142_+	beta-hexosaminidase	NA	NA	NA	NA	NA
AVR22836.1|2675141_2676446_+	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
AVR22837.1|2676547_2676901_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22838.1|2676897_2677203_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22839.1|2677199_2677430_+	hypothetical protein	NA	NA	NA	NA	NA
AVR22840.1|2677485_2677890_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22841.1|2678883_2679615_-	hypothetical protein	NA	NA	NA	NA	NA
AVR22842.1|2679771_2680869_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.4	1.5e-44
2685840:2685857	attR	AGCCTGTATGCGGCGTTC	NA	NA	NA	NA
